Search

During recent decades, global warming has intensified, altering crop growth, development and survival. To overcome changes in their environment, plants undergo transcriptional reprogramming to activate stress response strategies/pathways. To evaluate the genetic bases of the response to heat stress, Conserved DNA-derived Polymorphism (CDDP) markers were applied across tomato genome of eight cultivars. Despite scattered genotypes, cluster analysis allowed two neighbouring panels to be discriminate. Tomato CDDP-genotypic and visual phenotypic assortment permitted the selection of two contrasting heat-tolerant and heat-sensitive cultivars. Further analysis explored differential expression in transcript levels of genes, encoding heat shock transcription factors (HSFs, HsfA1, HsfA2, HsfB1), members of the heat shock protein (HSP) family (HSP101, HSP17, HSP90) and ascorbate peroxidase (APX) enzymes (APX1, APX2). Based on discriminating CDDP-markers, a protein functional network was built allowing prediction of candidate genes and their regulating miRNA. Expression patterns analysis revealed that miR156d and miR397 were heat-responsive showing a typical inverse relation with the abundance of their target gene transcripts. Heat stress is inducing a set of candidate genes, whose expression seems to be modulated through a complex regulatory network. Integrating genetic resource data is required for identifying valuable tomato genotypes that can be considered in marker-assisted breeding programmes to improve tomato heat tolerance.

Tomato yellow leaf curl disease (TYLCD) and salinity stress adversely affect tomato production worldwide by causing extensive damages. In Tunisia, identifying TYLCD resistant cultivars selected in different environments is useful to devise counter-measures. To this end, 20 tomato commercial cultivars were screened for different Ty gene alleles’ combinations and evaluated either for TYLCD incidence or salinity constraint. We built a biological multi-layer network for integrating, visualizing and modelling generated data. It is a simple representation view linking allelic combinations to tomato cultivars behaviour under viral and salt stresses. In addition, we analyzed differential expression of transcriptions factors (TFs) belonging to WRKY and ERF families in selected resistant (R) and susceptible (S) tomato cultivars. Gene expression was evaluated for short- and long stress exposure to either TYLCSV infection or to both viral and salinity stresses. Evidence is that TFs promote resistance to abiotic and biotic stresses through a complex regulatory network. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (10.1007/s12298-020-00835-w) contains supplementary material, which is available to authorized users.

Guanosine pentaphosphate and tetraphosphate (together referred to as ppGpp) are hyperphosphorylated nucleotides found in bacteria and the chloroplasts of plants and algae. In plants and algae artificial ppGpp accumulation can inhibit chloroplast gene expression, and influence photosynthesis, nutrient remobilization, growth, and immunity. However, it is so far unknown whether ppGpp is required for abiotic stress acclimation in plants. Here, we demonstrate that ppGpp biosynthesis is necessary for acclimation to nitrogen starvation in Arabidopsis. We show that ppGpp is required for remodeling the photosynthetic electron transport chain to downregulate photosynthetic activity and for protection against oxidative stress. Furthermore, we demonstrate that ppGpp is required for coupling chloroplastic and nuclear gene expression during nitrogen starvation. Altogether, our work indicates that ppGpp is a pivotal regulator of chloroplast activity for stress acclimation in plants.

Guanosine pentaphosphate and tetraphosphate (together referred to as ppGpp) are hyperphosphorylated nucleotides found in bacteria and the chloroplasts of plants and algae. In plants and algae artificial ppGpp accumulation can inhibit chloroplast gene expression, and influence photosynthesis, nutrient remobilisation, growth, and immunity. However, it is so far unknown whether ppGpp is required for abiotic stress acclimation in plants. Here, we demonstrate that ppGpp biosynthesis is necessary for acclimation to nitrogen starvation in Arabidopsis. We show that ppGpp is required for remodeling the photosynthetic electron transport chain to downregulate photosynthetic activity and for protection against oxidative stress. Furthermore, we demonstrate that ppGpp is required for coupling chloroplastic and nuclear gene expression during nitrogen starvation. Altogether, our work indicates that ppGpp is a pivotal regulator of chloroplast activity for stress acclimation in plants.

Translation initiation factors 4E (eIF4E) are the main source of resistance to potyvirus. We systematically assessed tomato single and double knock-out (KO) mutants of members of the eIF4E-coding gene family for resistance to Pepper veinal mottle virus (PVMV), a major constraint to tomato production. We show that the KO mutant of eIF4E2 has partial resistance to PVMV isolate IC, with plants harboring weak symptoms and low virus loads at the systemic level. The causal effect of eIF4E2 loss-of-function on resistance was confirmed on a progeny segregating for the KO mutation. The eIF4E2 KO mutant was resistant to six of the eight PVMV isolates tested and no resistance to other potyviruses was observed. This is the first evidence that mutation of eIF4E2 is in itself conferring resistance to a potyvirus and 3D protein modelling suggests that the eIF4E2 gene could be converted into a functional resistance allele.

[EN] Tomato spotted wilt virus (TSWV) causes severe losses of tomato crops worldwide. To cope dynamically with such a threat, plants deploy strategies acting at the molecular and the epigenetic levels. We found that tomato symptoms progress in a specific-genotype-manner upon TSWV infection. Susceptible genotypes showed within the Auxin Response Factor (ARF8) promoter coupled to enhanced expression of miRNA167a, reduced ARF8 gene and decreased levels of the hormone auxin. This constitutes a deliberate attempt of TSWV to disrupt plant growth to promote spread in sensitive cultivars. Epigenetic regulation through the level of cytosine methylation and the miR167a-ARF8 module are part of a complex network modulating auxin-triggered synthesis and shaping tomato responses to TSWV. Furthermore, modulation of miR167a-ARF8 regulatory module could be applied in tomato-resistance breeding programs, This work was financially supported by the Ministry of Higher Education and Scientific Research of Tunisia

Chloroplasts can act as key players in the perception and acclimatization of plants to incoming environmental signals. A growing body of evidence indicates that chloroplasts play a critical role in plant immunity. Chloroplast function can be regulated by the nucleotides guanosine tetraphosphate and pentaphosphate [(p)ppGpp]. In plants, (p)ppGpp levels increase in response to abiotic stress and to plant hormones which are involved in abiotic and biotic stress signalling. In this study, we analysed the transcriptome of Arabidopsis plants that over-accumulate (p)ppGpp, and unexpectedly found a decrease in the levels of a broad range of transcripts for plant defence and immunity. To determine whether (p)ppGpp is involved in the modulation of plant immunity, we analysed the susceptibility of plants with different levels of (p)ppGpp to Turnip mosaic virus (TuMV) carrying a green fluorescent protein (GFP) reporter. We found that (p)ppGpp accumulation was associated with increased susceptibility to TuMV and reduced levels of the defence hormone salicylic acid (SA). In contrast, plants with lower (p)ppGpp levels showed reduced susceptibility to TuMV, and this was associated with the precocious up-regulation of defence-related genes and increased SA content. We have therefore demonstrated a new link between (p)ppGpp metabolism and plant immunity in Arabidopsis.

Viroids of fruit trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of fruit trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5′ GTCTGAAGCCTGGGCGCTGG 3′ and reverse primer 5′ CCTTCGT CGACGACGAGCCGAG 3′ were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach trees tested, 12 were found infected with PLMVd. Two pear trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in fruit trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting fruit trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Légumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.

Almond (Prunus dulcis Mill) is an important crop in countries of the Mediterranean area. Until now, among viroids, only Hop stunt viroid (HSVd) is known to infect cultivated almond trees (2). In 2004, a survey of almond trees was carried out in orchards in different regions of Tunisia, a major producing and exporting country of almond. Symptoms such as mosaic and necrotic lesions, potentially caused by the Peach latent mosaic viroid (PLMVd), were observed on leaves of cultivated almond trees. Since PLMVd was recently detected in peach and pear trees in Tunisia (4), the presence of this viroid in almond trees was studied. The detection method on the basis of one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays was previously described and validated for the detection of this viroid in fruit trees (4). Amplification products were obtained by using previously reported primer pairs of PLMVd (1). Positive controls included RNA preparations of twigs of PLMVd-infected GF 305 peach seedlings. These materials, provided by B. Pradier (Station de Quarantaine des Ligneux, Lempdes, France), were positive as revealed by chip budding on peach seedling indicator plants grown under greenhouse conditions. RT-PCR analysis of nucleic acid preparations from leaves of almond showed specific amplification products with the expected size of 337 bp for two almond trees among 17 trees tested. Nucleotide sequence analyses of cloned amplification products obtained with the PLMVd primers confirmed a size of 337 bp and revealed a sequence similar to sequences from other PLMVd isolates previously characterized. The sequences shared 94 to 98% identity with the reference isolates of PLMVd from peach (EMBL Accession No. M83545, AF170511, AF170514, and AY685181). The two infected almond trees are proximal to each other and peach trees infected with PLMVd. This suggests that one tree may have served as a source of inoculum for the other through agronomic practices such as pruning or the aphid Myzus percicae (3). Alternatively, PLMVd may have originated in an unknown host and was then transmitted to almond trees. Our investigation shows that almond is a new host for PLMVd. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) M. C. Cañizares et al. Eur. J. Plant Pathol. 105:553, 1999. (3) J. C. Desvignes et al. Phytoma 444:70, 1992. (4) I. Fekih Hassen et al. Plant Dis. 88:1164, 2004.

The potyvirus Lettuce mosaic virus (LMV) is a common pathogen of lettuce crops worldwide, but it also infects other Asteraceae spp. including ornamentals (2,3,4). Cape daisies (Osteospermum sp.) are widely grown perennial ornamentals reported to be natural hosts of LMV (2,4), which causes faint leaf mosaic and sometimes mild flower breaking. A preliminary observation of mosaic symptoms prompted a large-scale survey during the spring of 2005 in Cape daisies grown in the Tunis metropolitan area and the south of Tunisia (Djerba, Medenine). Two hundred seventy-one samples (Tunis: 14 sites, 219 samples; South: 9 sites, 52 samples) were randomly collected from nurseries, roadway plantings, and home gardens and analyzed. Ninety-three samples (Tunis: 40%, South: 12%; overall: 34%) showed distinct mosaic symptoms. LMV infection was verified by immuno-tissue printing on all collected samples (1), providing evidence for even higher infection levels (Tunis: 60%; South: 25%; overall: 56%). This technique, therefore, allowed the detection of symptomless infection in a significant proportion of samples. It should however, be stressed that symptoms can be very difficult to observe in water-stressed plants, a situation frequently observed in Tunisia. Subsequent PCR analysis with LMV-specific primers (1) of a subset of 24 symptomatic and tissue-print-positive samples confirmed LMV infection in all cases. This is to our knowledge, the first report of LMV infection in Cape daisies in Tunisia. The very high rate of infection observed suggests that these popular ornamentals might constitute a reservoir of LMV as previously reported in the United States (4). References: (1) H. Fakhfakh et al. J. Plant Pathol. 83:3, 2001. (2) R. Jordan and M. Guaragna. (Abstr.) Phytopathology 96(suppl.):S56, 2006. (3) O. Le Gall. No. 399 in: Description of Plant Viruses. A. T. Jones et al., eds. CMI/AAB, Kew, Surrey, UK, 2003. (4) D. C. Opgenorth et al. Plant Dis. 75:751, 1991.

Salt stress was applied to tomato commercial genotypes to study adverse effects on their phenotypic traits. Three were saline tolerant (San Miguel, Romelia and Llanero), two were mildly tolerant (Perfect peel HF1 and Heinz 1350) whereas the remaining were sensitive. Genotyping cultivars using 19 polymorphic SSRs out of 25 tested produced a total of 70 alleles with an average of 3.68 alleles per locus and PIC values ranging from 0.22 (SSR 26, 92, 66 and TG35) to 0.82 (SSR 356). Principal component analysis (PCA) showed two contrasting panels discriminating tolerant and sensitive groups and one panel with scattered genotypes. STRUCTURE analysis clustered genotypes within three groups in accordance with their salt stress behavior. The success of tomato salt-tolerance breeding programs can be enhanced through molecular characterization of diversity within commercial cultivars that adapt differently to stress conditions. To this end, we combined phenotypes and SSR marker-genotypes to seek sources of salt tolerance that might be tomato species-specific. We integrated and represented genotype-phenotype associations from multiple loci into a multi-layer network representation. It is a systemic view linking discriminating genotypes to salt stress phenotypes, which may guide strategies for the introgression of valuable traits in target tomato varieties to overcome salinity.

International audience; Combining landscape ecology and genetics provides an excellent framework to appreciate pest population dynamics and dispersal. The genetic architectures of many species are always shaped by environmental constraints. Because little is known about the ecological and genetic traits of Tunisian whitefly populations, the main objective of this work is to highlight patterns of biodiversity, genetic structure and migration routes of this pest. We used nuclear microsatellite loci to analyze B. tabaci populations collected from various agricultural areas across the country and we determine their biotype status. Molecular data were subsequently interpreted in an ecological context supplied from a species distribution model to infer habitat suitability and hereafter the potential connection paths between sampling localities. An analysis of landscape resistance to B. tabaci genetic flow was thus applied to take into account habitat suitability, genetic relatedness and functional connectivity of habitats within a varied landscape matrix. We shed light on the occurrence of three geographically delineated genetic groups with high levels of genetic differentiation within each of them. Potential migration corridors of this pest were then established providing significant advances toward the understanding of genetic features and the dynamic dispersal of this pest. This study supports the hypothesis of a long-distance dispersal of B. tabaci followed by infrequent long-term isolations. The Inference of population sources and colonization routes is critical for the design and implementation of accurate management strategies against this pest.

In Tunisia, potato virus Y (PVY) currently presents a significant threat to potato production, reducing tuber yield and quality. Three hundred and eighty-five potato samples (six different cultivars) collected in autumn 2007 from nine regions in Tunisia were tested for PVY infection by DAS-ELISA. The virus was detected in all regions surveyed, with an average incidence of 80.26%. Subsequently, a panel of 82 Tunisian PVY isolates (PVY-TN) was subjected to systematic biological, serological and molecular typing using immunocapture reverse-transcription polymerase chain reaction and a series of PVY(OC)- and PVY(N)-specific monoclonal antibodies. Combined analyses revealed ~67% of PVY(NTN) variants of which 17 were sequenced in the 5'NTR-P1 region to assess the genetic diversity and phylogenetic relationship of PVY-TN against other worldwide PVY isolates. To investigate whether selective constraints could act on viral genomic RNA, synonymous and non-synonymous substitution rates and their ratio were analyzed. Averages of all pairwise comparisons obtained in the 5'NTR-P1 region allowed more synonymous changes, suggesting selective constraint acting in this region. Selective neutrality test was significantly negative, suggesting a rapid expansion of PVY isolates. Pairwise mismatch distribution gave a bimodal pattern and pointed to an eventually early evolution characterizing these sequences. Genetic haplotype network topology provided evidence of the existence of a distinct geographical structure. This is the first report of such genetic analyses conducted on PVY isolates from Tunisia.

Understanding plant response to salinity, one of the major abiotic stresses, provides insights into the improvement of tomato salt tolerance. This work focuses on the responses of tomato cultivars to salt stress. Genotypes, representative of content and enzyme activities. QPCR analysis of WRKY, ERF, LeNHX and HKT genes was also performed. A high K+, Ca2+ and proline accumulation as well as a decrease in Na+ concentration mediated salt tolerance. Concomitant with a pattern of high antioxidant enzyme activities, tolerant genotypes also displayed differential patterns of gene expression., Salinity is a constraint limiting plant growth and productivity of crops throughout the world. Understanding the mechanism underlying plant response to salinity provides new insights into the improvement of salt tolerance-crops of importance. In the present study, we report on the responses of twenty cultivars of tomato. We have clustered genotypes into scale classes according to their response to increased NaCl levels. Three local tomato genotypes, representative of different saline scale classes, were selected for further investigation. During early (0 h, 6 h and 12 h) and later (7 days) stages of the response to salt treatment, ion concentrations (Na+, K+ and Ca2+), proline content, enzyme activities (catalase, ascorbate peroxidase and guiacol peroxidase) were recorded. qPCR analysis of candidate genes WRKY (8, 31and 39), ERF (9, 16 and 80), LeNHX (1, 3 and 4) and HKT (class I) were performed. A high K+, Ca2 +and proline accumulation as well as a decrease of Na+ concentration-mediated salt tolerance. Concomitant with a pattern of high-antioxidant enzyme activities, tolerant genotypes also displayed differential patterns of gene expression during the response to salt stress.