Author: "Ivask M" / Publication Year Range: Last 10 years - Searchworks@Jio Institute Digital Library Search Results

Your search keyword '"Ivask M"' showing total 50 results

Start Over Author "Ivask M" Publication Year Range Last 10 years

50 results on '"Ivask M"'

1. Genetic parameters for bull effects on in vitro embryo production (IVP) and relationship between semen quality traits and IVP performance

Author: Gebreyesus, G., Secher, J. B., Lund, M. S., Kupisiewicz, K., Ivask, M., Hallap, T., Pärn, P., Su, G., Gebreyesus, G., Secher, J. B., Lund, M. S., Kupisiewicz, K., Ivask, M., Hallap, T., Pärn, P., and Su, G.
Abstract: In vitro production of embryos (IVP) is increasingly applied in dairy cattle breeding and promises widespread use of females of superior genetic merits. One of the current challenges with implementation of IVP is the variability in blastocyst rates. Several factors contribute to these variabilities, among which is known to be the bull used for oocytes fertilization. The extent of genetic control of bulls’ effect on IVP performances is yet to be investigated. This study estimates genetic parameters for bull effects on IVP performance traits including blastocyst rate, hatching rate and an index trait combining Blastocyst rate, Kinetic Score, and Morphology score (BL_M_K). The IVP experiments were performed using oocytes aspirated from slaughterhouse ovaries from Holstein cows, fertilized with semen from 123 Holstein bulls. A total of 77 in vitro fertilization (IVF) experiments with 163 records (different IVF groups) were available for the analysis. The results indicate low to moderate heritability and moderate to high repeatability estimates for bull effects on IVP performance traits. Our study also showed that some semen quality traits had significant effects on IVP performance. This included strong genetic correlations between pre-cryopreservation sperm viability and blastocyst rate as well as BL_M_K score at days 7 and 8. Despite the generally weak bull effect correlations and the high standard errors of the estimates, our results provide initial evidence of a measurable genetic component in the bull's impact on IVP performance traits. However, the high standard errors underscore the need for further studies with a larger sample size.
Published: 2024

2. Global fine-resolution data on springtail abundance and community structure

Author: Potapov, A. M., Chen, T. -W., Striuchkova, A. V., Alatalo, J. M., Alexandre, D., Arbea, J., Ashton, T., Ashwood, F., Babenko, A. B., Bandyopadhyaya, I., Baretta, C. R. D. M., Baretta, D., Barnes, A. D., Bellini, B. C., Bendjaballah, M., Berg, M. P., Bernava, V., Bokhorst, S., Bokova, A. I., Bolger, T., Bouchard, M., Brito, R. A., Buchori, D., Castano-Meneses, G., Chauvat, M., Chomel, M., Chow, Y., Chown, S. L., Classen, A. T., Cortet, J., Cuchta, P., de la Pedrosa, A. M., De Lima, E. C. A., Deharveng, L. E., Doblas Miranda, E., Drescher, J., Eisenhauer, N., Ellers, J., Ferlian, O., Ferreira, S. S. D., Ferreira, A. S., Fiera, C., Filser, J., Franken, O., Fujii, S., Koudji, E. G., Gao, M., Gendreau-Berthiaume, B., Gers, C., Greve, M., Hamra-Kroua, S., Handa, I. T., Hasegawa, M., Heiniger, C., Hishi, T., Holmstrup, M., Homet, P., Hoye, T. T., Ivask, M., Jacques, B., Janion-Scheepers, C., Jochum, M., Joimel, S., Jorge, B. C. S., Jucevica, E., Kapinga, E. M., Kovac, L., Krab, E. J., Krogh, P. H., Kuu, A., Kuznetsova, N., Lam, W. N., Lin, D., Lindo, Z., Liu, A. W. P., Lu, J. -Z., Lucianez, M. J., Marx, M. T., Mawan, A., Mccary, M. A., Minor, M. A., Mitchell, G. I., Moreno, D., Nakamori, T., Negri, Ilaria, Nielsen, U. N., Ochoa-Hueso, R., Oliveira Filho, L. C. I., Palacios-Vargas, J. G., Pollierer, M. M., Ponge, J. -F., Potapov, M. B., Querner, P., Rai, B., Raschmanova, N., Rashid, M. I., Raymond-Leonard, L. J., Reis, A. S., Ross, G. M., Rousseau, L., Russell, D. J., Saifutdinov, R. A., Salmon, S., Santonja, M., Saraeva, A. K., Sayer, E. J., Scheunemann, N., Scholz, C., Seeber, J., Shaw, P., Shveenkova, Y. B., Slade, E. M., Stebaeva, S., Sterzynska, M., Sun, X., Susanti, W. I., Taskaeva, A. A., Tay, L. S., Thakur, M. P., Treasure, A. M., Tsiafouli, M., Twala, M. N., Uvarov, A. V., Venier, L. A., Widenfalk, L. A., Widyastuti, R., Winck, B., Winkler, D., Wu, D., Xie, Z., Yin, R., Zampaulo, R. A., Zeppelini, D., Zhang, B., Zoughailech, A., Ashford, O., Klauberg-Filho, O., Scheu, S., Negri I. (ORCID:0000-0001-5188-1408), Potapov, A. M., Chen, T. -W., Striuchkova, A. V., Alatalo, J. M., Alexandre, D., Arbea, J., Ashton, T., Ashwood, F., Babenko, A. B., Bandyopadhyaya, I., Baretta, C. R. D. M., Baretta, D., Barnes, A. D., Bellini, B. C., Bendjaballah, M., Berg, M. P., Bernava, V., Bokhorst, S., Bokova, A. I., Bolger, T., Bouchard, M., Brito, R. A., Buchori, D., Castano-Meneses, G., Chauvat, M., Chomel, M., Chow, Y., Chown, S. L., Classen, A. T., Cortet, J., Cuchta, P., de la Pedrosa, A. M., De Lima, E. C. A., Deharveng, L. E., Doblas Miranda, E., Drescher, J., Eisenhauer, N., Ellers, J., Ferlian, O., Ferreira, S. S. D., Ferreira, A. S., Fiera, C., Filser, J., Franken, O., Fujii, S., Koudji, E. G., Gao, M., Gendreau-Berthiaume, B., Gers, C., Greve, M., Hamra-Kroua, S., Handa, I. T., Hasegawa, M., Heiniger, C., Hishi, T., Holmstrup, M., Homet, P., Hoye, T. T., Ivask, M., Jacques, B., Janion-Scheepers, C., Jochum, M., Joimel, S., Jorge, B. C. S., Jucevica, E., Kapinga, E. M., Kovac, L., Krab, E. J., Krogh, P. H., Kuu, A., Kuznetsova, N., Lam, W. N., Lin, D., Lindo, Z., Liu, A. W. P., Lu, J. -Z., Lucianez, M. J., Marx, M. T., Mawan, A., Mccary, M. A., Minor, M. A., Mitchell, G. I., Moreno, D., Nakamori, T., Negri, Ilaria, Nielsen, U. N., Ochoa-Hueso, R., Oliveira Filho, L. C. I., Palacios-Vargas, J. G., Pollierer, M. M., Ponge, J. -F., Potapov, M. B., Querner, P., Rai, B., Raschmanova, N., Rashid, M. I., Raymond-Leonard, L. J., Reis, A. S., Ross, G. M., Rousseau, L., Russell, D. J., Saifutdinov, R. A., Salmon, S., Santonja, M., Saraeva, A. K., Sayer, E. J., Scheunemann, N., Scholz, C., Seeber, J., Shaw, P., Shveenkova, Y. B., Slade, E. M., Stebaeva, S., Sterzynska, M., Sun, X., Susanti, W. I., Taskaeva, A. A., Tay, L. S., Thakur, M. P., Treasure, A. M., Tsiafouli, M., Twala, M. N., Uvarov, A. V., Venier, L. A., Widenfalk, L. A., Widyastuti, R., Winck, B., Winkler, D., Wu, D., Xie, Z., Yin, R., Zampaulo, R. A., Zeppelini, D., Zhang, B., Zoughailech, A., Ashford, O., Klauberg-Filho, O., Scheu, S., and Negri I. (ORCID:0000-0001-5188-1408)
Abstract: Springtails (Collembola) inhabit soils from the Arctic to the Antarctic and comprise an estimated ~32% of all terrestrial arthropods on Earth. Here, we present a global, spatially-explicit database on springtail communities that includes 249,912 occurrences from 44,999 samples and 2,990 sites. These data are mainly raw sample-level records at the species level collected predominantly from private archives of the authors that were quality-controlled and taxonomically-standardised. Despite covering all continents, most of the sample-level data come from the European continent (82.5% of all samples) and represent four habitats: woodlands (57.4%), grasslands (14.0%), agrosystems (13.7%) and scrublands (9.0%). We included sampling by soil layers, and across seasons and years, representing temporal and spatial within-site variation in springtail communities. We also provided data use and sharing guidelines and R code to facilitate the use of the database by other researchers. This data paper describes a static version of the database at the publication date, but the database will be further expanded to include underrepresented regions and linked with trait data.
Published: 2024

3. P-422 Ovarian tissue vitrification as a low-technology and cost-effective protocol for female fertility preservation: a bovine study

Author: Deligiannis, S P, primary, Kask, K, additional, Modhukur, V, additional, Ivask, M, additional, Jaakma, Ü, additional, Damdimopoulou, P, additional, Tuuri, T, additional, Velthut-Meikas, A, additional, and Salumets, A, additional
Published: 2023
Full Text: View/download PDF

4. Globally invariant metabolism but density-diversity mismatch in springtails

Author: Potapov, A. M., Guerra, C. A., van den Hoogen, J., Babenko, A., Bellini, B. C., Berg, M. P., Chown, S. L., Deharveng, L., Kováč, Ľ., Kuznetsova, N. A., Ponge, J. F., Potapov, M. B., Russell, D. J., Alexandre, D., Alatalo, J. M., Arbea, J. I., Bandyopadhyaya, I., Bernava, V., Bokhorst, S., Bolger, T., Castaño-Meneses, G., Chauvat, M., Chen, T. W., Chomel, M., Classen, A. T., Cortet, J., Čuchta, P., Manuela de la Pedrosa, A., Ferreira, S. S. D., Fiera, C., Filser, J., Franken, O., Fujii, S., Koudji, E. G., Gao, M., Gendreau-Berthiaume, B., Gomez-Pamies, D. F., Greve, M., Tanya Handa, I., Heiniger, C., Holmstrup, M., Homet, P., Ivask, M., Janion-Scheepers, C., Jochum, M., Joimel, S., Claudia, S. Jorge B., Jucevica, E., Ferlian, O., Iuñes de Oliveira Filho, L. C., Klauberg-Filho, O., Baretta, D., Krab, E. J., Kuu, A., de Lima, E. C. A., Lin, D., Lindo, Z., Liu, A., Lu, J. Z., Luciañez, M. J., Marx, M. T., Mccary, M. A., Minor, M. A., Nakamori, T., Negri, Ilaria, Ochoa-Hueso, R., Palacios-Vargas, J. G., Pollierer, M. M., Querner, P., Raschmanová, N., Rashid, M. I., Raymond-Léonard, L. J., Rousseau, L., Saifutdinov, R. A., Salmon, S., Sayer, E. J., Scheunemann, N., Scholz, C., Seeber, J., Shveenkova, Y. B., Stebaeva, S. K., Sterzynska, M., Sun, X., Susanti, W. I., Taskaeva, A. A., Thakur, M. P., Tsiafouli, M. A., Turnbull, M. S., Twala, M. N., Uvarov, A. V., Venier, L. A., Widenfalk, L. A., Winck, B. R., Winkler, D., Wu, D., Xie, Z., Yin, R., Zeppelini, D., Crowther, T. W., Eisenhauer, N., Negri I. (ORCID:0000-0001-5188-1408), Potapov, A. M., Guerra, C. A., van den Hoogen, J., Babenko, A., Bellini, B. C., Berg, M. P., Chown, S. L., Deharveng, L., Kováč, Ľ., Kuznetsova, N. A., Ponge, J. F., Potapov, M. B., Russell, D. J., Alexandre, D., Alatalo, J. M., Arbea, J. I., Bandyopadhyaya, I., Bernava, V., Bokhorst, S., Bolger, T., Castaño-Meneses, G., Chauvat, M., Chen, T. W., Chomel, M., Classen, A. T., Cortet, J., Čuchta, P., Manuela de la Pedrosa, A., Ferreira, S. S. D., Fiera, C., Filser, J., Franken, O., Fujii, S., Koudji, E. G., Gao, M., Gendreau-Berthiaume, B., Gomez-Pamies, D. F., Greve, M., Tanya Handa, I., Heiniger, C., Holmstrup, M., Homet, P., Ivask, M., Janion-Scheepers, C., Jochum, M., Joimel, S., Claudia, S. Jorge B., Jucevica, E., Ferlian, O., Iuñes de Oliveira Filho, L. C., Klauberg-Filho, O., Baretta, D., Krab, E. J., Kuu, A., de Lima, E. C. A., Lin, D., Lindo, Z., Liu, A., Lu, J. Z., Luciañez, M. J., Marx, M. T., Mccary, M. A., Minor, M. A., Nakamori, T., Negri, Ilaria, Ochoa-Hueso, R., Palacios-Vargas, J. G., Pollierer, M. M., Querner, P., Raschmanová, N., Rashid, M. I., Raymond-Léonard, L. J., Rousseau, L., Saifutdinov, R. A., Salmon, S., Sayer, E. J., Scheunemann, N., Scholz, C., Seeber, J., Shveenkova, Y. B., Stebaeva, S. K., Sterzynska, M., Sun, X., Susanti, W. I., Taskaeva, A. A., Thakur, M. P., Tsiafouli, M. A., Turnbull, M. S., Twala, M. N., Uvarov, A. V., Venier, L. A., Widenfalk, L. A., Winck, B. R., Winkler, D., Wu, D., Xie, Z., Yin, R., Zeppelini, D., Crowther, T. W., Eisenhauer, N., and Negri I. (ORCID:0000-0001-5188-1408)
Abstract: Soil life supports the functioning and biodiversity of terrestrial ecosystems. Springtails (Collembola) are among the most abundant soil arthropods regulating soil fertility and flow of energy through above- and belowground food webs. However, the global distribution of springtail diversity and density, and how these relate to energy fluxes remains unknown. Here, using a global dataset representing 2470 sites, we estimate the total soil springtail biomass at 27.5 megatons carbon, which is threefold higher than wild terrestrial vertebrates, and record peak densities up to 2 million individuals per square meter in the tundra. Despite a 20-fold biomass difference between the tundra and the tropics, springtail energy use (community metabolism) remains similar across the latitudinal gradient, owing to the changes in temperature with latitude. Neither springtail density nor community metabolism is predicted by local species richness, which is high in the tropics, but comparably high in some temperate forests and even tundra. Changes in springtail activity may emerge from latitudinal gradients in temperature, predation and resource limitation in soil communities. Contrasting relationships of biomass, diversity and activity of springtail communities with temperature suggest that climate warming will alter fundamental soil biodiversity metrics in different directions, potentially restructuring terrestrial food webs and affecting soil functioning.
Published: 2023

5. 487. Bull effects on in vitro embryo production quality traits are repeatable and heritable

Author: Gebreyesus, G., primary, Secher, J.B., additional, Lund, M.S., additional, Kupisiewicz, K., additional, Ivask, M., additional, and Su, G., additional
Published: 2022
Full Text: View/download PDF

6. 115 Detecting embryo developmental potential by single blastomere RNA-seq

Author: Nõmm, M., primary, Ivask, M., additional, Pärn, P., additional, Reimann, E., additional, JaakmaÜ, Ü., additional, and Kõks, S., additional
Published: 2022
Full Text: View/download PDF

7. Reduced corneal sensitivity with neuronal degeneration is a novel clinical feature in Wolfram Syndrome

Author: Waszczykowska, A., Zmysłowska, A., Bartosiewicz, K., Studzian, M., Pułaski, L., Braun, M., Ivask, M., Kõks, S., Jurowski, P., Młynarski, W., Waszczykowska, A., Zmysłowska, A., Bartosiewicz, K., Studzian, M., Pułaski, L., Braun, M., Ivask, M., Kõks, S., Jurowski, P., and Młynarski, W.
Abstract: PURPOSE To evaluate corneal sensitivity and corneal nerve morphology among patients with Wolfram syndrome (WFS). DESIGN An observational clinical case series with confirmatory experiments. METHODS We included a group of 12 patients with biallelic mutations in the WFS1 gene and a control group composed of 30 individuals with type 1 diabetes (T1D). All participants (n = 42) underwent a complete ophthalmic examination, esthesiometry, and retinal nerve fiber layer assessment using optical coherence tomography. Morphologic assessment of corneal neuropathy by in vivo corneal confocal microscopy was conducted in 11 patients with WFS (both eyes) and 1 WFS patient (1 eye) as well as in 24 patients with T1D (both eyes in 6 patients and 1 eye in 18 patients). Additionally, corneas from Wfs1KO mice and their wild-type littermates were subjected to laser scanning confocal microscopy. RESULTS Corneal sensitivity was significantly reduced in patients with WFS compared with patients with T1D (4.50 cm [interquartile range, 3.50–5.50 cm] vs 6.00 cm [interquartile range, 6.00–6.00 cm]; P < 10–5). Additionally, corneal nerve fiber and branch density as well as nerve fiber length were low among patients with WFS. Corneal sensitivity correlated with macular average thickness (R = 0.6928; P = .039) and best-corrected visual acuity (R = –0.61; P = .002) in the WFS group. Similarly, Wfs1 knockout mice also presented corneal neurodegeneration changes when corneal nerve fiber density and length were measured using laser scanning confocal microscopy. CONCLUSIONS Decreased corneal sensitivity and corneal nerve degeneration are observed in WFS. Corneal sensitivity is linked with the degree of disease progression as measured by visual acuity and retinal thinning.
Published: 2022

8. High-fat diet associated sensitization to metabolic stress in Wfs1 heterozygous mice

Author: Ivask, M., Volke, V., Raasmaja, A., Kõks, S., Ivask, M., Volke, V., Raasmaja, A., and Kõks, S.
Abstract: Wolfram syndrome is a rare autosomal recessive disorder caused by mutations in the wolframin ER transmembrane glycoprotein (WFS1) gene and characterized by diabetes mellitus, diabetes insipidus, optic atrophy and deafness. In experimental models the homozygous Wfs1 mutant mice have a full penetrance and clearly expressed phenotype, whereas heterozygous mutants have a less-pronounced phenotype between the wild-type and homozygous mutant mice. Heterozygous WFS1 mutations have been shown to be significant risk factors for diabetes and metabolic disorders in humans. In the present study we analyzed the response of heterozygous Wfs1 mice to high fat diet (HFD) by exploring potential outcomes and molecular changes induced by this challenge. The HFD treatment increased the body weight (BW) similarly both in Wfs1 wild-type (WT) and heterozygous (HZ) mice, and therefore HFD also prevented the impaired BW gain found in Wfs1 mutant mice. In Wfs1HZ mutant mice, HFD impaired the normalized insulin secretion and the expression of ER stress genes in isolated pancreatic islets. These results suggest that Wfs1HZ mice have a decreased insulin response and pronounced cellular stress response due to a higher sensitivity to HFD as hypothesized. In Wfs1HZ mice, HFD increased the expression of Ire1α and Chop in pancreas and decreased that of Ire1α and Atf4 in liver. The present study shows that HFD can disturb insulin function with an increased ER stress in Wfs1HZ mice and only one functional Wfs1 gene copy is not sufficient to compensate this challenge. In conclusion, our study indicates that quantitative Wfs1 gene deficiency is sufficient to predispose the carriers of single functional Wfs1 copy to diabetes and metabolic syndrome and makes them susceptible to the environmental challenges such as HFD.
Published: 2021

9. Multiple Retinal Anomalies in Wfs1-Deficient Mice

Author: Waszczykowska, A., Zmysłowska, A., Braun, M., Ivask, M., Kõks, S., Jurowski, P., Młynarski, W., Waszczykowska, A., Zmysłowska, A., Braun, M., Ivask, M., Kõks, S., Jurowski, P., and Młynarski, W.
Abstract: Background: Wolfram syndrome (WFS, OMIM: #222300) is an ultrarare autosomal recessive disorder characterized by diabetes insipidus, diabetes mellitus, optic nerve atrophy and deafness. It has been reported that the average retinal thickness in WFS patients decreases with the progression of the disease. Aim: To investigate retinal thickness and wolframin expression disorders in Wolfram syndrome 1 gene knockout (Wfs1KO) mice compared to their wild-type (WT) littermates. Materials and methods: Both bulbs with optic nerves of three mice Wfs1WT and three Wfs1KO were taken for the histopathological examination. A strain of knockout mice with mutation in exon 8 was used. Results: No expression of wolframin protein in the retina and neurodegeneration of the optic nerve of Wfs1KO mice as compared among Wfs1WT mice was observed. The mean central retinal thickness was thinner and the retinal thickness/longitudinal diameter ratio was significantly lower in hte Wfs1KO as compared to the Wfs1WT mice. In four (67%) eyeballs of Wfs1KO mice, intra-retinal neovessels were observed. Conclusions: Wfs1KO mice retina with mutation in exon 8 present similar clinical features as patients with WFS in the form of reduced retinal thickness and neurodegeneration of the optic nerve. The presence of proliferative retinopathy observed in Wfs1KO mice requires further investigation.
Published: 2020

10. Corneal abnormalities are novel clinical feature in Wolfram Syndrome

Author: Waszczykowska, A., Zmysłowska, A., Braun, M., Zielonka, E., Ivask, M., Kõks, S., Jurowski, P., Młynarski, W., Waszczykowska, A., Zmysłowska, A., Braun, M., Zielonka, E., Ivask, M., Kõks, S., Jurowski, P., and Młynarski, W.
Abstract: Purpose To evaluate corneal morphology among patients with Wolfram syndrome (WFS). Design Comparative observational longitudinal case series of WFS patients with a laboratory approach in the WFS1 gene knockout (Wfs1KO) mouse model. Methods A group of 12 patients with biallelic mutations in the WFS1 gene recruited from the whole country and a control group composed of 30 individuals with type 1 diabetes (T1D) were evaluated in a national reference center for monogenic diabetes. All subjects (n = 42) underwent a complete ophthalmic examination, computer videokeratography, and corneal thickness and endothelial measurements. Additionally, WFS patients (n = 9) underwent longitudinal videokeratography and Pentacam evaluation. Corneal characteristics were assessed and compared between both groups. Human and mouse corneas were subjected to immunohistochemistry to detect wolframin expression and microscopic evaluation to study corneal morphology ex vivo. Results Clinical and topographic abnormalities similar to keratoconus were observed in 14 eyes (58.3%) of 8 WFS patients (66.7%). Flat keratometry, inferior-superior dioptric asymmetry, skewed radial axis, logarithm of keratoconus percentage index, index of surface variance, index of vertical asymmetry, keratoconus index, central keratoconus index, index of height asymmetry, and index of height decentration differed between WFS and T1D patients. Immunohistochemistry demonstrated wolframin expression in human and mouse corneas. Compared with Wfs1WT mice, Wfs1KO mice also presented corneal abnormalities. Conclusions Patients with WFS present a high prevalence of changes in corneal morphology compatible with the diagnosis of early stages of keratoconus. Observations in a mouse model suggest that a mutation in the WFS1 gene may be responsible for corneal abnormalities similar to keratoconus.
Published: 2020

11. On the degradation of metformin and carbamazepine residues in sewage sludge compost

Author: Merike Lillenberg, Haiba, E., Nei, L., Herodes, K., Ivask, M., and Estonian University of Life Sciences
Subjects: sawdust, fertilizers, carbamazepine, fungi, articles, article, arbamazepine, metformin, complex mixtures, sewage sludge compost
Abstract: Article Recent decades have shown intensive studies devoted to the fate of pharmaceuticals in the environment. These studies have involved the development of analytical tools, determination of pharmaceuticals in different compartments, composting technologies, and plant uptake of pharmaceuticals. The presence of organic pollutants in sewage sludge, including pharmaceuticals, is a problem of major concern. The r e - use of sewage sludge should be encouraged since it represents a long - term solution provided that the quality of the sludge re - used is compatible with public health and environmental protection requirements. Composting is a widely recognized way of making the soil application of sewage sludge safer. In this study, the impact of sewage sludge composting on the degradation of metformin (MET), by far the most often prescribed antidiabetic drug worldwide, and carbamazepine (CBZ), a poorly biodegradable but wid ely used as an anticonvulsant drug to cure depression and seizures, were analysed. The anaerobically digested and dewatered sewage sludge samples were collected from municipal wastewater treatment plant. Composting experiments were performed under fixed co nditions during 30 days. The results of the experiment showed that during a 1 - month composting period more than 90% of MET residues degraded, but no degradation of CBZ took place during the composting period. The half - life of MET was 3 days for the compost mixture with the ratios of 1:3 and 1:2 (v:v). The results of this study show that composting maylead to the efficient degradation of MET, whereas for the elimination of CBZ from sewage sludge different means should be used.
Published: 2018
Full Text: View/download PDF

12. Proteomic dataset of wolframin-deficient mouse heart and skeletal muscles

Author: Eimre, M., Kasvandik, S., Ivask, M., Kõks, S., Eimre, M., Kasvandik, S., Ivask, M., and Kõks, S.
Abstract: The data presented in this article are related to the research article entitled "Increased Mitochondrial Protein Levels and Bioenergetics in the musculus rectus femoris of Wfs1-Deficient mice" (Eimre et al., accepted for publication). This dataset reports the analysis of Wfs1-deficient mouse heart, musculus soleus, and white part of musculus rectus femoris by liquid chromatography/tandem mass spectrometry. Label-free quantitative analysis of the mass spectrometry data identified 4056 proteins, with 114, 212, and 1290 proteins differentially expressed (t-test; p < 0.05) in the heart, m. soleus, and m. rectus femoris, respectively, between the Wfs1-deficient and wild-type groups. Eight proteins were found to be differentially expressed in all mentioned muscles, with 1 protein differently expressed in oxidative (m. soleus and heart) and 88 in skeletal muscles. This dataset supports the cited study and can be used to extend additional analyses. Data are available via ProteomeXchange with identifier PXD011019.
Published: 2018

13. Hippocampus and Hypothalamus RNA-sequencing of WFS1-deficient Mice

Author: Ivask, M., Pajusalu, S., Reimann, E., Kõks, S., Ivask, M., Pajusalu, S., Reimann, E., and Kõks, S.
Abstract: Wolfram syndrome is caused by mutations in the WFS1 gene. WFS1 protein dysfunction results in a range of neuroendocrine syndromes and is mostly characterized by juvenile-onset diabetes mellitus and optic atrophy. WFS1 has been shown to participate in membrane trafficking, protein processing and Ca2+ homeostasis in the endoplasmic reticulum. Aim of the present study was to find the transcriptomic changes influenced by WFS1 in the hypothalamus and hippocampus using RNA-sequencing. The WFS1-deficient mice were used as a model system to analyze the changes in transcriptional networks. The number of differentially expressed genes between hypothalami of WFS1-deficient (Wfs1KO) and wild-type (WT) mice was 43 and between hippocampi 311 with False Discovery Rate (FDR) <0.05. Avpr1a and Avpr1b were significantly upregulated in the hypothalamus and hippocampus of Wfs1KO mice respectively. Trpm8 was the most upregulated gene in the hippocampus of Wfs1KO mice. The functional analysis revealed significant enrichment of networks and pathways associated with protein synthesis, cell-to-cell signaling and interaction, molecular transport, metabolic disease and nervous system development and function. In conclusion, the transcriptomic profiles of WFS1-deficient hypothalamus and hippocampus do indicate the activation of degenerative molecular pathways causing the clinical occurrences typical to Wolfram syndrome.
Published: 2018

14. Increased mitochondrial protein levels and bioenergetics in the musculus rectus femoris of Wfs1-deficient mice

Author: Eimre, M., Paju, K., Peet, N., Kadaja, L., Tarrend, M., Kasvandik, S., Seppet, J., Ivask, M., Orlova, E., Kõks, S., Eimre, M., Paju, K., Peet, N., Kadaja, L., Tarrend, M., Kasvandik, S., Seppet, J., Ivask, M., Orlova, E., and Kõks, S.
Abstract: Wfs1 deficiency leads to a progressive loss of plasma insulin concentration, which should reduce the consumption of glucose in insulin-dependent tissues, causing a variety of changes in intracellular energy metabolism. Our objective here was to assess the changes in the amount and function of mitochondrial proteins in different muscles of Wfs1-deficient mice. Mitochondrial functions were assayed by high-resolution oxygraphy of permeabilized muscle fibers; the protein amount was evaluated by liquid chromatography tandem mass spectrometry (LC/MS/MS) analysis and mRNA levels of the uncoupler proteins UCP2 and UCP3 by real-time PCR; and citrate synthase (CS) activity was determined spectrophotometrically in muscle homogenates. Compared to controls, there were no changes in proton leak and citrate synthase activity in the heart and m. soleus tissues of Wfs1-deficient mice, but significantly higher levels of both of these factors were observed in the m. rectus femoris; mitochondrial proteins and mRNA of UCP2 were also higher in the m. rectus femoris. ADP-stimulated state 3 respiration was lower in the m. soleus, remained unchanged in the heart, and was higher in the m. rectus femoris. The mitochondrial protein amount and activity are higher in Wfs1-deficient mice, as are mitochondrial proton leak and oxygen consumption in m. rectus femoris. These changes in muscle metabolism may be important for identifying the mechanisms responsible for Wolfram syndrome and diabetes.
Published: 2018

15. 36 transgenic somatic cell nuclear transfer blastocyst selection with embryo biopsying

Author: Nõmm, M., Ivask, M., Pärn, P., Jaakma, Ü., Kõks, S., Nõmm, M., Ivask, M., Pärn, P., Jaakma, Ü., and Kõks, S.
Abstract: Somatic cell nuclear transfer (SCNT) is, to date, the most used technology producing transgenic (TG) cattle. Depending on the gene construct and transfection method, transfection efficiency may differ greatly. Applying a more intense selection regime after transfection may obliterate the cells. An extended selection affects the passage number and leads to genotypic and phenotypic drift of the cells. We used the pBC1 Milk Expression Vector Kit (cat. no. K270-01, Invitrogen Corp., Carlsbad, CA, USA) to make the expression vector of human FSH (hFSH). For TG fibroblast cell line, the AmaxaTM NucleofectorTM Kit for Primary Fibroblasts (cat. no. VPI-1002, Lonza Grouop, Basel, Switzerland) was used. For TG fibroblast selection, G418 (neomycin) was used for 21 days with a final concentration of 400 µg mL−1. The final passage number of the cell line was 6. The primers included in the pBC1 Milk Expression Vector Kit-BCF (GATTGACAAGTAATACGCTGTTTCCTC) and BCR (CATCAGAAGTTAAACAGCACAGTTAG)-were used to control the insert. The transgenesis of the cell line was confirmed by sequencing the PCR product and analysing it with the BlastN and Bioedit software to make sure the fibroblast cell line was hFSH-positive. These cells were thereafter randomly used for SCNT as donor cells. All the SCNT embryos were cultured for 4 days in IVF Bioscience (Falmouth, United Kingdom) culture media and then biopsied. After aspirating 1 blastomere from the 6- to 8-cell-stage embryo, the biopsied embryos were further individually cultured until Day 7 and blastocyst formation was recorded. Genomic DNA from the biopsies was isolated and amplified with REPLI-g Single Cell Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. The primers BCF and BCR were used to control the hFSH positivity of the embryos, and the PCR product was visualised on a 1% agarose gel. From 62 biopsied SCNT cloned embryos, 22 (35.48%) tested TG positive. The total blastocyst yield from biopsied embryos was 26 (41.
Published: 2018

16. 36 Transgenic Somatic Cell Nuclear Transfer Blastocyst Selection with Embryo Biopsying

Author: Nõmm, M., primary, Ivask, M., additional, Pärn, P., additional, Jaakma, Ü., additional, and Kõks, S., additional
Published: 2018
Full Text: View/download PDF

17. 124 Cell Count of Bovine In Vitro-Produced Blastocysts After In Vitro Maturation in Glass versus Plastic Vials

Author: Secher, J. O., primary, Hashem, N., additional, Pryor, J. H., additional, Long, C. R., additional, Docherty, J., additional, Avery, B. M., additional, Ivask, M., additional, Hyttel, P., additional, and Strøbech, L. B., additional
Published: 2018
Full Text: View/download PDF

18. Expression of mitochondrial proteins and respiration in muscles of mice with deleted wolframin (wfs1) gene

Author: Orlova, E., Eimre, M., Paju, K., Peet, N., Kadaja, L., Tarrend, M., Kasvandik, S., Ivask, M., Kõks, S., Orlova, E., Eimre, M., Paju, K., Peet, N., Kadaja, L., Tarrend, M., Kasvandik, S., Ivask, M., and Kõks, S.
Abstract: Introduction Mice models of Wfs1 deficiency allow to study the mechanisms of human Wolfram syndrome. Our aim was to assess the changes in mitochondrial proteins and function in muscles of wfs1‐deficient mice. Materials and methods Samples of heart, m. soleus and m. rectus femoris of wfs1‐deficient and wild‐type mice. LFQ intensity of proteins was evaluated by nano‐LC‐MS/MS analysis of muscle homogenates, mRNA levels of uncoupler proteins, UCP2 and UCP3, by real‐time PCR method, and citrate synthase activity was determined spectrophotometrically. Mitochondrial function was assayed by high‐resolution oxygraphy of permeabilized muscle fibres. Results Compared with controls, there was no change in proton leak and citrate synthase activity in the wfs1‐deficient heart and m. soleus, but in m. rectus femoris 16.1‐fold (P<0.002) and 1.46‐fold (P<0.05) increases were found respectively. However, oxidative phosphorylation did not change in any muscle group. UCP2 mRNA level was in wfs1‐deficient m. rectus femoris 2.6 times (P<0.05) higher than in wild‐type muscle. UCP3 expression was one order of magnitude lesser than UCP2 and did not differ in muscle groups. The amounts of mitochondrial pyruvate dehydrogenase E1 component subunit alpha and mitochondrial succinate dehydrogenase iron sulphur subunit were in m. rectus femoris, compared with the wild type, respectively, 1.69 (P<0.005) and 2.08 times (P<0.0002) larger. Conclusion Wfs1‐deficient mice are characterized by a larger amount and activity of mitochondrial proteins in m. rectus femoris; the proton leak in this muscle was increased probably due to a larger amount of UCP2.
Published: 2017

19. Energy production and transfer in oxidative muscles of mice with deleted wolframin (wfs1) gene

Author: Eimre, M., Paju, K., Peet, N., Kasvandik, S., Orlova, E., Ivask, M., Kõks, S., Eimre, M., Paju, K., Peet, N., Kasvandik, S., Orlova, E., Ivask, M., and Kõks, S.
Abstract: Poster session
Published: 2017

20. Increased proton leak and expression of mitochondria! proteins in white skeletal muscle of mice with deleted wolframin (wfs1) gene

Author: Orlova, E., Eimre, M., Paju, K., Peet, N., Kadaja, L., Tarrend, M., Kasvandik, S., Ivask, M., Kõks, S., Orlova, E., Eimre, M., Paju, K., Peet, N., Kadaja, L., Tarrend, M., Kasvandik, S., Ivask, M., and Kõks, S.
Abstract: Poster abstract
Published: 2017

21. Cold induced Ucp1 expression in brown and white adipose tissue of WFS1-deficient mice

Author: Ehrlich, M., Ivask, M., Kõks, S., Ehrlich, M., Ivask, M., and Kõks, S.
Abstract: Ucp1 expression in brown adipose tissue (BAT) is induced by cold temperatures and is fully consistent with temperature adaptation and thermogenesis. Transcription of the Ucp1 gene is increased within minutes of cold exposure. Beige adipocytes are mainly in the subcutaneous white adipose tissues (WAT) and they arise postnatally in response to chronic cold exposure. This process is often referred as the browning of WAT. The aim of this study was to compare the cold induced metabolic and Ucp1 expression differences between WFS1-deficient mice and their wild-type littermates. Experiments were performed with 2–3 months old male and female F2 hybrids (129S6/SvEvTac × 129S6/SvEvTac). Five to twelve WFS1-deficient mice and wild-type mice were used in the study. Mice were kept at 8–12°C up to 7 days and metabolic effect was measured with calorimetric cages (TSE Phenomaster). Ucp1 expression was measured in BAT and WAT with qPCR (Applied Biosystems). The results of measurements showed that WFS1-deficient mice have significantly higher energy metabolism and higher Ucp1 expression in BAT and WAT after cold exposure. In conclusion, our results show that WFS1-deficient mice have a stronger response to cold exposure and upregulation of Ucp1 in BAT and WAT. Thus suggesting that WFS1-deficient mice have changes in regulation of thermogenesis that should be studied further.
Published: 2017

22. Changes in intracellular energy transfer enzymes in muscles of mice with deleted wolframin (wfs1) gene

Author: Eimre, M., Peet, N., Kadaja, L., Tarrend, M., Kasvandik, S., Orlova, E., Ivask, M., Kõks, S., Eimre, M., Peet, N., Kadaja, L., Tarrend, M., Kasvandik, S., Orlova, E., Ivask, M., and Kõks, S.
Abstract: Introduction To study the mechanisms of Wolfram syndrome, we assessed the changes in activities, amounts and functional coupling between mitochondria and enzymes involved in the transport of energy in muscles of wfs1‐deficient mice, models of this syndrome. Materials and methods Samples of heart, m. soleus and m. rectus femoris of wfs1‐deficient and wild‐type mice. Real‐time PCR method, spectrophotometry and nano‐LC‐MS/MS analysis of homogenates. Coupling between mitochondria and enzymes was assayed by oxygraphy of permeabilized muscle fibres. Results Compared with wild type, in m. rectus femoris of wfs1‐deficient mice mRNA level of muscle‐type creatine kinase isoform was two times (P<0.05) lower, total activities of creatine and adenylate kinase decreased by 34% (P<0.01) and 48% (P<0.02) respectively. In wfs1‐deficient mice functional coupling of adenylate kinase and mitochondria in heart decreased by 39% (P<0.05), but in m. soleus and m. rectus femoris did not change. Coupling of mitochondria and creatine kinase did not alter in any muscle of wfs1‐deficient mice. The amounts of mitochondrial sarcomeric creatine kinase in wfs1‐deficient m. rectus femoris increased 3.16‐fold (P<0.001) and mitochondrial adenylate kinase 2 2.09‐fold (P<0.01), cytoplasmatic adenylate kinase 1 but 2.12‐fold (P<0.01) decreased compared with wild‐type muscle. Conclusion In hearts of wfs1‐deficient mice, functional coupling of adenylate kinase and mitochondria decreased. Despite the drop in total activities of creatine and adenylate kinase in m. rectus femoris, the functional coupling of mitochondria did not change, because the amounts of mitochondrial isoforms of these enzymes even increased.
Published: 2017

23. Degradation of diclofenac and triclosan residues in sewage sludge compost

Author: Haiba, E., Nei, L., Kutti, S., Lillenberg, M., Herodes, K., Ivask, M., Kipper, K., Aro, Rudolf, Laaniste, A., Haiba, E., Nei, L., Kutti, S., Lillenberg, M., Herodes, K., Ivask, M., Kipper, K., Aro, Rudolf, and Laaniste, A.
Abstract: Land application of sewage sludge compost is an important and efficient tool in the remediation of industrial landscapes and agricultural soils in Estonia. A number of studies have shown that, as a rule, pharmaceuticals and personal care products (PPCPs) are neither completely removed by sewage treatment, nor completely degraded in the environment. In this study, degradation rates of diclofenac sodium (DFC) and triclosan (TCS) were determined during sewage sludge composting. Anaerobically digested and dewatered sewage sludge was mixed with sawdust at two different ratios (1:2 and 1:3 sludge/sawdust, v:v). Then aerobic composting was carried out. These ratios were chosen on the basis of previous studies on sewage sludge composting with different bulking agents. The initial concentration of DFC and TCS was 2 mg kg-1 in relation to dry weight (dw). Low quantities of the studied pharmaceuticals were present in sewage sludge that was used for preparing the compost mixtures used in our experiments. The background concentrations of DFC and TCS were never equal to zero. The results showed that the difference between sewage sludge and bulking agent ratios (1:2 vs 1:3) in compost samples did not significantly affect temperature profiles during the experiment. The degradation of pharmaceuticals was more complete in the compost samples where the ratio of bulking agent was higher (1:3 by volume). The average degradation level (in all compost mixtures) was 95% for DFC and 68% for TCS. Pharmaceuticals entering into the soil may affect microbial activity, plant growth and development, and may have adverse effects on living organisms., Funding Agency:Environmental Investment Centre of Estonia
Published: 2017

24. RNA-sequencing of WFS1-deficient pancreatic islets

Author: Ivask, M., Hugill, A., Kõks, S., Ivask, M., Hugill, A., and Kõks, S.
Abstract: Wolfram syndrome, an autosomal recessive disorder characterized by juvenile‐onset diabetes mellitus and optic atrophy, is caused by mutations in the WFS1 gene. WFS1 encodes an endoplasmic reticulum resident transmembrane protein. The Wfs1‐null mice exhibit progressive insulin deficiency and diabetes. The aim of this study was to describe the insulin secretion and transcriptome of pancreatic islets in WFS1‐deficient mice. WFS1‐deficient (Wfs1KO) mice had considerably less pancreatic islets than heterozygous (Wfs1HZ) or wild‐type (WT) mice. Wfs1KO pancreatic islets secreted less insulin after incubation in 2 and 10 mmol/L glucose and with tolbutamide solution compared to WT and Wfs1HZ islets, but not after stimulation with 20 mmol/L glucose. Differences in proinsulin amount were not statistically significant although there was a trend that Wfs1KO had an increased level of proinsulin. After incubation in 2 mmol/L glucose solution the proinsulin/insulin ratio in Wfs1KO was significantly higher than that of WT and Wfs1HZ. RNA‐seq from pancreatic islets found melastatin‐related transient receptor potential subfamily member 5 protein gene (Trpm5) to be downregulated in WFS1‐deficient mice. Functional annotation of RNA sequencing results showed that WFS1 deficiency influenced significantly the pathways related to tissue morphology, endocrine system development and function, molecular transport network.
Published: 2016

25. Analysis of metabolic effects of menthol on WFS1-deficient mice

Author: Ehrlich, M., Ivask, M., Raasmaja, A., Kõks, S., Ehrlich, M., Ivask, M., Raasmaja, A., and Kõks, S.
Abstract: In this study, we investigated the physiological regulation of energy metabolism in wild‐type (WT) and WFS1‐deficient (Wfs1KO) mice by measuring the effects of menthol treatment on the O2 consumption, CO2 production, rectal body temperature, and heat production. The basal metabolism and behavior was different between these genotypes as well as TRP family gene expressions. Wfs1KO mice had a shorter life span and weighed less than WT mice. The food and water intake of Wfs1KO mice was lower as well as the body temperature when compared to their WT littermates. Furthermore, Wfs1KO mice had higher basal O2 consumption, and CO2 and heat production than WT mice. In addition, Wfs1KO mice showed a higher response to menthol administration in comparison to WT mice. The strongest menthol effect was seen on different physiological measures 12 h after oral administration. The highest metabolic response of Wfs1KO mice was seen at the menthol dose of 10 mg/kg. Menthol increased O2 consumption, and CO2 and heat production in Wfs1KO mice when compared to their WT littermates. In addition, the expression of Trpm8 gene was increased. In conclusion, our results show that the Wfs1KO mice develop a metabolic phenotype characterized with several physiological dysfunctions.
Published: 2016

26. Metabolic effects of menthol on WFS1-deficient mice

Author: Ehrlich, M., Ivask, M., Raasmaja, A., Kõks, S., Ehrlich, M., Ivask, M., Raasmaja, A., and Kõks, S.
Abstract: Previous experiments of RNA sequencing showed that Trpm8 gene was upregulated in the hippocampus of WFS1-deficient mice compared to wild-type littermates. TRPM8 is activated by cold (8–28°C) and chemicals, e.g. menthol, which induce cold sensation. TRP ion channels are used as primary transducers of thermal stimuli for thermosensation. The aim of this study was to compare the metabolic differences and dose-response effects to menthol between WFS1-deficient mice and their wild-type littermates. Experiments were performed with 9–12 months old male F2 hybrids (129S6/SvEvTac x 129S6/SvEvTac). Five to twelve WFS1-deficient mice and wild-type mice were used in the study. Different menthol doses were administrated by oral gavage and metabolic effect was measured with metabolic cages (TSE Phenomaster). The life span of WFS1-deficient and wild-type mice was investigated. The results of measurements showed that WFS1-deficient mice have significantly higher energy metabolism and shorter life span compared to WT mice and specific menthol doses had a significantly higher reaction on the energy metabolism of WFS1-deficient mice compared to WT mice. In conclusion, our results show that the shorter life span, metabolic changes and upregulation of Trpm8 gene in WFS1-deficient mice suggest that WFS1-deficient mice have serious metabolic dysfunctions. Menthol has an opposite effect on the WFS1-deficient mice metabolic parameters by increasing them compared to wild-type mice.
Published: 2016

27. Kloonembrüote ja in vitro viljastatud embrüote RNA sünteesi erinevused

Author: Lilleoja, R., Reimann, E., Nõmm, M., Plaas, M., Ivask, M., Pärn, P., Häling, A., Jaakma, Ü., Kõks, S., Lilleoja, R., Reimann, E., Nõmm, M., Plaas, M., Ivask, M., Pärn, P., Häling, A., Jaakma, Ü., and Kõks, S.
Abstract: Tuuma siirdamise teel kloonimise efektiivsus on väga madal, sageli on elussündide osakaal alla 1%(Watanabe, 2013). Embrüonaalses arengus on väga oluline etapp doonorraku tuuma ümberprogrammeerimine, mis ei pruugi kloonimise puhul toimuda täies ulatuses. Puuduliku ümberprogrammeerimise tulemusena peetub kloonembrüote kasv erinevates arenguetappides ning lõpeb sageli loote surmaga (Chitwood jt, 2013; Graf jt, 2014). Suurem osa probleemidest avaldub varastes arenguetappides. Kuid ka hilisemas arengus võib avalduda kõrvalekaldeid normaalsest arengust–sageli esineb kloontiinuste puhul platsentoomide suurenemist ja nende arvu vähenemist, suurenenud läbimõõduga nabanööri ja ka vasikad ise on keskmisest suuremad. Sellist nähtust nimetatakse suure järglase sündroomiks (Chitwood jt, 2013; Graf jt, 2014).
Published: 2016

28. On the degradation of metformin and carbamazepine residues in sewage sludge compost.

Author: Haiba, E., Nei, L., Herodes, K., Ivask, M., and Lillenberg, M.
Subjects: METFORMIN, CARBAMAZEPINE, SEWAGE sludge, DRUG development, ENVIRONMENTAL protection, HYPOGLYCEMIC agents
Abstract: Recent decades have shown intensive studies devoted to the fate of pharmaceuticals in the environment. These studies have involved the development of analytical tools, determination of pharmaceuticals in different compartments, composting technologies, and plant uptake of pharmaceuticals. The presence of organic pollutants in sewage sludge, including pharmaceuticals, is a problem of major concern. The re-use of sewage sludge should be encouraged since it represents a long-term solution provided that the quality of the sludge re-used is compatible with public health and environmental protection requirements. Composting is a widely recognized way of making the soil application of sewage sludge safer. In this study, the impact of sewage sludge composting on the degradation of metformin (MET), by far the most often prescribed antidiabetic drug worldwide, and carbamazepine (CBZ), a poorly biodegradable but widely used as an anticonvulsant drug to cure depression and seizures, were analysed. The anaerobically digested and dewatered sewage sludge samples were collected from municipal wastewater treatment plant. Composting experiments were performed under fixed conditions during 30 days. The results of the experiment showed that during a 1-month composting period more than 90% of MET residues degraded, but no degradation of CBZ took place during the composting period. The half-life of MET was 3 days for the compost mixture with the ratios of 1:3 and 1:2 (v:v). The results of this study show that composting maylead to the efficient degradation of MET, whereas for the elimination of CBZ from sewage sludge different means should be used. [ABSTRACT FROM AUTHOR]
Published: 2018
Full Text: View/download PDF

29. Sewage sludge composting and fate of pharmaceutical residues - recent studies in Estonia.

Author: Haiba, E., Nei, L., Ivask, M., Peda, J., Järvis, J., Lillenberg, M., Kipper, K., and Herodes, K.
Subjects: SEWAGE sludge composting, WOOD waste, VERMICOMPOSTING, DRUG residues, SULFONAMIDES, SEWAGE purification
Abstract: This review is to reflect the work addressed to the application of biosolids and especially sewage sludge as a resource in composting. A considerable drop in the use of P fertilisers can be followed since early 1990s. Due to this fact crop production in Estonia takes place at the expense of soil phosphorous (P) resources. One of the ways of increasing the fertility of agricultural lands is to use nutrient-rich sewage sludge. Unfortunately, this may cause several undesired consequences due to biological and chemical contaminants. The presence of some widely used pharmaceuticals, as ciprofloxacin (CIP), norfloxacin (NOR), ofloxacin (OFL), sulfadimethoxine (SDM) and sulfamethoxazole (SMX), was evident in sewage sludge of the two Estonian largest cities, Tartu and Tallinn. The concentrations of pharmaceuticals decreased after sewage sludge digestion and composting, but they were still present in detectable amounts. Sewage sludge co-composting experiments with sawdust, peat and straw showed the degradation of fluoroquinolones (FQ) and sulfonamides (SA). Additions of sawdust clearly speeded up this process, whereas the mixtures with peat and straw performed lower abilities to decompose pharmaceutical residues. Novel methodologies were developed and experiments conducted to study the potential accumulation of fluoroquinolones FQs and SAs by food plants. Due to the low adsorption of SAs on soil particles they are 'free' to migrate into plants. Different behaviour is characteristic to FQs as they are accumulated in sludge. Recent years have also shown progress in vermicomposting work and in using compost in afforestation. [ABSTRACT FROM AUTHOR]
Published: 2016

30. Wheat field earthworms under divergent farming systems across a European climate gradient.

Author: Nuutinen V, Briones MJI, Schrader S, Dekemati I, Grujić N, Hyvönen J, Ivask M, Lassen SB, Lloret E, Ollio I, Pérez-Rodríguez P, Simon B, Sutri M, de Sutter N, Brandt KK, Peltoniemi K, Shanskiy M, Waeyenberge L, Martínez-Martínez S, and Fernández-Calviño D
Subjects: Animals, Europe, Soil chemistry, Oligochaeta physiology, Triticum, Climate, Agriculture methods
Abstract: Earthworms are a key faunal group in agricultural soils, but little is known on how farming systems affect their communities across wide climatic gradients and how farming system choice might mediate earthworms' exposure to climate conditions. Here, we studied arable soil earthworm communities on wheat fields across a European climatic gradient, covering nine pedo-climatic zones, from Mediterranean to Boreal (S to N) and from Lusitanian to Pannonian (W to E). In each zone, 20-25 wheat fields under conventional or organic farming were sampled. Community metrics (total abundance, fresh mass, and species richness and composition) were combined with data on climate conditions, soil properties, and field management and analyzed with mixed models. There were no statistically discernible differences between organic and conventional farming for any of the community metrics. The effects of refined arable management factors were also not detected, except for an elevated proportion of subsurface-feeding earthworms when crop residues were incorporated. Soil properties were not significantly associated with earthworm community variations, which in the case of soil texture was likely due to low variation in the data. Pedo-climatic zone was an overridingly important factor in explaining the variation in community metrics. The Boreal zone had the highest mean total abundance (179 individuals m -2 ) and fresh mass (86 g m -2 ) of earthworms while the southernmost Mediterranean zones had the lowest metrics (<1 individual m -2 and <1 g m -2 ). Within each field, species richness was low across the zones, with the highest values being recorded at the Nemoral and North Atlantic zones (mean of 2-3 species per field) and declining from there toward north and south. No litter-dwelling species were found in the southernmost, Mediterranean zones. These regional trends were discernibly related to climate, with the community metrics declining with the increasing mean annual temperature. The current continent-wide warming of Europe and related increase of severe and rapid onsetting droughts will likely deteriorate the living conditions of earthworms, particularly in southern Europe. The lack of interaction between the pedo-climatic zone and the farming system in our data for any of the earthworm community metrics may indicate limited opportunities for alleviating the negative effects of a warming climate in cereal field soils of Europe., (© 2024 The Author(s). Ecological Applications published by Wiley Periodicals LLC on behalf of The Ecological Society of America.)
Published: 2025
Full Text: View/download PDF

31. Molecular cloning of PRD-like homeobox genes expressed in bovine oocytes and early IVF embryos.

Author: Yaşar B, Boskovic N, Ivask M, Weltner J, Jouhilahti EM, Vill P, Skoog T, Jaakma Ü, Kere J, Bürglin TR, Katayama S, Org T, and Kurg A
Subjects: Animals, Cattle, Gene Expression Regulation, Developmental, Embryonic Development genetics, Blastocyst metabolism, Transcription Factors genetics, Transcription Factors metabolism, Oocytes metabolism, Cloning, Molecular, Fertilization in Vitro, Homeodomain Proteins genetics, Homeodomain Proteins metabolism, Genes, Homeobox
Abstract: Background: Embryonic genome activation (EGA) is a critical step in early embryonic development, as it marks the transition from relying on maternal factors to the initiation of transcription from embryo's own genome. The factors associated with EGA are not well understood and need further investigation. PRD-like (PRDL) homeodomain transcription factors (TFs) are considered to play crucial roles in this early event during development but these TFs have evolved differently, even within mammalian lineages. Different numbers of PRDL TFs have been predicted in bovine (Bos taurus); however, their divergent evolution requires species-specific confirmation and functional investigations., Results: In this study, we conducted molecular cloning of mRNAs for the PRDL TFs ARGFX, DUXA, LEUTX, NOBOX, TPRX1, TPRX2, and TPRX3 in bovine oocytes or in vitro fertilized (IVF) preimplantation embryos. Our results confirmed the expression of PRDL TF genes in early bovine development at the cDNA level and uncovered their structures. For each investigated PRDL TF gene, we isolated at least one homeodomain-encoding cDNA fragment, indicative of DNA binding and thus potential role in transcriptional regulation in developing bovine embryos. Additionally, our cDNA cloning approach allowed us to reveal breed-related differences in bovine, as evidenced by the identification of a high number of single nucleotide variants (SNVs) across the PRDL class homeobox genes. Subsequently, we observed the prediction of the 9aa transactivation domain (9aaTAD) motif in the putative protein sequence of TPRX3 leading us to conduct functional analysis of this gene. We demonstrated that the TPRX3 overexpression in bovine fibroblast induces not only protein-coding genes but also short noncoding RNAs involved in splicing and RNA editing. We supported this finding by identifying a shared set of genes between our and published bovine early embryo development datasets., Conclusions: Providing full-length cDNA evidence for previously predicted homeobox genes that belong to PRDL class improves the annotation of the bovine genome. Updating the annotation with seven developmentally-important genes will enhance the accuracy of RNAseq analysis with datasets derived from bovine preimplantation embryos. In addition, the absence of TPRX3 in humans highlights the species-specific and TF-specific regulation of biological processes during early embryo development., (© 2024. The Author(s).)
Published: 2024
Full Text: View/download PDF

32. Investigating the impact of vitrification on bovine ovarian tissue morphology, follicle survival, and transcriptomic signature.

Author: Deligiannis SP, Kask K, Modhukur V, Boskovic N, Ivask M, Jaakma Ü, Damdimopoulou P, Tuuri T, Velthut-Meikas A, and Salumets A
Subjects: Animals, Female, Cattle, Fertility Preservation methods, Cell Proliferation genetics, DNA Damage genetics, Vitrification, Ovarian Follicle growth & development, Ovarian Follicle metabolism, Cryopreservation methods, Transcriptome genetics, Ovary metabolism
Abstract: Purpose: Ovarian tissue cryopreservation is vital for fertility preservation, yet its effect on ovarian tissue follicle survival and transcriptomic signature requires further investigation. This study delves into the effects of vitrification on tissue morphology, function, and transcriptomic changes, helping to find possibilities for vitrification protocol improvements., Methods: Ovarian cortex from 19 bovine animals were used to conduct pre- and post-vitrification culture followed by histological assessment, immunohistochemistry, and TUNEL assay. Follicles' functionality was assessed for viability and growth within the tissue and in isolated cultures. RNA-sequencing of ovarian tissue was used to explore the transcriptomic alterations caused by vitrification., Results: Follicle density, cell proliferation, and DNA damage in ovarian stroma were unaffected by vitrification. However, vitrified cultured tissue exhibited reduced follicle density of primordial/primary and antral follicles, while freshly cultured tissue manifested reduction of antral follicles. Increased stromal cell proliferation and DNA damage occurred in both groups post-culture. Isolated follicles from vitrified tissue exhibited similar viability to fresh follicles until day 4, after which the survival dropped. RNA-sequencing revealed minor effects of vitrification on transcriptomic signatures, while culture induced significant gene expression changes in both groups. The altered expression of WNT and hormonal regulation pathway genes post-vitrification suggests the molecular targets for vitrification protocol refinement., Conclusion: Vitrification minimally affects tissue morphology, follicle density, and transcriptomic signature post-thawing. However, culture revealed notable changes in vitrified tissue samples, including reduced follicle density, decreased isolated follicle survival, and alteration in WNT signalling and ovarian hormonal regulation pathways, highlighted them as possible limitations of the current vitrification protocol., (© 2024. The Author(s).)
Published: 2024
Full Text: View/download PDF

33. Compliance with Pregnancy Prevention Recommendations for Isotretinoin Following the Amendment of the European Union Pregnancy Prevention Program: A Repeat Study in Estonia.

Author: Ivask M, Kurvits K, Uusküla M, Juppo A, Laius O, and Siven M
Abstract: Background: Isotretinoin, indicated for severe acne, is a potent teratogen and therefore contraindicated in pregnancy. Thus, the pregnancy prevention program (PPP) for isotretinoin has been introduced., Objectives: The aim of this study was to assess the concomitant use of isotretinoin and effective contraception and the rate of potential isotretinoin-exposed pregnancies in females of childbearing age in 2017-2020 in Estonia. In addition, we aimed to evaluate whether compliance with the PPP has improved compared with the previous study conducted in Estonia covering the period of 2012-2016., Methods: This retrospective, nationwide study using prescription and healthcare claims data included 2575 females aged 15-45 years who started using isotretinoin between 2017 and 2020., Results: For 64.7% of females of childbearing age, no concurrent use of an effective contraceptive was detected while using isotretinoin. A moderately higher contraceptive coverage (35.3%) was observed compared with the previous study (29.7%) (p < 0.001). Complete contraception coverage was highest in females aged 30-39 years with an adjusted OR of 12.8 (p < 0.001) compared with the age group 15-19 years and 2.47 (p < 0.001) compared with the age group 20-29 years. 17 pregnancies coincided with the isotretinoin treatment-related period. The risk for potential isotretinoin-exposed pregnancy was 6.6 (95% CI 3.9-10.5) per 1000 treated females of childbearing age over the 4-year observation period. The risk for potential isotretinoin-exposed pregnancies per 1000 treated females was 1.0 in females aged 15-19 years, 11.6 in females aged 20-29 years, 8.8 in females aged 30-39 years, and 7.4 in females aged 40-45 years (p = 0.009)., Conclusion: A slight improvement in complete contraceptive coverage during isotretinoin use has not resulted in a decrease in the risk of isotretinoin-exposed pregnancies. The contraceptive usage and risk for pregnancy vary greatly across age groups, suggesting the need for a more targeted approach to improve the effectiveness of the PPP., (© 2023. The Author(s).)
Published: 2024
Full Text: View/download PDF

34. Global fine-resolution data on springtail abundance and community structure.

Author: Potapov AM, Chen TW, Striuchkova AV, Alatalo JM, Alexandre D, Arbea J, Ashton T, Ashwood F, Babenko AB, Bandyopadhyaya I, Baretta CRDM, Baretta D, Barnes AD, Bellini BC, Bendjaballah M, Berg MP, Bernava V, Bokhorst S, Bokova AI, Bolger T, Bouchard M, Brito RA, Buchori D, Castaño-Meneses G, Chauvat M, Chomel M, Chow Y, Chown SL, Classen AT, Cortet J, Čuchta P, de la Pedrosa AM, De Lima ECA, Deharveng LE, Doblas Miranda E, Drescher J, Eisenhauer N, Ellers J, Ferlian O, Ferreira SSD, Ferreira AS, Fiera C, Filser J, Franken O, Fujii S, Koudji EG, Gao M, Gendreau-Berthiaume B, Gers C, Greve M, Hamra-Kroua S, Handa IT, Hasegawa M, Heiniger C, Hishi T, Holmstrup M, Homet P, Høye TT, Ivask M, Jacques B, Janion-Scheepers C, Jochum M, Joimel S, Jorge BCS, Juceviča E, Kapinga EM, Kováč Ľ, Krab EJ, Krogh PH, Kuu A, Kuznetsova N, Lam WN, Lin D, Lindo Z, Liu AWP, Lu JZ, Luciáñez MJ, Marx MT, Mawan A, McCary MA, Minor MA, Mitchell GI, Moreno D, Nakamori T, Negri I, Nielsen UN, Ochoa-Hueso R, Oliveira Filho LCI, Palacios-Vargas JG, Pollierer MM, Ponge JF, Potapov MB, Querner P, Rai B, Raschmanová N, Rashid MI, Raymond-Léonard LJ, Reis AS, Ross GM, Rousseau L, Russell DJ, Saifutdinov RA, Salmon S, Santonja M, Saraeva AK, Sayer EJ, Scheunemann N, Scholz C, Seeber J, Shaw P, Shveenkova YB, Slade EM, Stebaeva S, Sterzynska M, Sun X, Susanti WI, Taskaeva AA, Tay LS, Thakur MP, Treasure AM, Tsiafouli M, Twala MN, Uvarov AV, Venier LA, Widenfalk LA, Widyastuti R, Winck B, Winkler D, Wu D, Xie Z, Yin R, Zampaulo RA, Zeppelini D, Zhang B, Zoughailech A, Ashford O, Klauberg-Filho O, and Scheu S
Subjects: Animals, Ecosystem, Forests, Seasons, Soil, Arthropods
Abstract: Springtails (Collembola) inhabit soils from the Arctic to the Antarctic and comprise an estimated ~32% of all terrestrial arthropods on Earth. Here, we present a global, spatially-explicit database on springtail communities that includes 249,912 occurrences from 44,999 samples and 2,990 sites. These data are mainly raw sample-level records at the species level collected predominantly from private archives of the authors that were quality-controlled and taxonomically-standardised. Despite covering all continents, most of the sample-level data come from the European continent (82.5% of all samples) and represent four habitats: woodlands (57.4%), grasslands (14.0%), agrosystems (13.7%) and scrublands (9.0%). We included sampling by soil layers, and across seasons and years, representing temporal and spatial within-site variation in springtail communities. We also provided data use and sharing guidelines and R code to facilitate the use of the database by other researchers. This data paper describes a static version of the database at the publication date, but the database will be further expanded to include underrepresented regions and linked with trait data., (© 2024. The Author(s).)
Published: 2024
Full Text: View/download PDF

35. Uterine Fluid Extracellular Vesicles Proteome Is Altered During the Estrous Cycle.

Author: Piibor J, Waldmann A, Dissanayake K, Andronowska A, Ivask M, Prasadani M, Kavak A, Kodithuwakku S, and Fazeli A
Subjects: Female, Animals, Cattle, Uterus, Estrous Cycle metabolism, Embryonic Development, Proteome metabolism, Extracellular Vesicles metabolism
Abstract: Uterine environment is tightly and finely regulated via various signaling pathways mediated through endocrine, exocrine, autocrine, juxtacrine, and paracrine mechanisms. In utero signaling processes are paramount for normal and abnormal physiology which involves cell to cell, cells to gametes, cells to embryo, and even interkingdom communications due to presence of uterine microbiota. Extracellular vesicles (EVs) in the uterine fluid (UF) and their cargo components are known to be mediators of in utero signaling and communications. Interestingly, the changes in UF-EV proteome during the bovine estrous cycle and the effects of these differentially enriched proteins on embryo development are yet to be fully discovered. In this study, shotgun quantitative proteomics-based mass spectrometry was employed to compare UF-EV proteomes at day 0, 7, and 16 of the estrous cycle to understand the estrous cycle-dependent dynamics. Furthermore, different phase UF-EVs were supplemented in embryo cultures to evaluate their impact on embryo development. One hundred fifty-nine UF-EV proteins were differentially enriched at different time points indicating the UF-EV proteome is cycle-dependent. Overall, many identified pathways are important for normal uterine functions, early embryo development, and its nutritional needs, such as antioxidant activity, cell morphology and cycle, cellular homeostasis, cell adhesion, and carbohydrate metabolic process. Furthermore, the luteal phase UF-EVs supplementation increased in vitro blastocyst rates from 25.0 ± 5.9% to 41.0 ± 4.0% (p ≤ 0.05). Our findings highlight the importance of bovine UF-EV in uterine communications throughout the estrous cycle. Interestingly, comparison of hormone-synchronized EV proteomes to natural cycle UF-EVs indicated shift of signaling. Finally, UF-EVs can be used to improve embryo production in vitro., Competing Interests: Conflict of interest The authors declare no competing interests., (Copyright © 2023 The Authors. Published by Elsevier Inc. All rights reserved.)
Published: 2023
Full Text: View/download PDF

36. Detecting Embryo Developmental Potential by Single Blastomere RNA-Seq.

Author: Nõmm M, Ivask M, Pärn P, Reimann E, Kõks S, and Jaakma Ü
Subjects: Pregnancy, Female, Animals, Cattle, RNA-Seq, Fertilization in Vitro methods, Embryonic Development genetics, RNA, Messenger, Blastomeres, Preimplantation Diagnosis methods
Abstract: Recent advances in preimplantation embryo diagnostics enable a wide range of applications using single cell biopsy and molecular-based selection techniques without compromising embryo production. This study was conducted to develop a single cell embryo biopsy technique and gene expression analysis method with a very low input volume to ensure normal embryo development and to see if there are differences in gene expression profiles between day-5 biopsied bovine embryos that developed into blastocysts and embryos arrested at morula stage. Out of the 65 biopsied morulae, 32 developed to blastocysts (49.2%). Out of the 13,580 successfully annotated genes, 1204 showed a difference in mRNA expression level. Out of these, 155 genes were expressed in embryos developing to blastocysts. The pathway enrichment analysis revealed significant enrichment in "organelle biogenesis and maintenance", "mRNA splicing" and "mitochondrial translation" pathways. These findings suggest principal differences in gene expression patterns and functional networks of embryos able to reach the blastocyst stage compared to embryos arrested in development. Our preliminary data suggest that single blastomere biopsy and selected gene expression profiles at morula stage could offer additional possibilities for early preimplantation embryo selection before transfer.
Published: 2023
Full Text: View/download PDF

37. Globally invariant metabolism but density-diversity mismatch in springtails.

Author: Potapov AM, Guerra CA, van den Hoogen J, Babenko A, Bellini BC, Berg MP, Chown SL, Deharveng L, Kováč Ľ, Kuznetsova NA, Ponge JF, Potapov MB, Russell DJ, Alexandre D, Alatalo JM, Arbea JI, Bandyopadhyaya I, Bernava V, Bokhorst S, Bolger T, Castaño-Meneses G, Chauvat M, Chen TW, Chomel M, Classen AT, Cortet J, Čuchta P, Manuela de la Pedrosa A, Ferreira SSD, Fiera C, Filser J, Franken O, Fujii S, Koudji EG, Gao M, Gendreau-Berthiaume B, Gomez-Pamies DF, Greve M, Tanya Handa I, Heiniger C, Holmstrup M, Homet P, Ivask M, Janion-Scheepers C, Jochum M, Joimel S, Claudia S Jorge B, Jucevica E, Ferlian O, Iuñes de Oliveira Filho LC, Klauberg-Filho O, Baretta D, Krab EJ, Kuu A, de Lima ECA, Lin D, Lindo Z, Liu A, Lu JZ, Luciañez MJ, Marx MT, McCary MA, Minor MA, Nakamori T, Negri I, Ochoa-Hueso R, Palacios-Vargas JG, Pollierer MM, Querner P, Raschmanová N, Rashid MI, Raymond-Léonard LJ, Rousseau L, Saifutdinov RA, Salmon S, Sayer EJ, Scheunemann N, Scholz C, Seeber J, Shveenkova YB, Stebaeva SK, Sterzynska M, Sun X, Susanti WI, Taskaeva AA, Thakur MP, Tsiafouli MA, Turnbull MS, Twala MN, Uvarov AV, Venier LA, Widenfalk LA, Winck BR, Winkler D, Wu D, Xie Z, Yin R, Zeppelini D, Crowther TW, Eisenhauer N, and Scheu S
Subjects: Humans, Animals, Biodiversity, Tundra, Soil, Ecosystem, Arthropods
Abstract: Soil life supports the functioning and biodiversity of terrestrial ecosystems. Springtails (Collembola) are among the most abundant soil arthropods regulating soil fertility and flow of energy through above- and belowground food webs. However, the global distribution of springtail diversity and density, and how these relate to energy fluxes remains unknown. Here, using a global dataset representing 2470 sites, we estimate the total soil springtail biomass at 27.5 megatons carbon, which is threefold higher than wild terrestrial vertebrates, and record peak densities up to 2 million individuals per square meter in the tundra. Despite a 20-fold biomass difference between the tundra and the tropics, springtail energy use (community metabolism) remains similar across the latitudinal gradient, owing to the changes in temperature with latitude. Neither springtail density nor community metabolism is predicted by local species richness, which is high in the tropics, but comparably high in some temperate forests and even tundra. Changes in springtail activity may emerge from latitudinal gradients in temperature, predation and resource limitation in soil communities. Contrasting relationships of biomass, diversity and activity of springtail communities with temperature suggest that climate warming will alter fundamental soil biodiversity metrics in different directions, potentially restructuring terrestrial food webs and affecting soil functioning., (© 2023. The Author(s).)
Published: 2023
Full Text: View/download PDF

38. Reduced Corneal Sensitivity With Neuronal Degeneration is a Novel Clinical Feature in Wolfram Syndrome.

Author: Waszczykowska A, Zmysłowska A, Bartosiewicz K, Studzian M, Pułaski Ł, Braun M, Ivask M, Koks S, Jurowski P, and Młynarski W
Subjects: Animals, Cornea innervation, Humans, Mice, Microscopy, Confocal methods, Nerve Fibers, Tomography, Optical Coherence methods, Corneal Dystrophies, Hereditary, Diabetes Mellitus, Type 1, Wolfram Syndrome diagnosis, Wolfram Syndrome genetics
Abstract: Purpose: To evaluate corneal sensitivity and corneal nerve morphology among patients with Wolfram syndrome (WFS)., Design: An observational clinical case series with confirmatory experiments., Methods: We included a group of 12 patients with biallelic mutations in the WFS1 gene and a control group composed of 30 individuals with type 1 diabetes (T1D). All participants (n = 42) underwent a complete ophthalmic examination, esthesiometry, and retinal nerve fiber layer assessment using optical coherence tomography. Morphologic assessment of corneal neuropathy by in vivo corneal confocal microscopy was conducted in 11 patients with WFS (both eyes) and 1 WFS patient (1 eye) as well as in 24 patients with T1D (both eyes in 6 patients and 1 eye in 18 patients). Additionally, corneas from Wfs1KO mice and their wild-type littermates were subjected to laser scanning confocal microscopy., Results: Corneal sensitivity was significantly reduced in patients with WFS compared with patients with T1D (4.50 cm [interquartile range, 3.50-5.50 cm] vs 6.00 cm [interquartile range, 6.00-6.00 cm]; P < 10 -5 ). Additionally, corneal nerve fiber and branch density as well as nerve fiber length were low among patients with WFS. Corneal sensitivity correlated with macular average thickness (R = 0.6928; P = .039) and best-corrected visual acuity (R = -0.61; P = .002) in the WFS group. Similarly, Wfs1 knockout mice also presented corneal neurodegeneration changes when corneal nerve fiber density and length were measured using laser scanning confocal microscopy., Conclusions: Decreased corneal sensitivity and corneal nerve degeneration are observed in WFS. Corneal sensitivity is linked with the degree of disease progression as measured by visual acuity and retinal thinning., (Copyright © 2021 Elsevier Inc. All rights reserved.)
Published: 2022
Full Text: View/download PDF

39. An overview of Estonian woodlice (Isopoda, Oniscidea).

Author: Sammet K, Orgusaar G, Ivask M, and Kurina O
Abstract: An overview of the Estonian terrestrial isopod fauna is given, based on literature data and material collected from 1984 to 2021. The identified material consisted of 10915 specimens belonging to 14 species and collected from 172 localities throughout Estonia. In combination with previous data from the literature data, there are now reliable records of 16 species of woodlice from Estonia. Two species, viz. Platyarthrushoffmannseggii Brandt, 1833 and Hyloniscusriparius (C. Koch, 1838), are new for the fauna. The latter has probably colonised Estonia recently and range expansions have been reported elsewhere. The data on Philosciamuscorum (Scopoli, 1763) are dubious, and this species is currently excluded from the Estonian list., (Kaarel Sammet, Getriin Orgusaar, Mari Ivask, Olavi Kurina.)
Published: 2021
Full Text: View/download PDF

40. High-fat diet associated sensitization to metabolic stress in Wfs1 heterozygous mice.

Author: Ivask M, Volke V, Raasmaja A, and Kõks S
Subjects: Animals, Body Weight, Insulin metabolism, Islets of Langerhans physiopathology, Male, Membrane Proteins metabolism, Mice, Wolfram Syndrome genetics, Diet, High-Fat, Heterozygote, Membrane Proteins genetics, Stress, Physiological genetics
Abstract: Wolfram syndrome is a rare autosomal recessive disorder caused by mutations in the wolframin ER transmembrane glycoprotein (WFS1) gene and characterized by diabetes mellitus, diabetes insipidus, optic atrophy and deafness. In experimental models the homozygous Wfs1 mutant mice have a full penetrance and clearly expressed phenotype, whereas heterozygous mutants have a less-pronounced phenotype between the wild-type and homozygous mutant mice. Heterozygous WFS1 mutations have been shown to be significant risk factors for diabetes and metabolic disorders in humans. In the present study we analyzed the response of heterozygous Wfs1 mice to high fat diet (HFD) by exploring potential outcomes and molecular changes induced by this challenge. The HFD treatment increased the body weight (BW) similarly both in Wfs1 wild-type (WT) and heterozygous (HZ) mice, and therefore HFD also prevented the impaired BW gain found in Wfs1 mutant mice. In Wfs1HZ mutant mice, HFD impaired the normalized insulin secretion and the expression of ER stress genes in isolated pancreatic islets. These results suggest that Wfs1HZ mice have a decreased insulin response and pronounced cellular stress response due to a higher sensitivity to HFD as hypothesized. In Wfs1HZ mice, HFD increased the expression of Ire1α and Chop in pancreas and decreased that of Ire1α and Atf4 in liver. The present study shows that HFD can disturb insulin function with an increased ER stress in Wfs1HZ mice and only one functional Wfs1 gene copy is not sufficient to compensate this challenge. In conclusion, our study indicates that quantitative Wfs1 gene deficiency is sufficient to predispose the carriers of single functional Wfs1 copy to diabetes and metabolic syndrome and makes them susceptible to the environmental challenges such as HFD., Competing Interests: Declaration of Competing Interest No conflicts of interest, financial or otherwise, are declared by the author(s)., (Copyright © 2021 Elsevier Inc. All rights reserved.)
Published: 2021
Full Text: View/download PDF

41. Global data on earthworm abundance, biomass, diversity and corresponding environmental properties.

Author: Phillips HRP, Bach EM, Bartz MLC, Bennett JM, Beugnon R, Briones MJI, Brown GG, Ferlian O, Gongalsky KB, Guerra CA, König-Ries B, Krebs JJ, Orgiazzi A, Ramirez KS, Russell DJ, Schwarz B, Wall DH, Brose U, Decaëns T, Lavelle P, Loreau M, Mathieu J, Mulder C, van der Putten WH, Rillig MC, Thakur MP, de Vries FT, Wardle DA, Ammer C, Ammer S, Arai M, Ayuke FO, Baker GH, Baretta D, Barkusky D, Beauséjour R, Bedano JC, Birkhofer K, Blanchart E, Blossey B, Bolger T, Bradley RL, Brossard M, Burtis JC, Capowiez Y, Cavagnaro TR, Choi A, Clause J, Cluzeau D, Coors A, Crotty FV, Crumsey JM, Dávalos A, Cosín DJD, Dobson AM, Domínguez A, Duhour AE, van Eekeren N, Emmerling C, Falco LB, Fernández R, Fonte SJ, Fragoso C, Franco ALC, Fusilero A, Geraskina AP, Gholami S, González G, Gundale MJ, López MG, Hackenberger BK, Hackenberger DK, Hernández LM, Hirth JR, Hishi T, Holdsworth AR, Holmstrup M, Hopfensperger KN, Lwanga EH, Huhta V, Hurisso TT, Iannone BV 3rd, Iordache M, Irmler U, Ivask M, Jesús JB, Johnson-Maynard JL, Joschko M, Kaneko N, Kanianska R, Keith AM, Kernecker ML, Koné AW, Kooch Y, Kukkonen ST, Lalthanzara H, Lammel DR, Lebedev IM, Le Cadre E, Lincoln NK, López-Hernández D, Loss SR, Marichal R, Matula R, Minamiya Y, Moos JH, Moreno G, Morón-Ríos A, Motohiro H, Muys B, Neirynck J, Norgrove L, Novo M, Nuutinen V, Nuzzo V, Mujeeb Rahman P, Pansu J, Paudel S, Pérès G, Pérez-Camacho L, Ponge JF, Prietzel J, Rapoport IB, Rashid MI, Rebollo S, Rodríguez MÁ, Roth AM, Rousseau GX, Rozen A, Sayad E, van Schaik L, Scharenbroch B, Schirrmann M, Schmidt O, Schröder B, Seeber J, Shashkov MP, Singh J, Smith SM, Steinwandter M, Szlavecz K, Talavera JA, Trigo D, Tsukamoto J, Uribe-López S, de Valença AW, Virto I, Wackett AA, Warren MW, Webster ER, Wehr NH, Whalen JK, Wironen MB, Wolters V, Wu P, Zenkova IV, Zhang W, Cameron EK, and Eisenhauer N
Subjects: Animals, Biomass, Biodiversity, Oligochaeta classification
Abstract: Earthworms are an important soil taxon as ecosystem engineers, providing a variety of crucial ecosystem functions and services. Little is known about their diversity and distribution at large spatial scales, despite the availability of considerable amounts of local-scale data. Earthworm diversity data, obtained from the primary literature or provided directly by authors, were collated with information on site locations, including coordinates, habitat cover, and soil properties. Datasets were required, at a minimum, to include abundance or biomass of earthworms at a site. Where possible, site-level species lists were included, as well as the abundance and biomass of individual species and ecological groups. This global dataset contains 10,840 sites, with 184 species, from 60 countries and all continents except Antarctica. The data were obtained from 182 published articles, published between 1973 and 2017, and 17 unpublished datasets. Amalgamating data into a single global database will assist researchers in investigating and answering a wide variety of pressing questions, for example, jointly assessing aboveground and belowground biodiversity distributions and drivers of biodiversity change.
Published: 2021
Full Text: View/download PDF

42. Corneal Abnormalities Are Novel Clinical Feature in Wolfram Syndrome.

Author: Waszczykowska A, Zmysłowska A, Braun M, Zielonka E, Ivask M, Koks S, Jurowski P, and Młynarski W
Subjects: Adolescent, Adult, Animals, Corneal Diseases etiology, Corneal Diseases physiopathology, Corneal Pachymetry, Female, Humans, Male, Mice, ROC Curve, Retrospective Studies, Wolfram Syndrome diagnosis, Wolfram Syndrome physiopathology, Young Adult, Cornea pathology, Corneal Diseases diagnosis, Corneal Topography methods, Wolfram Syndrome complications
Abstract: Purpose: To evaluate corneal morphology among patients with Wolfram syndrome (WFS)., Design: Comparative observational longitudinal case series of WFS patients with a laboratory approach in the WFS1 gene knockout (Wfs1KO) mouse model., Methods: A group of 12 patients with biallelic mutations in the WFS1 gene recruited from the whole country and a control group composed of 30 individuals with type 1 diabetes (T1D) were evaluated in a national reference center for monogenic diabetes. All subjects (n = 42) underwent a complete ophthalmic examination, computer videokeratography, and corneal thickness and endothelial measurements. Additionally, WFS patients (n = 9) underwent longitudinal videokeratography and Pentacam evaluation. Corneal characteristics were assessed and compared between both groups. Human and mouse corneas were subjected to immunohistochemistry to detect wolframin expression and microscopic evaluation to study corneal morphology ex vivo., Results: Clinical and topographic abnormalities similar to keratoconus were observed in 14 eyes (58.3%) of 8 WFS patients (66.7%). Flat keratometry, inferior-superior dioptric asymmetry, skewed radial axis, logarithm of keratoconus percentage index, index of surface variance, index of vertical asymmetry, keratoconus index, central keratoconus index, index of height asymmetry, and index of height decentration differed between WFS and T1D patients. Immunohistochemistry demonstrated wolframin expression in human and mouse corneas. Compared with Wfs1WT mice, Wfs1KO mice also presented corneal abnormalities., Conclusions: Patients with WFS present a high prevalence of changes in corneal morphology compatible with the diagnosis of early stages of keratoconus. Observations in a mouse model suggest that a mutation in the WFS1 gene may be responsible for corneal abnormalities similar to keratoconus., (Copyright © 2020 Elsevier Inc. All rights reserved.)
Published: 2020
Full Text: View/download PDF

43. Multiple Retinal Anomalies in Wfs1-Deficient Mice.

Author: Waszczykowska A, Zmysłowska A, Braun M, Ivask M, Koks S, Jurowski P, and Młynarski W
Abstract: Background: Wolfram syndrome (WFS, OMIM: #222300) is an ultrarare autosomal recessive disorder characterized by diabetes insipidus, diabetes mellitus, optic nerve atrophy and deafness. It has been reported that the average retinal thickness in WFS patients decreases with the progression of the disease., Aim: To investigate retinal thickness and wolframin expression disorders in Wolfram syndrome 1 gene knockout (Wfs1KO) mice compared to their wild-type (WT) littermates., Materials and Methods: Both bulbs with optic nerves of three mice Wfs1WT and three Wfs1KO were taken for the histopathological examination. A strain of knockout mice with mutation in exon 8 was used., Results: No expression of wolframin protein in the retina and neurodegeneration of the optic nerve of Wfs1KO mice as compared among Wfs1WT mice was observed. The mean central retinal thickness was thinner and the retinal thickness/longitudinal diameter ratio was significantly lower in hte Wfs1KO as compared to the Wfs1WT mice. In four (67%) eyeballs of Wfs1KO mice, intra-retinal neovessels were observed., Conclusions: Wfs1KO mice retina with mutation in exon 8 present similar clinical features as patients with WFS in the form of reduced retinal thickness and neurodegeneration of the optic nerve. The presence of proliferative retinopathy observed in Wfs1KO mice requires further investigation.
Published: 2020
Full Text: View/download PDF

44. Increased Mitochondrial Protein Levels and Bioenergetics in the Musculus Rectus Femoris of Wfs1-Deficient Mice.

Author: Eimre M, Paju K, Peet N, Kadaja L, Tarrend M, Kasvandik S, Seppet J, Ivask M, Orlova E, and Kõks S
Subjects: Animals, Electron Transport genetics, Electron Transport physiology, Energy Metabolism genetics, Male, Membrane Proteins deficiency, Mice, Mice, Knockout, Mitochondrial Proteins genetics, Proteomics, Reverse Transcriptase Polymerase Chain Reaction, Tandem Mass Spectrometry, Energy Metabolism physiology, Membrane Proteins metabolism, Mitochondrial Proteins metabolism, Quadriceps Muscle metabolism
Abstract: Wfs1 deficiency leads to a progressive loss of plasma insulin concentration, which should reduce the consumption of glucose in insulin-dependent tissues, causing a variety of changes in intracellular energy metabolism. Our objective here was to assess the changes in the amount and function of mitochondrial proteins in different muscles of Wfs1-deficient mice. Mitochondrial functions were assayed by high-resolution oxygraphy of permeabilized muscle fibers; the protein amount was evaluated by liquid chromatography tandem mass spectrometry (LC/MS/MS) analysis and mRNA levels of the uncoupler proteins UCP2 and UCP3 by real-time PCR; and citrate synthase (CS) activity was determined spectrophotometrically in muscle homogenates. Compared to controls, there were no changes in proton leak and citrate synthase activity in the heart and m. soleus tissues of Wfs1-deficient mice, but significantly higher levels of both of these factors were observed in the m. rectus femoris ; mitochondrial proteins and mRNA of UCP2 were also higher in the m. rectus femoris . ADP-stimulated state 3 respiration was lower in the m. soleus , remained unchanged in the heart, and was higher in the m. rectus femoris . The mitochondrial protein amount and activity are higher in Wfs1-deficient mice, as are mitochondrial proton leak and oxygen consumption in m. rectus femoris . These changes in muscle metabolism may be important for identifying the mechanisms responsible for Wolfram syndrome and diabetes.
Published: 2018
Full Text: View/download PDF

45. A synopsis of Estonian myriapod fauna (Myriapoda: Chilopoda, Diplopoda, Symphyla and Pauropoda).

Author: Sammet K, Ivask M, and Kurina O
Abstract: The data on Estonian Myriapoda are scattered in various publications and there has been no overview of the fauna up to the present. A critical summary of the previous information on Estonian Myriapoda is given, supplemented by new records and distribution maps. Altogether, 5784 specimens from 276 collecting sites were studied. To the hitherto recorded 14 centipede species are added Lithobiusmelanops , L.microps , Geophiluscarpophagus , G.flavus , Strigamiatranssilvanica and Stenotaenialinearis , a probably introduced species. Of the 27 published Estonian millipede species, the data on two species proved erroneous, and two new species were recorded ( Craspedosomaraulinsii and Cylindroiulusbritannicus ). Two previously recorded millipede species - Brachyiuluspusillus and Mastigophorophyllonsaxonicum - were not found in the recent samples, the latter may have become more rare or extinct. Pauropoda and Symphyla lack previous reliable records. Combined with published data, the number of myriapod species known from Estonia is now set at 52. Some changes in species distribution and frequencies were detected comparing the published data with new records. Some data about habitat preferences of the more common species are also given. The majority of species have a western Palaearctic distribution, while six species are at the northern limit of their ranges.
Published: 2018
Full Text: View/download PDF

46. Proteomic dataset of wolframin-deficient mouse heart and skeletal muscles.

Author: Eimre M, Kasvandik S, Ivask M, and Kõks S
Abstract: The data presented in this article are related to the research article entitled "Increased Mitochondrial Protein Levels and Bioenergetics in the musculus rectus femoris of Wfs1-Deficient mice" (Eimre et al., accepted for publication). This dataset reports the analysis of Wfs1-deficient mouse heart, musculus soleus , and white part of musculus rectus femoris by liquid chromatography/tandem mass spectrometry. Label-free quantitative analysis of the mass spectrometry data identified 4056 proteins, with 114, 212, and 1290 proteins differentially expressed ( t -test; p < 0.05) in the heart, m . soleus , and m. rectus femoris , respectively, between the Wfs1-deficient and wild-type groups. Eight proteins were found to be differentially expressed in all mentioned muscles, with 1 protein differently expressed in oxidative ( m. soleus and heart) and 88 in skeletal muscles. This dataset supports the cited study and can be used to extend additional analyses. Data are available via ProteomeXchange with identifier PXD011019.
Published: 2018
Full Text: View/download PDF

47. Hippocampus and Hypothalamus RNA-sequencing of WFS1-deficient Mice.

Author: Ivask M, Pajusalu S, Reimann E, and Kõks S
Subjects: Animals, Disease Models, Animal, Male, Membrane Proteins genetics, Mice, 129 Strain, Mice, Knockout, Real-Time Polymerase Chain Reaction, Receptors, Vasopressin metabolism, Sequence Analysis, RNA, TRPM Cation Channels metabolism, Transcriptome, Hippocampus metabolism, Hypothalamus metabolism, Membrane Proteins deficiency, Wolfram Syndrome metabolism
Abstract: Wolfram syndrome is caused by mutations in the WFS1 gene. WFS1 protein dysfunction results in a range of neuroendocrine syndromes and is mostly characterized by juvenile-onset diabetes mellitus and optic atrophy. WFS1 has been shown to participate in membrane trafficking, protein processing and Ca 2+ homeostasis in the endoplasmic reticulum. Aim of the present study was to find the transcriptomic changes influenced by WFS1 in the hypothalamus and hippocampus using RNA-sequencing. The WFS1-deficient mice were used as a model system to analyze the changes in transcriptional networks. The number of differentially expressed genes between hypothalami of WFS1-deficient (Wfs1KO) and wild-type (WT) mice was 43 and between hippocampi 311 with False Discovery Rate (FDR) <0.05. Avpr1a and Avpr1b were significantly upregulated in the hypothalamus and hippocampus of Wfs1KO mice respectively. Trpm8 was the most upregulated gene in the hippocampus of Wfs1KO mice. The functional analysis revealed significant enrichment of networks and pathways associated with protein synthesis, cell-to-cell signaling and interaction, molecular transport, metabolic disease and nervous system development and function. In conclusion, the transcriptomic profiles of WFS1-deficient hypothalamus and hippocampus do indicate the activation of degenerative molecular pathways causing the clinical occurrences typical to Wolfram syndrome., (Copyright © 2018 IBRO. Published by Elsevier Ltd. All rights reserved.)
Published: 2018
Full Text: View/download PDF

48. Generation of transgene-free porcine intermediate type induced pluripotent stem cells.

Author: Li D, Secher J, Hyttel P, Ivask M, Kolko M, Hall VJ, and Freude KK
Subjects: Animals, Cell Differentiation, Cells, Cultured, Embryoid Bodies cytology, Embryoid Bodies metabolism, Female, Fibroblasts cytology, Fibroblasts metabolism, Induced Pluripotent Stem Cells cytology, Induced Pluripotent Stem Cells transplantation, Karyotype, Mice, Mice, Inbred NOD, Mice, SCID, Nanog Homeobox Protein genetics, Nanog Homeobox Protein metabolism, Octamer Transcription Factor-3 genetics, Octamer Transcription Factor-3 metabolism, Plasmids genetics, Plasmids metabolism, SOXB1 Transcription Factors genetics, SOXB1 Transcription Factors metabolism, Swine, Teratoma pathology, Transgenes genetics, Cellular Reprogramming, Induced Pluripotent Stem Cells metabolism
Abstract: Physiologically and anatomically, humans and pigs share many similarities, which make porcine induced pluripotent stem cells (piPSCs) very attractive for modeling human cell therapy as well as for testing safety of iPSC based cell replacement therapies. To date, several integrative and non-integrative strategies have been reported to successfully generate piPSCs, but all resulting piPSCs had integration of transgenes. The use of integrative methods has the disadvantage of potential lack of silencing or inappropriate re-activation of these genes during differentiation, as well as uncertainty regarding disruption of important genomic regions caused by integration. In our study, we performed a non-integrative vector based reprogramming approach using porcine fetal fibroblasts. The resulting four piPSC lines were positive for pluripotency marker and when subjected to in vitro and in vivo differentiation assays, all four lines formed embryoid bodies, capable to differentiate into all three germ layers, and three out of the four cell lines formed teratomas. PCR analysis on genomic and plasmid DNA revealed that the episomal vectors were undetectable in six out of eight subclones derived from one of the piPSC lines (piPSC1) above passage 20. These piPSCs could potentially be ideal cell lines for the generation of porcine in vitro and in vivo models. Furthermore, subsequent analyses of our new transgene independent piPSCs could provide novel insights on the genetic and epigenetic necessities to achieve and maintain piPSCs.
Published: 2018
Full Text: View/download PDF

49. RNA-sequencing of WFS1-deficient pancreatic islets.

Author: Ivask M, Hugill A, and Kõks S
Subjects: Animals, Databases, Genetic, Gene Expression Profiling, Gene Expression Regulation, Gene Regulatory Networks, Genetic Predisposition to Disease, Glucose pharmacology, Heterozygote, Hypoglycemic Agents pharmacology, Insulin metabolism, Insulin Secretion, Islets of Langerhans drug effects, Islets of Langerhans pathology, Membrane Proteins genetics, Mice, 129 Strain, Mice, Inbred C57BL, Mice, Knockout, Phenotype, Proinsulin metabolism, RNA metabolism, Real-Time Polymerase Chain Reaction, TRPM Cation Channels genetics, TRPM Cation Channels metabolism, Tissue Culture Techniques, Tolbutamide pharmacology, Transcription, Genetic, Wolfram Syndrome metabolism, Wolfram Syndrome pathology, Wolfram Syndrome physiopathology, Islets of Langerhans metabolism, Membrane Proteins deficiency, RNA genetics, Sequence Analysis, RNA, Transcriptome, Wolfram Syndrome genetics
Abstract: Wolfram syndrome, an autosomal recessive disorder characterized by juvenile-onset diabetes mellitus and optic atrophy, is caused by mutations in theWFS1gene.WFS1encodes an endoplasmic reticulum resident transmembrane protein. TheWfs1-null mice exhibit progressive insulin deficiency and diabetes. The aim of this study was to describe the insulin secretion and transcriptome of pancreatic islets inWFS1-deficient mice.WFS1-deficient (Wfs1KO) mice had considerably less pancreatic islets than heterozygous (Wfs1HZ) or wild-type (WT) mice. Wfs1KOpancreatic islets secreted less insulin after incubation in 2 and 10 mmol/L glucose and with tolbutamide solution compared toWTand Wfs1HZislets, but not after stimulation with 20 mmol/L glucose. Differences in proinsulin amount were not statistically significant although there was a trend that Wfs1KOhad an increased level of proinsulin. After incubation in 2 mmol/L glucose solution the proinsulin/insulin ratio in Wfs1KOwas significantly higher than that ofWTand Wfs1HZRNA-seq from pancreatic islets found melastatin-related transient receptor potential subfamily member 5 protein gene (Trpm5) to be downregulated inWFS1-deficient mice. Functional annotation ofRNAsequencing results showed thatWFS1 deficiency influenced significantly the pathways related to tissue morphology, endocrine system development and function, molecular transport network., (© 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.)
Published: 2016
Full Text: View/download PDF

50. Analysis of metabolic effects of menthol on WFS1-deficient mice.

Author: Ehrlich M, Ivask M, Raasmaja A, and Kõks S
Subjects: Animals, Body Weight drug effects, Body Weight physiology, Dose-Response Relationship, Drug, Energy Metabolism drug effects, Male, Membrane Proteins genetics, Mice, Mice, 129 Strain, Mice, Knockout, Oxygen Consumption drug effects, Thermogenesis drug effects, Energy Metabolism physiology, Membrane Proteins deficiency, Menthol pharmacology, Oxygen Consumption physiology, Thermogenesis physiology
Abstract: In this study, we investigated the physiological regulation of energy metabolism in wild-type (WT) and WFS1-deficient (Wfs1KO) mice by measuring the effects of menthol treatment on the O2 consumption, CO2 production, rectal body temperature, and heat production. The basal metabolism and behavior was different between these genotypes as well as TRP family gene expressions. Wfs1KO mice had a shorter life span and weighed less than WT mice. The food and water intake of Wfs1KO mice was lower as well as the body temperature when compared to their WT littermates. Furthermore, Wfs1KO mice had higher basal O2 consumption, and CO2 and heat production than WT mice. In addition, Wfs1KO mice showed a higher response to menthol administration in comparison to WT mice. The strongest menthol effect was seen on different physiological measures 12 h after oral administration. The highest metabolic response of Wfs1KO mice was seen at the menthol dose of 10 mg/kg. Menthol increased O2 consumption, and CO2 and heat production in Wfs1KO mice when compared to their WT littermates. In addition, the expression of Trpm8 gene was increased. In conclusion, our results show that the Wfs1KO mice develop a metabolic phenotype characterized with several physiological dysfunctions., (© 2015 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.)
Published: 2016
Full Text: View/download PDF

Catalog

Books, media, physical & digital resources

See catalog results

Searchworks

Select search scope, currently: Articles Catalog books, media & more in Jio Institute collections Articles journal articles & other e-resources

Search

Search Constraints

Refine your results

Search Limiters

Topic

Publication Year Range

Language

Publication Type

Journal

Region

Database

Publisher

50 results on '"Ivask M"'

Search Results

Catalog

Select search scope, currently: Articles

Catalog

books, media & more in Jio Institute collections

Articles

journal articles & other e-resources