Search

Elevated serum free fatty acids (FFAs) levels play an important role in the development of insulin resistance (IR) and diabetes. We investigated the dynamic changes and the underlying regulatory mechanism of postprandial FFA profile in hyperlipidemia (HLP) and their relation with insulin sensitivity in both humans and mice. We found that serum stearic acid (SA) is the only fatty acid that is increased dramatically in the postprandial state. The elevation of SA is due to increased insulin-stimulated de novo synthesis mediated by sterol regulatory element-binding protein-1c (SREBP-1c)/acetyl-CoA carboxylase/fatty acid synthase/elongation of long-chain fatty acid family member 6 (ELOVL6) and the elongation of palmitic acid (PA) catalyzed by ELOVL6. Downregulation of SREBP-1c or ELOVL6 by small interfering RNA can reduce SA synthesis in liver and serum SA level, followed by amelioration of IR in HLP mice. However, inhibition of SREBP-1c is more effective in improving IR than suppression of ELOVL6, which resulted in accumulation of PA. In summary, increased postprandial SA is caused by the insulin-stimulated SREBP-1c pathway and elongation of PA in HLP. Reduction of postprandial SA is a good candidate for improving IR, and SREBP-1c is potentially a better target to prevent IR and diabetes by decreasing SA., Hyperlipidemia(HLP) is strikingly common in patients with type 2 diabetes (1), and disturbance of lipid metabolism appears to be an early event in the development of diabetes, potentially preceding disease [...]

Both environmental and genetic factors play important roles in the development of the metabolic syndrome. To elucidate how these factors interact under normal conditions, C57B1/6 (B6) and 129S6/SvEvTac (129) mice were placed on a low-fat or high-fat diet. Over 18 weeks, the 129 strain developed features of the metabolic syndrome, notably obesity, hyperinsulinemia, and glucose intolerance only on the high-fat diet; the B6 strain on the other hand developed these features on both diets. High-fat feeding of both strains led to decreased serum triglycerides, hepatic steatosis, and hypercholesterolemia; however, B6 mice developed worse steatosis and a larger increase in LDL cholesterol. Both B6 background and high-fat feeding increased sterol regulatory element-binding protein-1c (SREBP-1c), a key regulator of lipogenic gene transcription, and its downstream targets. Stearoyl-CoA desaturase 1 (SCD1), an enzyme that regulates monounsaturated fatty acid (MUFA) synthesis, was also increased at the mRNA and enzyme activity levels by both high-fat feeding and B6 background. Furthermore, lipid analysis revealed increased hepatic triglycerides and MUFAs in B6 and high-fat--fed mice. Thus, dietary fat and genetic background act through SREBP-1c and SCD1 to affect hepatic lipid metabolism contributing to the development of the metabolic syndrome., The metabolic syndrome is a constellation of findings, including central obesity, insulin resistance, dyslipidemia, hypertension, and hepatic steatosis, which predispose to diabetes, cardiovascular disease, and cancer. As the prevalence of [...]

In vitro, the transcription factor sterol regulatory element binding protein-1c (SREBP-1c) mimics the positive effects of insulin on hepatic genes involved in glucose utilization, such as glucokinase (GK) and enzymes of the lipogenic pathway, suggesting that it is a key factor in the control of hepatic glucose metabolism. Decreased glucose utilization and increased glucose production by the liver play an important role in the development of the hyperglycemia in diabetic states. We thus reasoned that if SREBP-1c is indeed a mediator of hepatic insulin action, a hepatic targeted overexpression of SREBP-1c should greatly improve glucose homeostasis in diabetic mice. This was achieved by injecting streptozotocin-induced diabetic mice with a recombinant adenovirus containing the cDNA of the mature, transcriptionally active form of SREBP-1c. We show here that overexpressing SREBP-1c specifically in the fiver of diabetic mice induces GK and lipogenic enzyme gene expression and represses the expression of phosphoenolpyruvate carboxykinase, a key enzyme of the gluconeogenic pathway. This in turn increases glycogen and triglyceride hepatic content and leads to a marked decrease in hyperglycemia in diabetic mice. We conclude that SREBP-1c has a major role in vivo in the long-term control of glucose homeostasis by insulin., Sterol regulatory element binding protein-1c (SREBP-1c) belongs to a family of transcription factors involved in cholesterol and fatty acid metabolism (1). It is synthesized as a precursor form anchored in [...]

2017 AUG 19 (NewsRx) -- By a News Reporter-Staff News Editor at Obesity, Fitness & Wellness Week -- Current study results on Hydroxycorticosteroids have been published. According to news reporting [...]

Stearoyl-CoA desaturase (SCD)1 catalyzes the rate-limiting reaction of monounsaturated fatty acid (MUFA) synthesis and plays an important role in the development of obesity. SCD1 is suppressed by leptin but induced by insulin. We have used animal models to dissect the effects of these hormones on SCD1. In the first model, leptin-deficient ob/ob mice were treated with either leptin alone or with both leptin and insulin to prevent the leptin-mediated fall in insulin. In the second model, mice with a liver-specific knockout of the insulin receptor (LIRKO) and their littermate controls (LOXs) were treated with leptin. As expected, leptin decreased SCD1 transcript, protein, and activity by >60% in ob/ob and LOX mice. However, the effects of leptin were not diminished by the continued presence of hyperinsulinemia in ob/ob mice treated with both leptin and insulin or the absence of insulin signaling in LIRKO mice. Furthermore, genetic knockout of sterol regulatory element-binding protein (SREBP)-1c, the lipogenic transcription factor that mediates the effects of insulin on SCD1, also had no effect on the ability of leptin to decrease either SCD1 transcript or activity. Thus, the effect of leptin on SCD1 in liver is independent of insulin and SREBP-1c, and leptin, rather than insulin, is the major regulator of hepatic MUFA synthesis in obesity-linked diabetes., Stearoyl-CoA desaturases (SCDs) catalyze the rate-determining reaction in the synthesis of monounsaturated fatty acids (MUFAs), the introduction of a double bond in the Δ-9 position of acyl-CoAs (rev. in 1). [...]

Postprandial dyslipidemia is recognized as an important complication of insulin-resistant states, and recent evidence implicates intestinal lipoprotein overproduction as a causative factor. The mechanisms linking intestinal lipoprotein overproduction and aberrant insulin signaling in intestinal enterocytes are currently unknown. Intestinal insulin sensitivity and lipid metabolism were studied in a fructose-fed hamster model of insulin resistance and metabolic dyslipidemia. Intestinal lipoprotein production in chow-fed hamsters was responsive to the inhibitory effects of insulin, and a decrease in circulating levels of triglyceride-rich apolipoprotein (apo)B48-containing lipoproteins occurred 60 min after insulin administration. However, fructose-fed hamster intestine was not responsive to the insulin-induced downregulation of apoB48-lipoprotein production, suggesting insulin insensitivity at the level of the intestine. Enterocytes from the fructose-fed hamster exhibited normal activity of the insulin receptor but reduced levels of insulin receptor substrate-1 phosphorylation and mass and Akt protein mass. Conversely, the protein mass of the p110 subunit of phosphatidylinositol 3-kinase, protein tyrosine phosphatase-1B, and basal levels of phosphorylated extracellular signal-related kinase (ERK) were significantly increased in the fructose-fed hamster intestine. Modulating the ERK pathway through in vivo inhibition of mitogen-activated protein/ERK kinase 1/2, the upstream activator of ERK1/2, we observed a significant decrease in intestinal apoB48 synthesis and secretion. Interestingly, enhanced basal ERK activity in the fructose-fed hamster intestine was accompanied by an increased activation of sterol regulatory element-binding protein. In summary, these data suggest that insulin insensitivity at the level of the intestine and aberrant insulin signaling are important underlying factors in intestinal overproduction of highly atherogenic apoB48-containing lipoproteins in the insulin-resistant state. Basal activation of the ERK pathway may be an important contributor to the aberrant insulin signaling and lipoprotein overproduction in this model., The insulin-resistant state is associated with a cluster of pathologies often referred to as the metabolic syndrome (1). The various pathologies include obesity, hypertension, dyslipidemia, and atherosclerosis (2,3). There is [...]

Conjugated linoleic acid (CLA) is a heterogeneous group of positional and geometric isomers of linoleic acid. This study demonstrates the divergent effects of the cis-9 trans-11 (c9,t11-CLA) and trans-10 cis-12 (t10,c12-CLA) isomers of CLA on lipid metabolism and nutrient regulation of gene expression in ob/ob mice. The c9,t11-CLA diet decreased serum triacyl-glycerol (P = 0.01) and nonesterified fatty acid (NEFA) (P = 0.05) concentrations, and this was associated with reduced hepatic sterol regulatory element-binding protein-1c (SREBP-1c; P = 0.0045) mRNA expression, coupled with reduced levels of both the membrane-bound precursor and the nuclear forms of the SREBP-1 protein. C9,t11-CLA significantly reduced hepatic LXRα (P = 0.019) mRNA expression, a novel regulator of SREBP-1c. In contrast, c9,t11-CLA increased adipose tissue SREBP-1c mRNA expression (P = 0.0162) proportionally to the degree of reduction of tumor necrosis factor α (TNF-α) mRNA (P = 0.012). Recombinant TNF-α almost completely abolished adipose tissue SREBP-1α mRNA expression in vivo. The t10,c12-CLA diet promoted insulin resistance and increased serum glucose (P = 0.025) and insulin (P = 0.01) concentrations. T10,c12-CLA induced profound weight loss (P = 0.0001) and increased brown and white adipose tissue UCP-2 (P = 0.001) and skeletal muscle UCP-3 (P = 0.008) mRNA expression. This study highlights the contrasting molecular and metabolic effect of two isomers of the same fatty acids. The ameliorative effect of c9,t11-CLA on lipid metabolism may be ascribed to reduced synthesis and cleavage of hepatic SREBP-1, which in turn may be regulated by hepatic LXRα expression., The novel fatty acid conjugated linoleic acid (CLA) may have potential as a therapeutic nutrient with respect to dyslipidemia and insulin resistance that is characteristic of the metabolic syndrome. CLA [...]

Sterol regulatory element binding protein-1c (SREBP-1c) is a transcription factor that mediates insulin effects on hepatic gene expression. It is itself transcriptionally stimulated by insulin in hepatocytes. Here we show that SREBP-1c mRNA is expressed in adult rat skeletal muscles and that this expression is decreased by diabetes. The regulation of SREBP-1c expression was then assessed in cultures of adult muscle satellite cells. These cells form spontaneously contracting multinucleated myotubes within 7 days of culture. SREBP-1c mRNA is expressed in contracting myotubes. A 4-h treatment with 100 nmol/l insulin increases SREBP-1c expression and nuclear abundance by two- to threefold in myotubes. In cultured myotubes, insulin increases the expression of glycolytic and lipogenic enzyme genes and inhibits the 9-cis retinoic acid-induced UCP3 expression. These effects of insulin are mimicked by adenovirus-mediated expression of a transcriptionally active form of SREBP-1c. We conclude that in skeletal muscles, SREBP-1c expression is sensitive to insulin and can transduce the positive and negative actions of the hormone on specific genes and thus has a pivotal role in long-term muscle insulin sensitivity. Diabetes 51:1722-1728, 2002, Insulin has a key role in metabolic adaptations linked to changes in the diet carbohydrate status. It not only rapidly modulates the activity of specific proteins but also, in the [...]

GLUT2 is mainly expressed in the liver, β-cells of the pancreas, and the basolateral membrane of kidney proximal tubules and plays an important role in glucose homeostasis in living organisms. The transcription of the GLUT2 gene is known to be upregulated in the liver during postprandial hyperglycemic states or in type 2 diabetes. However, a molecular mechanism by which glucose activates GLUT2 gene expression is not known. In this study, we report evidence that sterol response element-binding protein (SREBP)-1c plays a key role in glucose-stimulated GLUT2 gene expression. The GLUT2 promoter reporter is activated by SREBP-1c, and the activation is inhibited by a dominant-negative form of SREBP-1c (SREBP-1c DN). Adenoviral expression of SREBP-1c DN suppressed glucose-stimulated GLUT2 mRNA level in primary hepatocytes. An electrophoretic mobility shift assay and mutational analysis of the GLUT2 promoter revealed that SREBP-1c binds to the -84/-76 region of the GLUT2 promoter. Chromatin immunoprecipitation revealed that the binding of SREBP-1c to the -84/-76 region was increased by glucose concentration in a dose-dependent manner. These results indicate that SREBP-1c mediates glucose-stimulated GLUT2 gene expression in hepatocytes., Adipocyte determination and differentiation-dependent factor 1 (ADD1)/sterol response element binding protein (SREBP)-1c is a transacting factor that regulates transcription of many genes involved in cholesterol and fatty acid synthesis (1-6). [...]

The transcription factor sterol regulatory element binding protein (SREBP)-1c is intimately involved in the regulation of lipid and glucose metabolism. To investigate whether mutations in this gene might contribute to insulin resistance, we screened the exons encoding the aminoterminal transcriptional activation domain in a cohort of 85 unrelated human subjects with severe insulin resistance. Two missense mutations (P87L and P416A) were found in single affected patients but not in 47 control subjects. However, these variants were indistinguishable from the wild-type in their ability to bind DNA or to transactivate an SREBP-1 responsive promoter construct. We also identified a common intronic single nucleotide polymorphism (C/T) located between exon 18c and 19c. In a case-control study of 517 U.K. Caucasian case subjects and 517 age- and sex-matched control subjects, the T-allele at this locus was significantly associated with type 2 diabetes in men (odds ratio = 1.42 [1.11-1.82], P = 0.005) but not women. In a separate population-based study of 1,100 Caucasians, carriers of the T-allele showed significantly higher levels of total and LDL cholesterol (P < 0.05) compared with wild-type individuals. In summary, we have conducted the first study of the SREBP-1c gene as a candidate for human insulin resistance. Although the rare mutations identified were functionally silent in the assays used, we obtained some evidence, which requires conformation in other populations, that a common variant in the SREBP-1c gene might influence diabetes risk and plasma cholesterol level. Diabetes 53:842-846, 2004, Type 2 diabetes is characterized by peripheral insulin resistance, increased hepatic gluconeogenesis, loss of glucose-induced insulin secretion and, in most patients, obesity (1). Recent data suggest that dysregulated fatty acid [...]

Insulin and glucose together have been previously shown to regulate hepatic sterol regulatory element-binding protein (SREBP)--1c expression. We sought to explore the nutritional regulation of lipogenesis through SREBP-1c induction in a setting where effects of sugars versus insulin could be distinguished. To do so, mice were insulin depleted by streptozotocin (STZ) administration and subjected to a fasting-refeeding protocol with glucose, fructose, or sucrose. Unexpectedly, the insulin-depleted mice exhibited a marked induction of SREBP-1c on all sugars, and this increase in SREBP-1c was even more dramatic than in the non-STZ-administered controls. The time course of changes in SREBP-1 induction varied depending on the type of sugars in both control and STZ-administered mice. Glucose refeeding gave a peak of SREBP-1c induction, whereas fructose refeeding caused slow and gradual increments, and sucrose refeeding fell between these two responses. Expression of various lipogenic enzymes were also gradually increased over time, irrespective of the types of sugars, with greater intensities in STZ-administered than in nontreated mice. In contrast, induction of hepatic glucokinase and suppression of phoshoenolpyruvate carboxykinase were insulin dependent in an early refed state. These data clearly demonstrate that nutritional regulation of SREBP-1c and lipogenic genes may be completely independent of insulin as long as sufficient carbohydrates are available., Sterol regulatory element-binding proteins (SREBPs) are members of the basic helix-loop-helix leucine zipper family of transcription factors that regulate fatty acid and cholesterol synthesis (1,2). SREBP proteins are initially bound [...]

2015 DEC 12 (NewsRx) -- By a News Reporter-Staff News Editor at Obesity, Fitness & Wellness Week -- Researchers detail new data in Peptide Proteins. According to news reporting from [...]

Sterol-regulatory element binding protein-1c (SREBP-1c) is a transcription factor that controls lipogenesis in the liver. Hepatic SREBP-1c is nutritionally regulated, and its sustained activation causes hepatic steatosis and insulin resistance. Although regulation of SREBP-1c is known to occur at the transcriptional level, the precise mechanism by which insulin signaling activates SREBP-1c promoter remains to be elucidated. Here we show that protein kinase C beta (PKCbeta) is a key mediator of insulin-mediated activation of hepatic SREBP-1c and its target lipogenic genes. Activation of SREBP-1c in the liver of refed mice was suppressed by either adenoviral RNAi-mediated knockdown or dietary administration of a specific inhibitor of protein kinase C beta. The effect of PKCbeta inhibition was cancelled in insulin depletion by streptozotocin (STZ) treatment of mice. Promoter analysis indicated that PKCbeta activates SREBP-1c promoter through replacement of Sp3 by Sp1 for binding to the GC box in the sterol regulatory element (SRE) complex, a key cis-element of SREBP-1c promoter. Knockdown of Sp proteins demonstrated that Sp3 and Sp1 play reciprocally negative and positive roles in nutritional regulation of SREBP-1c, respectively. This new understanding of PKCbeta involvement in nutritional regulation of SREBP-1c activation provides a new aspect of PKCbeta inhibition as a potential therapeutic target for diabetic complications.

The generally accepted hypothesis for the pathogenesis of alcoholic liver disease (ALD) is the two-hit model, which proposes that fat accumulation in the liver increases the sensitivity of the liver to a second hit that leads to inflammatory liver cell damage. In this study we evaluated the effects of Magnolia officinalis(MO), which contains honokiol and magnolol as the primary pharmacological components, to eradicate fatty liver in rats fed an ethanol diet. In vitro studies showed that MO was able to protect RAW 264.7 cells from ethanol-induced production of tumor necrosis factor-α, reactive oxygen species, and superoxide anion radicals; the activation of NADPH oxidase; and subsequent cell death. We also investigated the therapeutic effects of MO on alcoholic fatty liver in Lieber-DeCarli ethanol diet–fed rats. MO treatment of the rats for the last 2 weeks of ethanol feeding completely reversed all the serum, hepatic parameters, and fatty liver changes. The increased maturation of sterol regulatory element– binding protein-1c in the liver by ethanol treatment was completely inhibited by treatment with MO. Therefore, MO may be a promising candidate for development as a therapeutic agent for ALD.

Little is known about the development and metabolism of the pig adipocyte, and even less is known about regulation of lipogenesis in the pig adipocyte. The objective of this study was to test the effects of insulin on the morphology of cells, the content of triacylglycerols (TG), the activity of fatty acid synthase (FAS) and the mRNA level of sterol regulatory element binding protein-1c (SREBP-1c) in porcine adipocytes in vitro. Morphologically, larger lipid droplets appeared in the presence of insulin for 48 h. Insulin-induced lipogenesis of primary porcine adipocytes was correlated with the TG content and FAS activity. There was a significant difference in the TG content and FAS activity between the insulin-treated cells and the control cells (P < 0.05); insulin increased the content of TG and FAS activity in a dose-dependent manner and the maximum activity occurred at 150 nmol L-1. The TG content and FAS activity were increased in a dose-dependent manner and maximal values were obtained when adipocytes were incubated with 150 nmol L-1insulin. The mRNA levels of SREBP-1c were also increased by insulin. In summary, lipogenesis of porcine adipocyte could be induced by insulin in a dose-dependent manner and the induced hypertrophy of porcine adipocytes partially due to the increase of TG content, FAS activity and SREBP-1c mRNA level. Key words: Lipogenesis, porcine, adipocyte, insulin, SREBP-1c

Insulin inhibits transcription of cholesterol 7α-hydroxylase (Cyp7a1), a key gene in bile acid synthesis, and the hepatic nuclear factor-4 (HNF-4) site in the promoter was identified as a negative insulin response sequence. Using a fasting/feeding protocol in mice and insulin treatment in HepG2 cells, we explored the inhibition mechanisms. Expression of sterol regulatory element-binding protein-1c (SREBP-1c), an insulin-induced lipogenic factor, inversely correlated with Cyp7a1expression in mouse liver. Interaction of HNF-4 with its coactivator, peroxisome proliferator-activated receptor-γ coactivator 1α (PGC-1α), was observed in livers of fasted mice and was reduced after feeding. Conversely, HNF-4 interaction with SREBP-1c was increased after feeding. In vitrostudies suggested that SREBP-1c competed with PGC-1α for direct interaction with the AF2 domain of HNF-4. Reporter assays showed that SREBP-1c, but not of a SREBP-1c mutant lacking the HNF-4 interacting domain, inhibited HNF-4/PGC-1α transactivation of Cyp7a1. SREBP-1c also inhibited PGC-1α-coactivation of estrogen receptor, constitutive androstane receptor, pregnane X receptor, and farnesoid X receptor, implying inhibition of HNF-4 by SREBP-1c could extend to other nuclear receptors. In chromatin immunoprecipitation studies, HNF-4 binding to the promoter was not altered, but PGC-1α was dissociated, SREBP-1c and histone deacetylase-2 (HDAC2) were recruited, and acetylation of histone H3 was decreased upon feeding. Adenovirus-mediated expression of a SREBP-1c dominant-negative mutant, which blocks the interaction of SREBP-1c and HNF-4, partially but significantly reversed the inhibition of Cyp7a1after feeding. Our data show that SREBP-1c functions as a non-DNA-binding inhibitor and mediates, in part, suppression of Cyp7a1by blocking functional interaction of HNF-4 and PGC-1α. This mechanism may be relevant to known repression of many other HNF-4 target genes upon feeding.

The transcription activator SREBP-1c (sterol-regulatory-element-binding protein-1c) is induced by insulin in the liver and is considered a master regulator of lipogenic genes such as FASN (fatty acid synthase). The question of whether SREBP-1c is also a mediator of insulin action on the regulatory enzyme of glucose metabolism GCK (glucokinase) is controversial. In the present paper, we induced SREBP-1c to various levels with insulin or the liver X receptor ligand T0901317 in primary hepatocytes and asked if these levels correlated with those of GCK or FASN mRNA expression, using the latter as positive control. Insulin and T0901317 triggered the accumulation of precursor and processed forms of SREBP-1c to similar levels and with comparable kinetics, and both effectors together caused synergistic increases in SREBP-1c protein levels. These effects were accompanied by commensurate elevation of FASN mRNA, notably by a synergistic response to both effectors. By contrast, GCK mRNA was unresponsive to T0901317 and was induced only by insulin. Treatment of hepatocytes with insulin and/or T0901317 resulted in the recruitment of SREBP-1c to the FASN promoter as shown by chromatin immunoprecipitation, whereas SREBP-1c did not bind to the GCK promoter. Lastly, we observed that the glycogen synthase kinase-3 inhibitor SB216763 produced a small increase in SREBP-1c protein level, which was further augmented in the presence of T0901317. The level of FASN mRNA varied in parallel with SREBP-1c, while GCK mRNA was unaffected. Collectively, these results showed that increases in SREBP-1c were neither necessary nor sufficient for GCK induction in hepatocytes, while at the same time they underscored the role of SREBP-1c as a key regulator of FASN.

Accumulation of intracellular lipid by pancreatic islet β-cells has been proposed to inhibit normal glucose-regulated insulin secretion (‘glucolipotoxicity’). In the present study, we determine whether over-expression in rat islets of the lipogenic transcription factor SREBP1c (sterol-regulatory-element-binding protein-1c) affects insulin release, and whether changes in islet lipid content may be reversed by activation of AMPK (AMP-activated protein kinase). Infection with an adenovirus encoding the constitutively active nuclear fragment of SREBP1c resulted in expression of the protein in approx. 20% of islet cell nuclei, with a preference for β-cells at the islet periphery. Real-time PCR (TaqMan®) analysis showed that SREBP1c up-regulated the expression of FAS (fatty acid synthase; 6-fold), acetyl-CoA carboxylase-1 (2-fold), as well as peroxisomal-proliferator-activated receptor-γ (7-fold), uncoupling protein-2 (1.4-fold) and Bcl2 (B-cell lymphocytic-leukaemia proto-oncogene 2; 1.3-fold). By contrast, levels of pre-proinsulin, pancreatic duodenal homeobox-1, glucokinase and GLUT2 (glucose transporter isoform-2) mRNAs were unaltered. SREBP1c-transduced islets displayed a 3-fold increase in triacylglycerol content, decreased glucose oxidation and ATP levels, and a profound inhibition of glucose-, but not depolarisation-, induced insulin secretion. Culture of islets with the AMPK activator 5-amino-4-imidazolecarboxamide riboside decreased the expression of the endogenous SREBP1c and FAS genes, and reversed the effect of over-expressing active SREBP1c on FAS mRNA levels and cellular triacylglycerol content. We conclude that SREBP1c over-expression, even when confined to a subset of β-cells, leads to defective insulin secretion from islets and may contribute to some forms of Type II diabetes.

The regulation of hepatic glucose metabolism has a key role in whole-body energy metabolism, since the liver is able to store (glycogen synthesis, lipogenesis) and to produce (glycogenolysis, gluconeogenesis) glucose. These pathways are regulated at several levels, including a transcriptional level, since many of the metabolism-related genes are expressed according to the quantity and quality of nutrients. Recent advances have been made in the understanding of the regulation of hepatic glycolytic, lipogenic and gluconeogenic gene expression by pancreatic hormones, insulin and glucagon and glucose. Here we review the role of the transcription factors forkhead and sterol regulatory element binding protein-1c in the inductive and repressive effects of insulin on hepatic gene expression, and the pathway that leads from glucose to gene regulation with the recently discovered carbohydrate response element binding protein. We discuss how these transcription factors are integrated in a regulatory network that allows a fine tuning of hepatic glucose storage or production, and their potential importance in metabolic diseases.

Two treatments, fasting/refeeding and administration of liver X receptor (LXR) agonists, elevate the mRNA for sterol regulatory element-binding protein-1c (SREBP-1c) and enhance lipid synthesis in liver. These treatments do not affect the mRNA for SREBP-1a, an alternative transcript from the same gene. Through homologous recombination, we eliminated the exon encoding SREBP-1c from the mouse genome, leaving the SREBP-1a transcript intact. On a normal diet, livers ofSREBP-1c−/−mice manifested reductions in multiple mRNAs encoding enzymes of fatty acid and triglyceride synthesis, including acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS). In contrast, SREBP-1c−/−livers showed a compensatory increase in hepatic SREBP-2 mRNA, accompanied by increased mRNA levels for cholesterol biosynthetic enzymes. In fasted/refed animals, ACC and FAS mRNAs rose, but not to the same extent as in wild-type livers. The refeeding-induced increase in SREBP-1c−/−mice was greater than in mice lacking SREBP cleavage-activating protein (SCAP), in which all nuclear SREBPs are absent. Thus, SREBP-2 and/or SREBP-1a can substitute partially for SREBP-1c in permitting an insulin-mediated increase in ACC and FAS mRNAs. In contrast, mRNAs for several other lipogenic enzymes (glucose-6-phosphate dehydrogenase, malic enzyme, glycerol-3-phosphate acyltransferase, and stearoyl-CoA desaturase-1) showed a complete failure of the normal inductive response to refeeding, indicating specific reliance on SREBP-1c. Moreover, these mRNAs, as well as multiple other lipogenic mRNAs, showed a markedly blunted response to the LXR agonist T090137, indicating an essential role of SREBP-1c in the LXR response.

Sterol regulatory element binding protein-1c (SREBP-1c) is a key hepatic transcription factor involved in lipogenic gene expression. In an effort to understand the role SREBP-1c plays in lipogenic gene transcription, we have examined the functional interaction between SREBP-1c, nuclear factor Y, 3,5,3′-triiodothyronine (T3) receptors, and co-activators using the S14 gene promoter as a model. T3, glucose, and insulin rapidly induce S14 gene transcription in rat liver and in primary hepatocytes. Linker scanning analyses of the S14 promoter showed that an SRE at −139/−131 base pairs (bp) binding SREBP-1c and a Y-box at −104/−99 bp binding NF-Y are indispensable for both T3- and SREBP-1c-mediated induction of S14 promoter activity in rat primary hepatocytes. T3and glucose/insulin induce S14 gene transcription through separate enhancers. Enhancer substitution studies reveal a preferential interaction between SREBP-1c·NF-Y and the T3regulatory region (−2.8/−2.5 kb) binding thyroid hormone receptor/RXR heterodimers. Elevating hepatocellular levels of specific co-activators (CBP, p/CAF, or GCN5) induced S14 promoter activity 2–3-fold, while SREBP-1c induced promoter activity 10-fold. The combination of these treatments induced S14 promoter activity (20–35-fold). However, this additive effect was lost when the T3regulatory region was deleted. Based on these results, we suggest that the SREBP-1c·NF-Y complex facilitates the interaction between co-activators that are recruited to distal hormone-regulated enhancers and the general transcription machinery that binds the S14 proximal promoter.

We have assessed the potential role of sterol regulatory element-binding protein-1c (SREBP-1c) on the transcription of the gene for the cytosolic form of phosphoenolpyruvate carboxykinase (GTP) (EC 4.1.1.32) (PEPCK-C). SREBP-1c introduced into primary hepatocytes with an adenovirus vector caused a total loss of PEPCK-C mRNA and a marked induction of fatty acid synthase mRNA that directly coincided with the appearance of SREBP-1c in the hepatocytes. It also blocked the induction of PEPCK-C mRNA by cAMP and dexamethasone in these cells. In contrast, a dominant negative form of SREBP-1c (dnSREBP-1c) stimulated the accumulation of PEPCK-C mRNA in these cells. SREBP-1c completely blocked the induction of PEPCK-C gene transcription by the catalytic subunit of protein kinase A (PKA), and increasing concentrations of dnSREBP-1c reversed the negative effect of insulin on transcription from the PEPCK-C gene promoter in WT-IR cells. The more than 10-fold induction of PKA-stimulated PEPCK-C gene transcription caused by the co-activator CBP, was also blocked by SREBP-1c. In addition, dnSREBP-1c reversed the strong negative effect of E1A and NF1 on PKA-stimulated transcription from the PEPCK-C gene promoter. An analysis of the possible site of action of SREBP-1c using stepwise truncations of the PEPCK-C gene promoter indicated that the negative effect of SREBP-1c on transcription is exerted at a site between −355 and −277. We conclude that SREBP-1c is an intermediate in the action of insulin on PEPCK-C gene transcription in the liver and acts by blocking the stimulatory effect cAMP that is mediated via an interaction with cAMP-binding protein.

The liver X receptors (LXRs) are members of the nuclear hormone receptor superfamily that are bound and activated by oxysterols. These receptors serve as sterol sensors to regulate the transcription of gene products that control intracellular cholesterol homeostasis through catabolism and transport. In this report, we describe a novel LXR target, the sterol regulatory element-binding protein-1c gene (SREBP-1c), which encodes a membrane-bound transcription factor of the basic helix-loop-helix-leucine zipper family. SREBP-1c expression was markedly increased in mouse tissues in an LXR-dependent manner by dietary cholesterol and synthetic agonists for both LXR and its heterodimer partner, the retinoid X receptor (RXR). Expression of the related gene products, SREBP-1a and SREBP-2, were not increased. Analysis of the mouse SREBP-1c gene promoter revealed an RXR/LXR DNA-binding site that is essential for this regulation. The transcriptional increase in SREBP-1c mRNA by RXR/LXR was accompanied by a similar increase in the level of the nuclear, active form of the SREBP-1c protein and an increase in fatty acid synthesis. Because this active form of SREBP-1c controls the transcription of genes involved in fatty acid biosynthesis, our results reveal a unique regulatory interplay between cholesterol and fatty acid metabolism.

The transcription factor sterol regulatory-element-binding protein-1c (SREBP-1c) plays a major role in the effect of insulin on the transcription of hepatic genes such as glucokinase and fatty acid synthase. We show here in cultured rat hepatocytes that insulin, through activation of the phosphatidylinositol 3-kinase pathway increases the abundance of the precursor form of SREBP-1c in endoplasmic reticulum. This precursor form is then rapidly cleaved, possibly irrespective of the continuous presence of insulin, leading to an increased content of the nuclear mature form of SREBP-1c. Nevertheless, the increased amount of the mature form of SREBP-1c in the nucleus is not a prerequisite for the rapid effect of insulin on the transcription of genes such as glucokinase, suggesting that additional actions of the hormone are involved, such as the activation of the nuclear form of SREBP-1c or of an unidentified SREBP-1c partner.

Excess fructose consumption is associated with the development of type 2 diabetes and obesity. However, the impact of fructose intake on maternal and fetal lipid metabolism during pregnancy is not known. The aim of this study was to examine whether maternal fructose intake during pregnancy would affect fetal and maternal hepatic lipid metabolism. Pregnant Wistar rats were randomly divided into untreated control and fructose-treated groups; the fructose-treated group received fructose via drinking water throughout pregnancy. On gestational day 20, glucose and insulin concentration in the maternal plasma were measured. The mRNA expression of sterol regulatory element-binding protein (SREBP)-1c and its target genes in the liver of dams and fetuses were analyzed by real-time PCR. Significantly higher maternal plasma glucose levels, indicating hyperglycemia, was observed in the fructose-treated group than in the control group. Furthermore, the fructose-treated group showed significantly higher expression levels of both maternal and fetal SREBP-1c mRNA and protein and significantly elevated expression of fatty acid synthase; the group also showed reduced acyl-CoA oxidase levels in the maternal liver. Thus, our results suggest that maternal fructose intake during pregnancy causes maternal hyperglycemia and up-regulates hepatic SREBP-1c expression in both fetuses and dams. This may lead to defects in carbohydrate and lipid metabolism in the adult offspring.Excess fructose consumption is associated with the development of type 2 diabetes and obesity. However, the impact of fructose intake on maternal and fetal lipid metabolism during pregnancy is not known. The aim of this study was to examine whether maternal fructose intake during pregnancy would affect fetal and maternal hepatic lipid metabolism. Pregnant Wistar rats were randomly divided into untreated control and fructose-treated groups; the fructose-treated group received fructose via drinking water throughout pregnancy. On gestational day 20, glucose and insulin concentration in the maternal plasma were measured. The mRNA expression of sterol regulatory element-binding protein (SREBP)-1c and its target genes in the liver of dams and fetuses were analyzed by real-time PCR. Significantly higher maternal plasma glucose levels, indicating hyperglycemia, was observed in the fructose-treated group than in the control group. Furthermore, the fructose-treated group showed significantly higher expression levels of both maternal and fetal SREBP-1c mRNA and protein and significantly elevated expression of fatty acid synthase; the group also showed reduced acyl-CoA oxidase levels in the maternal liver. Thus, our results suggest that maternal fructose intake during pregnancy causes maternal hyperglycemia and up-regulates hepatic SREBP-1c expression in both fetuses and dams. This may lead to defects in carbohydrate and lipid metabolism in the adult offspring.

Obesity and type 2 diabetes are associated with insulin and leptin resistance, and increased ceramide contents in target tissues. Because the adipose tissue has become a central focus in these diseases, and leptin-induced increases in insulin sensitivity may be related to effects of leptin on lipid metabolism, we investigated herein whether central leptin was able to regulate total ceramide levels and the expression of enzymes involved in ceramide metabolism in rat white adipose tissue (WAT). After 7 d central leptin treatment, the total content of ceramides was analyzed by quantitative shotgun lipidomics mass spectrometry. The effects of leptin on the expression of several enzymes of the sphingolipid metabolism, sterol regulatory element binding protein (SREBP)-1c, and insulin-induced gene 1 (INSIG-1) in this tissue were studied. Total ceramide levels were also determined after surgical WAT denervation. Central leptin infusion significantly decreased both total ceramide content and the long-chain fatty acid ceramide species in WAT. Concomitant with these results, leptin decreased the mRNA levels of enzymes involved in de novoceramide synthesis (SPT-1, LASS2, LASS4) and ceramide production from sphingomyelin (SMPD-1/2). The mRNA levels of enzymes of ceramide degradation (Asah1/2) and utilization (sphingomyelin synthase, ceramide kinase, glycosyl-ceramide synthase, GM3 synthase) were also down-regulated. Ceramide-lowering effects of central leptin were prevented by local autonomic nervous system denervation of WAT. Finally, central leptin treatment markedly increased INSIG-1 mRNA expression and impaired SREBP-1c activation in epididymal WAT. These observations indicate that in vivocentral leptin, acting through the autonomic nervous system, regulates total ceramide levels and SREBP-1c proteolytic maturation in WAT, probably contributing to improve the overall insulin sensitivity.

In the present study, we aimed to decipher the mechanisms involved in the transcriptional effect of insulin on the SREBP-1c specific promoter of the human srebf-1 gene. Using luciferase reporter gene constructs in HEK-293 cells (human embryonic kidney cells), we demonstrated that the full effect of insulin requires the presence of SREs (sterol response elements) in the proximal region of the promoter. Furthermore, insulin increases the binding of SREBP-1 (sterol-regulatory-element-binding protein-1) to this promoter region in chromatin immunoprecipitation assay. We also found that the nuclear receptors LXRs (liver X receptors) strongly activate SREBP-1c gene expression and identified the LXRE (LXR-response element) involved in this effect. However, our results suggested that these LXREs do not play a major role in the response to insulin. Finally, using expression vectors and adenoviruses allowing ectopic overexpressions of the human mature forms of SREBP-1a or SREBP-1c, we demonstrated the direct role of SREBP-1 in the control of SREBP-1c gene expression in human skeletal-muscle cells. Altogether, these results strongly suggest that the SREBP-1 transcription factors are the main mediators of insulin action on SREBP-1c expression in human tissues.

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3regulates the mouse SREBP-1c mRNA expression. We found that T3negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1–6 cells revealed that T3negatively regulates the mouse SREBP-1c gene promoter (−574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-α/thyroid hormone receptor-β heterodimer bound to Site2, but retinoid X receptor-α/liver X receptor-α heterodimer could not bind to the site. In vivochromatin immunoprecipitation assays demonstrated that T3induced thyroid hormone receptor-β recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3in vivoand that T3negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.

With the increasing incidence of obesity today, related complications such as diabetes, insulin resistance and hepatic steatosis are also becoming major concerns. Since these conditions share a common factor, aberrations in lipid metabolism, understanding the molecular changes that lead to abnormal lipid partitioning has become key to combating the obesity epidemic.

Triglyceride (TG) accumulation in pancreatic β-cells is thought to be associated with impaired insulin secretory response to glucose (lipotoxicity). To better understand the mechanism of the impaired insulin secretory response to glucose in β-cell lipotoxicity, we overexpressed a constitutively active form of the sterol regulatory element-binding protein- 1c (SREBP-1c), a master transcriptional factor of lipogenesis, in INS-1 cells with an adenoviral vector. This treatment was associated with strong activation of transcription of the genes involved in fatty acid biosynthesis, increased cellular TG content, severely blunted glucose-stimulated insulin secretion, and enhanced expression of the uncoupling protein-2 (UCP-2), which supposedly dissipates the mitochondrial electrochemical potential. To decrease the up-regulated UCP-2 expression, small interfering RNA for UCP-2 was used. Introduction of the small interfering RNA increased the ATP/ADP ratio and partially rescued the glucose-stimulated insulin secretion in the cells overexpressing SREBP-1c, but did not affect the cellular TG content. Next, the effect of the AMP-activated protein kinase (AMPK) agonist, 5-amino-4-imidazolecarboxamide riboside, was examined in the lipotoxicity model. Exposure of the cells with lipotoxicity to 5-amino-4-imidazolecarboxamide riboside increased free fatty acid oxidation, partially reversed the TG accumulation, phosphorylated AMPK and acetyl-coenzyme A carboxylase, and improved the impaired glucose-stimulated insulin secretion. These results suggest that UCP-2 down-regulation and AMPK activation could be candidate targets for releasing β-cells from lipotoxicity.

The expression of SREBP-1 (sterol-regulatory-element-binding protein-1) isoforms differs between tissues and cultured cell lines in that SREBP-1a is the major isoform in established cell lines, whereas SREBP-1c predominates in liver and most other human tissues. SREBP-1c is transcriptionally less active than SREBP-1a, but is a main mediator of hepatic insulin action and is selectively up-regulated by LXR (liver X receptor) agonists. LXR-mediated transactivation is co-activated by PGC-1α (peroxisome-proliferator-activated receptor-γ co-activator-1α), which displays deficient expression in skeletal-muscle-derived cell lines. In the present paper, we show that PGC-1α expression is also deficient in HepG2 cells and in a human brown adipocyte cell line (PAZ6). In transient transfection studies, PGC-1α selectively amplified the LXR-mediated transcription from the human SREBP-1c promoter in HepG2 and PAZ6 cells via two LXR-response elements with extensive similarity to the respective murine sequence. Mutational analysis showed that the human LXR-response element-1 (hLXRE-1) was essential for co-activation of LXR-mediated SREBP-1c gene transcription by PGC-1α. Ectopic overexpression of PGC-1α in HepG2 cells enhanced basal SREBP-1c and, to a lesser extent, -1a mRNA expression, but only SREBP-1c expression was augmented further in an LXR/RXR (retinoic X receptor)-dependent fashion, thereby inducing mRNA abundance levels of SREBP-1c target genes, fatty acid synthase and acetyl-CoA carboxylase. These results indicate that PGC-1α contributes to the regulation of SREBP-1 gene expression, and can restore the SREBP-1 isoform expression pattern of HepG2 cells to that of human liver.

Liver X receptors (LXRs) and peroxisome proliferator-activated receptors (PPARs) are members of nuclear receptors that form obligate heterodimers with retinoid X receptors (RXRs). These nuclear receptors play crucial roles in the regulation of fatty acid metabolism: LXRs activate expression of sterol regulatory element-binding protein 1c (SREBP-1c), a dominant lipogenic gene regulator, whereas PPARα promotes fatty acid β-oxidation genes. In the current study, effects of PPARs on the LXR-SREBP-1c pathway were investigated. Luciferase assays in human embryonic kidney 293 cells showed that overexpression of PPARα and γ dose-dependently inhibited SREBP-1c promoter activity induced by LXR. Deletion and mutation studies demonstrated that the two LXR response elements (LXREs) in the SREBP-1c promoter region are responsible for this inhibitory effect of PPARs. Gel shift assays indicated that PPARs reduce binding of LXR/RXR to LXRE. PPARα-selective agonist enhanced these inhibitory effects. Supplementation with RXR attenuated these inhibitions by PPARs in luciferase and gel shift assays, implicating receptor interaction among LXR, PPAR, and RXR as a plausible mechanism. Competition of PPARα ligand with LXR ligand was observed in LXR/RXR binding to LXRE in gel shift assay, in LXR/RXR formation in nuclear extracts by coimmunoprecipitation, and in gene expression of SREBP-1c by Northern blot analysis of rat primary hepatocytes and mouse liver RNA. These data suggest that PPARα activation can suppress LXR-SREBP-1c pathway through reduction of LXR/RXR formation, proposing a novel transcription factor cross-talk between LXR and PPARα in hepatic lipid homeostasis.

We evaluated the hypothesis of sterol-regulatory element-binding protein (SREBP)-1c being a general mediator of the transcriptional effects of insulin, with a focus on adipocytes, in which insulin profoundly influences specific gene expression. Using real time quantitative reverse transcriptase-PCR to monitor changes in the expression of about 50 genes that cover a wide range of adipocyte functions, we have compared the impact of insulin treatment with that of adenoviral overexpression of either dominant positive or dominant negative SREBP-1c mutants in 3T3-L1 adipocytes. As expected, insulin up-regulated, dominant positive stimulated, and dominant negative decreased previously characterized direct SREBP targets (FAS, SCD-1, and low density lipoprotein receptor). We also identified three novel SREBP-1c transcriptional targets in adipocytes, which were confirmed by run-on assays: plasminogen activator inhibitor 1, CCAAT/enhancer-binding protein delta (C/EBPdelta), and C/EBPbeta. Because most insulin-regulated genes were also modulated by SREBP-1c mutants, our data establish that 1) SREBP-1c is an important mediator of insulin transcriptional effects in adipocytes, and 2) C/EBPbeta is under the direct control of SREBP-1c, as demonstrated by the ability of SREBP-1c to activate the transcription from C/EBPbeta promoter through canonical SREBP binding sites. Thus, some of the effects of insulin and/or SREBP-1c in mature fat cells might require C/EBPbeta or C/EBPdelta as transcriptional relays.

Ileal bile acid-binding protein (I-BABP) is a cytosolic protein that binds bile acid (BA) specifically. In the ileum, it is thought to be implied in their enterohepatic circulation. Because the fecal excretion of BA represents the main physiological way of elimination for cholesterol (CS), the I-BABP gene could have a major function in CS homeostasis. Therefore, the I-BABP gene expression might be controlled by CS. I-BABP mRNA levels were significatively increased when the human enterocyte-like CaCo-2 cells were CS-deprived and repressed when CS were added to the medium. A highly conserved sterol regularory element-like sequence (SRE) and a putative GC box were found in human I-BABP gene promoter. Different constructs of human I-BABP promoter, cloned upstream of a chloramphenicol acetyltransferase (CAT) reporter gene, have been used in transfections studies. CAT activity of the wild type promoter was increased in presence of CS-deprived medium, and conversely, decreased by a CS-supplemented medium. The inductive effect of CS depletion was fully abolished when the putative SRE sequence and/or GC box were mutated or deleted. Co-transfections experiments with the mature isoforms of human sterol responsive element-binding proteins (SREBPs) and Sp1 demonstrate that the CS-mediated regulation of I-BABP gene was dependent of these transcriptional factors. Paradoxically, mice subjected to a standard chow supplemented with 2% CS for 14 days exhibited a significant rise in both I-BABP and SREBP1c mRNA levels. We show that in vivo, this up-regulation could be explained by a recently described regulatory pathway involving a positive regulation of SREBP1c by liver-X-receptor following a high CS diet.

Recent data suggest that sterol regulatory-binding protein (SREBP)-1c plays a key role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis as a key regulator of fuel metabolism. SREBP-1c regulates its downstream genes by changing its own mRNA level, which led us to sequence and analyze the promoter region of the mouse SREBP-1c gene. A cluster of putative binding sites of several transcription factors composed of an NF-Y site, an E-box, a sterol-regulatory element 3, and an Sp1 site were located at −90 base pairs of the SREBP-1c promoter. Luciferase reporter gene assays indicated that this SRE complex is essential to the basal promoter activity and confers responsiveness to activation by nuclear SREBPs. Deletion and mutation analyses suggest that the NF-Y site and SRE3 in the SRE complex are responsible for SREBP activation, although the other sites were also involved in the basal activity. Gel mobility shift assays demonstrate that SREBP-1 binds to the SRE3. Taken together, these findings implicate a positive loop production of SREBP-1c through the SRE complex, possibly leading to the overshoot in induction of SREBP-1c and its downstream genes seen in the livers of refed mice. Furthermore, reporter assays using larger upstream fragments indicated another region that was inducible by addition of sterols. The presence of the SRE complex and a sterol-inducible region in the same promoter suggests a novel regulatory link between cholesterol and fatty acid synthesis.

We show that Id (inhibitor of DNA binding) 2 and Id3, dominant negative members of the helix-loop-helix (HLH) family, interact with the adipocyte determination and differentiation factor 1 (ADD1)/sterol regulatory element-binding protein (SREBP) 1c, a transcription factor of the basic HLH-leucine zipper family that controls the expression of several key genes of adipose metabolism. Gel mobility-shift assays performed with in vitro-translated ADD1, Id2 or Id3 proteins and a fatty acid synthase (FAS) promoter oligonucleotide showed evidence for a marked inhibition of the formation of DNA-ADD1 complexes by Id2 or Id3 proteins. Co-immunoprecipitation studies using in vitro-translated proteins demonstrated further the physical interaction of Id and ADD1/SREBP-1c proteins in the absence of DNA. Using the FAS gene as a model of an ADD1-regulated promoter in transiently transfected isolated rat adipocytes or mature 3T3-L1 adipocytes, a potent inhibition of the activity of the FAS-chloramphenicol acetyltransferase reporter gene was observed by overexpression of Id2 or Id3. Reciprocally, co-transfection of Id3 antisense and ADD1 expression vectors in preadipocytes potentiated the ADD1/SREBP-1c effect on the FAS promoter activity. Finally, in the non adipogenic NIH-3T3 cell line, most of the ADD1-mediated trans-activation of the FAS promoter was counteracted by co-transfection of Id2 or Id3 expression vectors. Previous studies have indicated Id gene expression to be down-regulated during adipogenesis [Moldes, Lasnier, Fève, Pairault and Djian (1997) Mol. Cell. Biol. 17, 1796-1804]. We here demonstrated that there was a dramatic rise of Id2 and Id3 mRNA levels when 3T3-L1 adipocytes or isolated rat fat cells were exposed to lipolytic and anti-lipogenic agents, forskolin and isoproterenol. Taken together, our data show that Id products are functionally involved in modulating ADD1/SREBP-1c transcriptional activity, and thus lipogenesis in adipocytes.

Sterol-regulatory-element-binding protein 1c (SREBP-1c) is one member of the family of transcription factors that stimulate sterol and fatty-acid biosynthesis in animal cells. Human SREBP-1c, mapped to chromosome 17p11.2, is expressed in liver, intestine, skeletal muscle and adipocytes. A section of genomic sequence from a chromosome 17 library, thought to contain the SREBP-1c promoter, was cloned. Putative transcription-factor-binding sites and a potential transcriptional start site were identified using the Genomatix Suite of sequence analysis tools (MatInspector®). Sequence analysis showed the human promoter to be 42% identical with the previously published mouse sequence. Two novel transcription-factor-binding sites were identified: those for PDX-1 (pancreatic–duodenal homoeobox-1) and HNF-4 (hepatic nuclear factor-4). Co-transfection experiments with overexpression plasmids for PDX-1 and HNF-4 suggested that both factors stimulate SREBP-1c gene expression, although further work is required to ascertain their mechanisms of action.

Alcoholic liver disease is one of the leading causes of liver-related morbidity and mortality worldwide, but effective treatments are still lacking. Honokiol, a lignin-type natural compound isolated from the leaves and bark of Magnolia plants, has been widely studied for its beneficial effects on several chronic diseases. Accumulating studies have revealed that honokiol displays a potential therapeutic effect on alcoholic liver disease. In this study, the protective activity of honokiol on alcoholic liver disease was confirmed due to its significant inhibitory activity on the expression levels of inflammatory cytokines (such as tumor necrosis factor-alpha, interleukin-6, and interleukin-1 β) in EtOH-fed mice and in EtOH-induced AML-12 cells. Meanwhile, the expression of the lipid metabolic parameter sterol regulatory element-binding protein-1c was also reduced. However, peroxisome proliferator-activated receptor α was increased in animal and cell experiments, which indicates that the activity of honokiol was related to its regulated activity on lipid metabolism. The result showed that honokiol significantly inhibited the expression level of p38 α in vivo and in vitro. Blocking p38 α inhibited the expression levels of tumor necrosis factor-alpha, interleukin-6, interleukin-1 β , and sterol regulatory element-binding protein-1c but promoted the expression level of peroxisome proliferator-activated receptor α compared with the honokiol-treated group. Moreover, the forced expression level of p38 α further produced the opposite effect on inflammatory cytokines and lipid metabolism indicators. Furthermore, p38 α has been related to the activation of the nuclear factor kappa B signaling pathway. In our study, honokiol significantly inhibited the activation of the nuclear factor kappa B signaling pathway mediated by p38 α. In conclusion, the results suggest that honokiol might be an effective regulator of p38 α by downregulating the nuclear factor kappa B signaling pathway, thereby reducing the inflammatory response and lipid metabolism disorder in alcoholic liver disease. [ABSTRACT FROM AUTHOR]

Metabolic dysfunction-associated steatotic liver disease (MASLD) is primarily attributed to the abnormal upregulation of hepatic lipogenesis, which is especially caused by the overactivation of the liver X receptor/sterol regulatory element-binding protein-1c (LXR/SREBP-1c) pathway in hepatocytes. In this study, we report the rational design and synthesis of a novel series of squaramides via bioisosteric replacement, which was evaluated for its inhibitory activity on the LXR/SREBP-1c pathway using dual cell-based assays. Compound 31was found to significantly downregulate LXR, SREBP-1c, and their target genes associated with lipogenesis. Further investigation revealed that compound 31may indirectly inhibit the LXR/SREBP-1c pathway by activating the upstream regulator sirtuin 6 (SIRT6). Encouragingly, compound 31substantially attenuated lipid accumulation in HepG2 cells and in the liver of high-fat-diet-fed mice. These findings suggest that compound 31holds promise as a candidate for the development of treatments for MASLD and other lipid metabolism-related diseases.

This study was conducted to explore the regulatory mechanism of leucine (Leu) on lipid metabolism of finishing pigs. Twenty-four Duroc × Landrace × Large cross pigs with an average body weight of 68.33 ± 0.97 kg were randomly allocated into 3 treatment groups with 8 replicates per group (1 pig per replicate). The dietary treatments were as follows: control group (CON), 0.25% Leu group and 0.50% Leu group. The experimental period was 42 d. The results showed as follows. (1) Compared with the CON, 0.25% and 0.50% Leu increased (P < 0.01) the average daily gain (ADG), while the average backfat thickness (ABT) and the ratio of feed intake to body weight gain (F:G ratio) were decreased (P < 0.05). (2) In the 0.25% Leu group, the relative mRNA expression levels of sterol regulatory element binding protein-1c (SREBP1c), recombinant fatty acid transport protein 1 (FATP1), chemerin and peroxisome proliferator-activated receptor γ (PPARγ) were decreased but the level of fatty acid binding protein 4 (FABP4) and fatty acid translocase (FAT/CD36) were increased in backfat tissue. In the 0.25% Leu group, the protein levels of p-Rictor, p-Raptor, p-eIF4E-binding protein 1 (p-4EBP1), p-silent mating type information regulator 2 homolog 1 (p-SIRT1) and acetylation ribosome s6 protein kinase 1 (Ac–S6K1) were increased (P < 0.05). (3) Compared to the CON, the diversity of gut microbiota in the 0.25% Leu group was increased. Principal component analysis showed that the relative abundance of Bacteroidetes, Lactobacillusand Desulfovibriowas higher in the 0.25% Leu group than the CON, but the relative abundance of Firmicutes, Treponemaand Shigellawas lower than in the CON (P < 0.05). (4) Four different metabolites were screened out from the serum of finishing pigs including allolithocholic acid (alloLCA), isolithocholic acid (isoLCA), ursodeoxycholic acid (UDCA) and hyodeoxycholic acid (HDCA), which correlate to various degrees with the above microorganisms. In conclusion, Leu could promote adipose tissue lipolysis of finishing pigs through the mTOR-SIRT1 signaling pathway, and S6K1 is acetylated at the same time, and the interaction between gut microbiota and bile acid metabolism is also involved.

Despite the increasing clinical importance of nonalcoholic fatty liver disease (NAFLD), little is known about its underlying pathogenesis or specific treatment. The senescence marker protein 30 (SMP30), which regulates the biosynthesis of vitamin C (VC) in many mammals, except primates and humans, was recently recognized as a gluconolactonase. However, the precise relation between VC and lipid metabolism in NAFLD is not completely understood. Therefore, this study aimed to clearly reveal the role of VC in NAFLD progression. SMP30 knockout (KO) mice were used as a VC-deficient mouse model. To investigate the precise role of VC on lipid metabolism, 13- to 15-week–old SMP30 KO mice and wild-type mice fed a 60% high-fat diet were exposed to tap water or VC-containing water (1.5 g/L) ad libitum for 11 weeks. Primary mouse hepatocytes isolated from the SMP30 KO and wild-type mice were used to demonstrate the relation between VC and lipid metabolism in hepatocytes. Long-term VC deficiency significantly suppressed the progression of simple steatosis. The high-fat diet–fed VC-deficient SMP30 KO mice exhibited impaired sterol regulatory element-binding protein-1c activation because of excessive cholesterol accumulation in hepatocytes. Long-term VC deficiency inhibits de novolipogenesis through impaired sterol regulatory element-binding protein-1c activation.

A study conducted by researchers at Pusan National University in Busan, South Korea, has found that dimethyloxalylglycine (DMOG) can suppress the expression of lipogenic genes in hepatocytes independently of hypoxia-inducible factor-1-alpha (HIF1A). DMOG inhibits the transcriptional activity of sterol regulatory element-binding protein-1c (SREBP1c), a master regulator of fatty acid synthesis in hepatocytes. The study suggests that DMOG may have anti-lipogenic effects through non-canonical pathways, highlighting the need for further research in this area. The research was funded by the National Research Foundation of Korea. [Extracted from the article]

The oxidation of fats and oils is an undisputed subject of science, given the effect of oxidized fats and oils on food quality and safety. This study aimed to determine whether maternal exposure to oxidized soybean oil (OSO) causes lipid metabolism disorders in the liver and whether this lipid metabolism disorder can be transmitted to offspring or even worsened. A total of 60 female Sprague–Dawley (SD) rats were divided randomly into four groups in this study. Treatment groups received a pure diet of OSO with a peroxide value of 200, 400, or 800 mEqO2/kg, while the control group received fresh soybean oil (FSO). As for our results, OSO affected serum biochemical parameters in the maternal generation (F0) and induced liver histopathology changes, inflammation, and oxidative stress. Moreover, the expression of genes related to the liver X receptor α (LXRα)─sterol regulatory element binding protein-1c (SREBP-1c) signaling pathway was changed. Similar trends were found in the livers of offspring on postnatal days 21 and 56. In conclusion, exposure to OSO during gestation and lactation can affect liver lipid synthesis. Additionally, it is detrimental to the development of the offspring’s liver, affecting fatty acid metabolism and causing liver damage.

Obesity is one of the principal reasons behind a wide range of metabolic diseases and dramatic health complications. Recent studies shed the light on chia (Salvia hispanicaL., Lamiaceae) and quinoa (Chenopodium quinoaWilld., Amaranthaceae) seeds and identified them as products of utmost health benefits. The present study was designed to explore the molecular mechanisms of the hydroalcoholic extract of those seeds in weight management. Rats were divided randomly into two main groups: control and treated. The control groups received regular chow diet, high-fat diet, and green tea. The treated groups received high-fat diet and chia or quinoa extracts. Results revealed that the seeds showed hepatoprotective effects and anti-inflammatory and antioxidant activities, and modulated leptin, adiponectin, serum lipid, and glycemic profiles. Effects are further consolidated by normal hepatic tissue architecture upon histopathological examination. Moreover, modulation of peroxisome proliferator-activated receptors-γ transcriptional activity via activation of 5′AMP-activated protein kinase and suppression of nuclear expression of sterol regulatory element-binding protein-1c in obese rats as compared to green tea were demonstrated. Characterization of the major secondary bioactive metabolites was done using HPLC/PDA/ESI-MS/MS. Our study advocates evidence-based study on nutrition and health claims on the use of chia and quinoa extracts as nutraceutical supplements for promoting weight wellness and alleviating its related metabolic disorders.

Nonalcoholic fatty liver disease (NAFLD) is among the most prevalent chronic liver diseases around the globe. The accumulation of lipids in the liver and oxidative stress are important pathological mechanisms of NAFLD. Astaxanthin (AT) is a carotenoid extracted from shrimps and crabs with beneficial biological activities, including anti-oxidative and anti-inflammatory activities. 16S microflora sequencing, H&E staining, and the western blot technique were employed to investigate the impacts of AT on a high-fat diet (HFD)-induced NAFLD. Significant mitigation in lipid metabolism-related disorders and decreased oxidative stress in HFD-induced mice were observed due to AT, and significant changes in the gut flora of the model mice were also observed. The in vitrostudy showed that AT considerably lowered the protein expression level of fatty acid synthetase (FAS), sterol regulatory element-binding protein-1c (SREBP-1c), and acetyl-COA carboxylase (ACC) and increased the protein expression of nuclear factor-E2 associated factor 2 (Nrf2) and AMP-activated protein kinase (AMPK) in oleic acid (OA) and palmitic acid (PA)-induced HepG2 cells. Additionally, mechanistic studies revealed that compound C (AMPK inhibitor, CC) inhibited the regulatory effect of AT on the SREBP-1c and Nrf2 signaling pathways. In conclusion, AT can inhibit the SREBP-1c, FAS, and ACC signaling pathways, activate the AMPK and Nrf2 signaling pathways, and improve the structure of intestinal flora.

A recent study conducted by researchers at the First Affiliated Hospital of Jinzhou Medical University explores the effect of FPS-ZM1, an inhibitor for receptor for AGEs (RAGE), on lipid deposition in the liver of mice with nonalcoholic fatty liver disease (NAFLD) and type 2 diabetes mellitus (T2DM). The study found that lipid deposition in the liver was increased in mice with T2DM compared to control mice. However, treatment with FPS-ZM1 resulted in a decrease in lipid deposition in liver cells. The researchers concluded that FPS-ZM1 may attenuate lipid deposition in hepatocytes of diabetic mice through the down-regulation of SREBP-1c, p65 nfkb, and p38 MAPK phosphorylation. [Extracted from the article]

Non-alcoholic fatty liver disease (NAFLD), with a global prevalence of 25%, continues to escalate, creating noteworthy concerns towards the global health burden. NAFLD causes triglycerides and free fatty acids to build up in the liver. The excessive fat build-up causes inflammation and damages the healthy hepatocytes, leading to non-alcoholic steatohepatitis (NASH). Dietary habits, obesity, insulin resistance, type 2 diabetes, and dyslipidemia influence NAFLD progression. The disease burden is complicated due to the paucity of therapeutic interventions. Obeticholic acid is the only approved therapeutic agent for NAFLD. With more scientific enterprise being directed towards the understanding of the underlying mechanisms of NAFLD, novel targets like lipid synthase, farnesoid X receptor signalling, peroxisome proliferator-activated receptors associated with inflammatory signalling, and hepatocellular injury have played a crucial role in the progression of NAFLD to NASH. Phytocompounds have shown promising results in modulating hepatic lipid metabolism and de novo lipogenesis, suggesting their possible role in managing NAFLD. This review discusses the ameliorative role of different classes of phytochemicals with molecular mechanisms in different cell lines and established animal models. These compounds may lead to the development of novel therapeutic strategies for NAFLD progression to NASH. This review also deliberates on phytomolecules undergoing clinical trials for effective management of NAFLD. [ABSTRACT FROM AUTHOR]

We aimed to investigate whether phloridzin could alleviate nonalcoholic fatty liver disease (NAFLD) in mice, which was induced by feeding a high-fat diet (HFD). We initially analyzed the effect of phloridzin on alleviating HFD-induced NAFLD in C57BL/6J mice and oleic acid (OA)-stimulated human normal liver L-02 cells (L02). Then, we investigated the mechanism of phloridzin on the mTORC1/sterol-regulatory element-binding protein-1c (SREBP-1c) signaling pathway by siRNA analysis, qRT-PCR, flow cytometry, and western blot analysis in vivoand in vitro. The results revealed that phloridzin significantly inhibited the increase in body weight, alleviated abnormal lipid metabolism, and decreased lipid biosynthesis and insulin resistance. Moreover, phloridzin augmented the number of CD8+CD122+PD-1+Tregs and CD4+FoxP3+Tregs in HFD-fed C57BL/6J mice and HFD-fed aP2-SREBF1c mice and downregulated the mTORC1/SREBP-1c signaling pathway-related protein expressions in vivoand in vitro. Furthermore, phloridzin reduced the expression of SREBP-1c in SREBP-1c-RNAi-lentivirus-transfected L02 cells and reversed the SREBP-1c expression in HFD-fed aP2-SREBF1c transgenic mice. Phloridzin ameliorates lipid accumulation and insulin resistance viainhibiting the mTORC1/SREBP-1c pathways. These results indicated that phloridzin may actively ameliorate NAFLD.

The mechanisms of highland barley whole grain (BWG) with rich phenolics on obese db/db mice were investigated in this study. Oral consumption of BWG reduced food intake, body weight, organ/body weight indexes of liver and fat, levels of serum and hepatic lipids, liver injury, and oxidative stress. Furthermore, BWG recovered the disorder of cecal microbiota by augmenting the Bacteroidetes/Firmicutesratio and Alistipesabundance and decreasing the abundances of Bacteroidesand Desulfovibrionaceaeto modulate lipid metabolism-related genes. BWG inhibited fatty acid biosynthesis via upregulating the phosphorylation of AMP-activated protein kinase α, while downregulating sterol regulatory element binding protein-1c, fatty acid synthase (FAS), and stearoyl-CoA desaturase 1 levels. BWG also significantly downregulated miRNA-122, miRNA-33, miRNA-34a, and miRNA-206 levels. Accordingly, BWG exhibited hypolipidemic potential through modulating cecal microbiota, AMPK/SREBP-1c/FAS pathway, and related miRNAs, triggering the alleviation of dyslipidemia. These findings suggested BWG as an effective candidate to ameliorate the symptoms of hyperlipidemia.