Search

Endogenous banana streak virus (eBSV) integrants derived from three distinct species, present in Musa balbisiana (B) but not Musa acuminata (A) banana genomes are able to reconstitute functional episomal viruses causing banana streak disease in interspecific triploid AAB banana hybrids but not in the diploid (BB) parent line, which harbours identical eBSV loci. Here, we investigated the regulation of these eBSV. In-depth characterization of siRNAs, transcripts and methylation derived from eBSV using Illumina and bisulfite sequencing were carried out on eBSV-free Musa acuminata AAA plants and BB or AAB banana plants with eBSV. eBSV loci produce low-abundance transcripts covering most of the viral sequence and generate predominantly 24-nt siRNAs. siRNA accumulation is restricted to duplicated and inverted viral sequences present in eBSV. Both siRNA-accumulating and nonaccumulating sequences of eBSV in BB plants are heavily methylated in all three CG, CHG and CHH contexts. Our data suggest that eBSVs are controlled at the epigenetic level in BB diploids. This regulation not only prevents their awakening and systemic infection of the plant but is also probably involved in the inherent resistance of the BB plants to mealybug-transmitted viral infection. These findings are thus of relevance to other plant resources hosting integrated viruses.

Plant hydraulics is crucial for assessing the plants' capacity to extract and transport water from the soil up to their aerial organs. Along with their capacity to exchange water between plant compartments and regulate evaporation, hydraulic properties determine plant water relations, water status and susceptibility to pathogen attacks. Consequently, any variation in the hydraulic characteristics of plants is likely to significantly impact various mechanisms and processes related to plant growth, survival and production, as well as the risk of biotic attacks and forest fire behaviour. However, the integration of hydraulic traits into disciplines such as plant pathology, entomology, fire ecology or agriculture can be significantly improved. This review examines how plant hydraulics can provide new insights into our understanding of these processes, including modelling processes of vegetation dynamics, illuminating numerous perspectives for assessing the consequences of climate change on forest and agronomic systems, and addressing unanswered questions across multiple areas of knowledge.

In this Opinion paper, members of the French Network on Xanthomonads give their personal view on what they consider to be some of the groundbreaking discoveries in the field of molecular plant pathology over the past 20 years. By celebrating the 20th anniversary of the first Xanthomonas genome sequences, they explain how genomics revolutionized taxonomy, provided insight into the emergence of pathogenic bacteria, enabled new fundamental discoveries and contributed to the development of novel control measures. Collectively, such new, genomics-enabled perspective will help to ensure sustainable agriculture and conservation of our environment in the future.

Traditional agrosystems, where humans, crops and microbes have coevolved over long periods, can serve as models to understand the ecoevolutionary determinants of disease dynamics and help the engineering of durably resistant agrosystems. Here, we investigated the genetic and phenotypic relationship between rice (Oryza sativa) landraces and their rice blast pathogen (Pyricularia oryzae) in the traditional Yuanyang terraces of flooded rice paddies in China, where rice landraces have been grown and bred over centuries without significant disease outbreaks. Analyses of genetic subdivision revealed that indica rice plants clustered according to landrace names. Three new diverse lineages of rice blast specific to the Yuanyang terraces coexisted with lineages previously detected at the worldwide scale. Population subdivision in the pathogen population did not mirror pattern of population subdivision in the host. Measuring the pathogenicity of rice blast isolates on landraces revealed generalist life history traits. Our results suggest that the implementation of disease control strategies based on the emergence or maintenance of a generalist lifestyle in pathogens may sustainably reduce the burden of disease in crops.

The Global Plant Health Assessment (GPHA) is a collective, volunteer-based effort to assemble expert opinions on plant health and disease impacts on ecosystem services based on published scientific evidence. The GPHA considers a range of forest, agricultural, and urban systems worldwide. These are referred to as (Ecoregion × Plant System), i.e., selected case examples involving keystone plants in given parts of the world. The GPHA focuses on infectious plant diseases and plant pathogens, but encompasses the abiotic (e.g., temperature, drought, and floods) and other biotic (e.g., animal pests and humans) factors associated with plant health. Among the 33 (Ecoregion × Plant System) considered, 18 are assessed as in fair or poor health, and 20 as in declining health. Much of the observed state of plant health and its trends are driven by a combination of forces, including climate change, species invasions, and human management. Healthy plants ensure (i) provisioning (food, fiber, and material), (ii) regulation (climate, atmosphere, water, and soils), and (iii) cultural (recreation, inspiration, and spiritual) ecosystem services. All these roles that plants play are threatened by plant diseases. Nearly none of these three ecosystem services are assessed as improving. Results indicate that the poor state of plant health in sub-Saharan Africa gravely contributes to food insecurity and environmental degradation. Results further call for the need to improve crop health to ensure food security in the most populated parts of the world, such as in South Asia, where the poorest of the poor, the landless farmers, are at the greatest risk. The overview of results generated from this work identifies directions for future research to be championed by a new generation of scientists and revived public extension services. Breakthroughs from science are needed to (i) gather more data on plant health and its consequences, (ii) identify collective actions to manage plant systems, (iii) e

Diversification of cropping systems is a lever for the management of epidemics. However, most research to date has focused on cultivar mixtures, especially for cereals, even though crop mixtures can also improve disease management. To investigate the benefits of crop mixtures, we studied the effect of different crop mixture characteristics (i.e., companion proportion, sowing date, and traits) on the protective effect of the mixture. We developed a SEIR (Susceptible, Exposed, Infectious, Removed) model of two damaging wheat diseases (Zymoseptoria tritici and Puccinia triticina), which were applied to different canopy components, ascribable to wheat and a theoretical companion crop. We used the model to study the sensitivity of disease intensity to the following parameters: wheat-versus-companion proportion, companion sowing date and growth, and architectural traits. For both pathogens, the companion proportion had the strongest effect, with 25% of companion reducing disease severity by 50%. However, changing companion growth and architectural traits also significantly improved the protective effect. The effect of companion characteristics was consistent across different weather conditions. After decomposing the dilution and barrier effects, the model suggested that the barrier effect is maximized for an intermediate proportion of companion crop. Our study thus supports crop mixtures as a promising strategy to improve disease management. Future studies should identify real species and determine the combination of host and companion traits to maximize the protective effect of the mixture.

Analyses of crop-specific cropland and trade network structures provide a first step for guiding strategies to manage emerging crop pathogens, for iterative improvement as more detailed data become available. We analyzed global to regional cropland and trade networks for the potential spread of emerging pathogens in twelve crops key to food sustainability. We identified which locations have high cropland connectivity globally, and in a more detailed analysis for Central America. A location with high cropland connectivity is more likely to have an important role in epidemics, and so is a candidate for prioritizing mitigation. In epidemic scenario analyses to evaluate relative risk for each crop, we identified countries in the Americas with cropland patterns more likely to result in high levels of pathogen establishment, and so more likely to need focused attention to manage invasions. Country-specific trade networks indicate how invasion risk varies among crops and pathogens, and which components of the network merit particular phytosanitary attention. Using these maps of risk for planning in advance can inform phytosanitary strategies globally, regionally, and within countries, for an efficient response to epidemic invasion. Integrating cropland and trade connectivity with other geographic factors - such as weather conduciveness, management landscapes, regional transportation, local trade, and international phytosanitary networks, will strengthen pest risk assessment and mitigation.

Le riz est la deuxième céréale la plus produite dans le monde. En Afrique, de nombreux Etats fondent leur espoir sur la production locale de riz pour atteindre la sécurité alimentaire. Les problèmes phytosanitaires contribuent à l'insécurité alimentaire. L'helminthosporiose du riz est une maladie fongique qui peut attaquer le riz à tous les stades de son développement. En Afrique subsaharienne, cette maladie est en progression dans de nombreux pays et cause des pertes d'environ 3,3% de la production. Malgré ce constat, les espèces responsables de la maladie, la diversité génétique et la structuration de leurs populations restent peu connues. Ces connaissances sont primordiales à l'élaboration de stratégies efficaces de lutte contre l'helminthosporiose du riz en Afrique de l'Ouest. Cette thèse avait pour objectifs : (i) d'identifier les espèces responsables de l'helminthosporiose du riz en Afrique de l'Ouest et d'évaluer leur pathogénie en milieu contrôlé, (ii) d'analyser la diversité génétique et le mode de reproduction des espèces les plus fréquentes, (iii) et de développer des outils de détection. La caractérisation par genotyping by sequencing (GBS) de 469 isolats isolés des symptômes de l'helminthosporiose du riz a permis d'assigner les isolats à des espèces : deux espèces majoritaires, Bipolaris oryzae (37%) et Exserohilum rostatum (41%), et 9 espèces moins fréquentes (<5% ; B. bicolor, B. maydis, B. sorokiniana, B. secalis, B. yamadae, Curvularia hawaiiensis, C. papendorfii, C. spicifera et E. turcicum). Les deux espèces les plus fréquentes ont été identifiées dans la plupart des pays échantillonnés. L'analyse de la structure génétique de B. oryzae et E. rostratum réalisée sur des échantillons provenant de 6 zones rizicoles du Burkina Faso a montré que la différenciation génétique était plus importante au sein des populations qu'entre les populations. Chacune des espèces était structurée en 4 groupes génétiques dont la distribution était indépendante de l'orig

Molecular epidemiology studies are essential to refine our understanding of migrations of phytopathogenic bacteria, the major determining factor in their emergence, and to understand the factors that shape their population structure. Microsatellite and minisatellite typing are useful techniques for deciphering the population structure of Xanthomonas citri pv. citri, the causal agent of Asiatic citrus canker. This paper presents a molecular epidemiology study, which has improved our understanding of the history of the pathogen's introductions into the Arabian Peninsula, since it was first reported in the 1980s. An unexpectedly high genetic diversity of the pathogen was revealed. The four distinct genetic lineages within X. citri pv. citri, which have been reported throughout the world, were identified in the Arabian Peninsula, most likely as the result of multiple introductions. No copper-resistant X. citri pv. citri strains were identified. The pathogen's population structure on Mexican lime (their shared host species) was closely examined in two countries, Saudi Arabia and Yemen. We highlighted the marked prevalence of specialist pathotype A* strains in both countries, which suggests that specialist strains of X. citri pv. citri may perform better than generalist strains when they occur concomitantly in this environment. Subclade 4.2 was the prevailing lineage identified. Several analyses (genetic structure deciphered by discriminant analysis of principal components, RST-based genetic differentiation, geographic structure) congruently suggested the role of human activities in the pathogen's spread. We discuss the implications of these results on the management of Asiatic citrus canker in the region.

Le poivre de Penja produit au Cameroun, est menacé par les ravageurs et les maladies. Cependant peu ou pas d'informations sont disponibles sur les ravageurs et les maladies ainsi que les mesures de lutte efficaces. De manière générale, les fongicides sont utilisés par la majorité des producteurs comme moyen de lutte. L'objectif de ce travail étaient d'identifier les principaux bioagresseurs associés aux principales maladies du poivre de Penja, d'évaluer les traitements chimiques pratiqués par les producteurs et proposer des solutions alternatives qui incluent l'utilisation des extraits de plantes et des antagonistes. Pour atteindre les deux premiers objectifs, une enquête a été menée auprès de 71 producteurs, des observations ont été menées dans 35 plantations de poivre dans trois zones d'études (Njombe-Penja, Loum et Tombel) et une collecte des échantillons de sol et du matériel végétal qui permettra l'identification des principales maladies et des agents pathogènes. Le dépérissement lent du poivrier et la pourriture racinaire blanche ont été identifiés comme principales maladies dans les plantations de poivre de Penja. Elles étaient présentes chez 42 % (dépérissement lent) et 51 % (la pourriture racinaire blanche) des producteurs et causant en moyenne 5 % de perte par année ce qui représente des pertes de revenus énormes pour le producteur. Une analyse moléculaire des régions ITS de l'ADNr des isolats obtenus ont permis d'identifier Armillaria sp. et Phytopythium sp. comme les potentiels agents pathogènes de la pourriture racinaire blanche et du dépérissement lent respectivement. La troisième partie du travail était consacrée aux méthodes de lutte alternatives. Les fongicides les plus utilisés par les producteurs, Trichoderma asperellum et les extraits aqueux et hydroéthanolique de trois plantes (Chromoleana odorata, Phyllantus amarus, Commelina benghalensis) ont été testés afin de contrôler Phytopythium sp. Les deux, T. asperellum et l'extrait hydroéthanolique de

The Coconut Industry Development for the Pacific (CIDP) Project is a joint initiative of the Pacific Community (SPC), European Union (EU) and the African, Caribbean and Pacific Group of States (ACP). CIDP aims to bolster the coconut sector in the region by improving the competitiveness of small producers, and strengthening production and regional integration of related markets. In the framework of this project, French Agricultural Research for Development (CIRAD) led and assisted with the design of improved seed production systems and developed a risk analysis for the coconut value chain. In June 2018, CIRAD launched an online survey on incentives and risks by contacting more than one thousand coconut stakeholders worldwide. The initial results of this survey and meeting output were presented at the 2018 COCOTECH conference, where the risk analysis study was also launched. A meeting was conducted in December 2018 in Fiji, both to train participants in risk mitigation and to improve this manual. Each individual risk assessment is authored by two to five experts and/or participants in the training session. The 40 risks presented in this document cover a wide diversity of themes and recommendations. They are organized in eight sections which explore the following themes: climate change and hazards; pests and diseases; planting material; agricultural practices; organizational and policy issues; post-harvest and processing; economics and marketing, and socio-cultural habits. The introduction to each of these eight sections provides generic perspectives addressing coconut development for the Pacific region. Each risk is first briefly described; then its occurrence and severity are examined, and the issues associated with its mitigation and adaptation are discussed. Finally, actions to undertake are proposed, and a short bibliography gives key information sources. In total, contributors to this manual included 52 experts from 26 countries, of which 19 are located in Oceani

Madagascar is a high diversity hotspot in the world, and palms are highly represented with nearly 200 endemic species (Rakotoarinivo et al., 2014). Coconut tree (Cocos nucifera) could have been introduced in Madagascar by Austronesians around AD 400 or 700 (Beaujard, 2011). Sporadic coconut trees showing very severe wilt were observed in 2016 in three localities of the western and northern coast of the island: Katsepy (Sample MG16-001), Antsohyhi (MG16-004 and MG16-005) and Ambaritsatrana (MG16-010). Symptoms correspond on a severe ascendant wilt of the leaves, associated with necrosis of the inflorescences and absence of nuts and death of all trees was confirmed eventually. We investigated the implication of phytoplasma because of the apparent similarity in the symptomatology with Coconut Lethal Yellowing Disease and Coconut Lethal Decline occurring in East Africa (Mpunami et al., 1999), and because the western coast of Madagascar faces the Mozambican channel only 400 km apart from areas along the East African coast where those two diseases occur. Symptomatic (n=4) and asymptomatic (n=6) coconut trees were sampled by stem drilling. DNA was extracted from sawdust samples using a modified CTAB protocol (Mpunami et al., 1999). A direct polymerase chain reaction (PCR) targeting the 16S rRNA gene plus Internal transcribed spacer with the P1-1T (AAGAGTTTGATCCTGGCTCAGGAT)/P7 primers (Schneider et al., 1998) amplified a product of about 1.8 kb for MG16-001 and MG16-005 samples only, while the four DNA extracts from symptomatic trees showed a 1.2 kb amplicon by nested PCR using R16F2n/R16R2 primer pairs in the second round (Lee et al., 1998). Amplification of the secA gene using the primer pair secAFor1/secARev3 (Hodgetts et al., 2008) was performed in a single round and gave a product of 850 bp exclusively for the symptomatic tree DNAs. All amplicons were double strand sequenced (Genewiz, UK). Corresponding high quality sequences were deposited in GenBank and submitted to

Background: Nitrogen fertilization is known to increase disease susceptibility, a phenomenon called Nitrogen-Induced Susceptibility (NIS). In rice, this phenomenon has been observed in infections with the blast fungus Magnaporthe oryzae. A previous classical genetic study revealed a locus (NIS1) that enhances susceptibility to rice blast under high nitrogen fertilization. In order to further address the underlying genetics of plasticity in susceptibility to rice blast after fertilization, we analyzed NIS under greenhouse-controlled conditions in a panel of 139 temperate japonica rice strains. A genome-wide association analysis was conducted to identify loci potentially involved in NIS by comparing susceptibility loci identified under high and low nitrogen conditions, an approach allowing for the identification of loci validated across different nitrogen environments. We also used a novel NIS Index to identify loci potentially contributing to plasticity in susceptibility under different nitrogen fertilization regimes. Results: A global NIS effect was observed in the population, with the density of lesions increasing by 8%, on average, under high nitrogen fertilization. Three new QTL, other than NIS1, were identified. A rare allele of the RRobN1 locus on chromosome 6 provides robust resistance in high and low nitrogen environments. A frequent allele of the NIS2 locus, on chromosome 5, exacerbates blast susceptibility under the high nitrogen condition. Finally, an allele of NIS3, on chromosome 10, buffers the increase of susceptibility arising from nitrogen fertilization but increases global levels of susceptibility. This allele is almost fixed in temperate japonicas, as a probable consequence of genetic hitchhiking with a locus involved in cold stress adaptation. Conclusions: Our results extend to an entire rice subspecies the initial finding that nitrogen increases rice blast susceptibility. We demonstrate the usefulness of estimating plasticity for the identificatio

Sugarcane mosaic virus (SCMV) was detected by reverse transcription polymerase chain reaction in eight different species of the Poaceae family in the Everglades Agricultural Area (EAA) of south Florida: broadleaf signalgrass (Urochloa platyphylla), Columbus grass (Sorghum almum), goosegrass (Eleusine indica), maize (Zea mays), sorghum (Sorghum bicolor), St. Augustine grass (Stenotaphrum secundatum), southern crabgrass (Digitaria ciliaris), and sugarcane (Saccharum interspecific hybrids). Based on their coat protein (CP) gene sequence, 62 isolates of SCMV from Florida and 29 worldwide isolates representing the known genetic diversity of this virus were distributed into eight major phylogenetic groups. SCMV isolates infecting Columbus grass, maize, and sorghum in Florida formed a unique group, whereas virus isolates infecting sugarcane in the United States (Florida and Louisiana) clustered with isolates from other countries. Based on the entire genome coding region, SCMV isolates infecting sugarcane in Florida were closest to virus isolates infecting sorghum species or St. Augustine grass. Virus isolates from Columbus grass, St. Augustine grass, and sugarcane showed different virulence patterns after mechanical inoculation of Columbus grass, St. Augustine grass, and sugarcane plants, thus proving that these isolates were different pathogenic strains. Sugarcane was symptomless and tested negative for SCMV by tissue blot immunoassay after inoculation with crude sap from SCMV-infected Columbus grass, indicating that Columbus grass was not a reservoir for SCMV infecting sugarcane in the EAA. Close CP sequence identity between isolates of SCMV from Columbus grass, maize, and sorghum suggested that the same virus strain was naturally spreading between these three plants in south Florida.

Les épidémies de rouille orangée du caféier (ROC) entraînent des crises socio-économiques qui menacent la durabilité des territoires de production de café en Amérique Centrale. Nous présentons le processus de co-construction d'un modèle de prévision de la ROC et sa mise en oeuvre lors d'ateliers participatifs de simulation interactive (SI) visant à renforcer les capacités des acteurs de la caféiculture pour faire face à la ROC. Basée sur un modèle de croissance du caféier et de la ROC, ce modèle fait évoluer un système caféier-ROC en fonction de la météorologie. Dans le contexte de l'agriculture familiale, les participants disposent de capacités réduites les obligeant à la parcimonie pour lutter contre la ROC. La SI a dû être virtualisée en raison de la pandémie de Covid-19, ce qui a nécessité des compromis sur les échanges entre participants mais les objectifs d'apprentissage ont été atteints. La virtualisation a permis une participation étendue, des économies substantielles, une meilleure gestion du temps, une prise en compte des opinions individuelles, le débriefing à chaud et la traçabilité des décisions. Plus contraignante, la virtualisation est aussi une opportunité pour améliorer nos pratiques de SI.

BACKGROUND: Pseudocercospora fijiensis is the causal agent of the black leaf streak disease (BLSD) of banana. Bananas are important global export commodities and a major staple food. Their susceptibility to BLSD pushes disease management towards excessive fungicide use, largely relying on multisite inhibitors and sterol demethylation inhibitors (DMIs). These fungicides are ubiquitous in plant disease control, targeting the CYP51 enzyme. We examined sensitivity to DMIs in P. fijiensis field isolates collected from various major banana production zones in Colombia, Costa Rica, Dominican Republic, Ecuador, the Philippines, Guadalupe, Martinique and Cameroon and determined the underlying genetic reasons for the observed phenotypes. RESULTS: We observed a continuous range of sensitivity towards the DMI fungicides difenoconazole, epoxiconazole and propiconazole with clear cross‐sensitivity. Sequence analyses of PfCYP51 in 266 isolates showed 28 independent amino acid substitutions, nine of which correlated with reduced sensitivity to DMIs. In addition to the mutations, we observed up to six insertions in the Pfcyp51 promoter. Such promoter insertions contain repeated elements with a palindromic core and correlate with the enhanced expression of Pfcyp51 and hence with reduced DMI sensitivity. Wild‐type isolates from unsprayed bananas fields did not contain any promoter insertions. CONCLUSION: The presented data significantly contribute to understanding of the evolution and global distribution of DMI resistance mechanisms in P. fijiensis field populations and facilitate the prediction of different DMI efficacy. The overall reduced DMI sensitivity calls for the deployment of a wider range of solutions for sustainable control of this major banana disease.

The aim of this study was to develop a set of experiments to screen and decipher the mechanisms of biocontrol agents (BCAs), isolated from commercial formulation, against two major mycotoxigenic fungi in cereals, Fusarium graminearum and Fusarium verticillioides. These two phytopathogens produce mycotoxins harmful to human and animal health and are responsible for the massive use of pesticides, for the protection of cereals. It is therefore essential to better understand the mechanisms of action of alternative control strategies such as the use of BCAs in order to optimize their applications. The early and late stages of interaction between BCAs and pathogens were investigated from germination of spores to the effects on perithecia (survival form of pathogen). The analysis of antagonist activities of BCAs revealed different strategies of biocontrol where chronological, process combination and specialization aspects of interactions are discussed. Streptomyces griseoviridis main strategy is based on antibiosis with the secretion of several compounds with anti-fungal and anti-germination activity, but also a mixture of hydrolytic enzymes to attack pathogens, which compensates for an important deficit in terms of spatial colonization capacity. It has good abilities in terms of nutritional competition. Trichoderma asperellum is capable of activating a very wide range of defenses and attacks combining the synthesis of various antifungal compounds (metabolite, enzymes, VOCs), with different targets (spores, mycelium, mycotoxins), and direct action by mycoparasitism and mycophagy. Concerning Pythium oligandrum, its efficiency is mainly due to its strong capacity to colonize the environment, with a direct action via microbial predation, stimulation of its reproduction at the contact of pathogens and the reduction of perithecia formation.

A thorough knowledge of genotypic and phenotypic variations (e.g., virulence, resistance to antimicrobial compounds) in bacteria causing plant disease outbreaks is key for optimizing disease surveillance and management. Using a comprehensive strain collection, tandem repeat-based genotyping techniques and pathogenicity assays, we characterized the diversity of X. citri pv. citri from the South West Indian Ocean (SWIO) region. Most strains belonged to the prevalent lineage 1 pathotype A that has a wide host range among rutaceous species. We report the first occurrence of genetically unrelated, nonepidemic lineage 4 pathotype A* (strains with a host range restricted to Mexican lime and related species) in Mauritius, Moheli and Réunion. Microsatellite data revealed that strains from the Seychelles were diverse, grouped in three different clusters not detected in the Comoros and the Mascarenes. Pathogenicity data suggested a higher aggressiveness of strains of one of these clusters on citron (Citrus medica). With the noticeable exception of the Comoros, there was no sign of recent interisland movement of the pathogen. Consistent with this finding, the copL gene, a marker for the plasmid-borne copLAB copper resistance that was recently identified in Réunion, was not detected in 568 strains from any islands in the SWIO region apart from Réunion.

The family Cactaceae comprises a diverse group of typically succulent plants that are native to the American continent but have been introduced to nearly all other continents, predominantly for ornamental purposes. Despite their economic, cultural, and ecological importance, very little research has been conducted on the viral community that infects them. We previously identified a highly divergent geminivirus that is the first known to infect cacti. Recent research efforts in non-cultivated and asymptomatic plants have shown that the diversity of this viral family has been under-sampled. As a consequence, little is known about the effects and interactions of geminiviruses in many plants, such as cacti. With the objective to expand knowledge on the diversity of geminiviruses infecting cacti, we used previously acquired high-throughput sequencing results to search for viral sequences using BLASTx against a viral RefSeq protein database. We identified two additional sequences with similarity to geminiviruses, for which we designed abutting primers and recovered full-length genomes. From 42 cacti and five scale insects, we derived 42 complete genome sequences of a novel geminivirus species that we have tentatively named Opuntia virus 2 (OpV2) and 32 genomes of an Opuntia-infecting becurtovirus (which is a new strain of the spinach curly top Arizona virus species). Interspecies recombination analysis of the OpV2 group revealed several recombinant regions, in some cases spanning half of the genome. Phylogenetic analysis demonstrated that OpV2 is a novel geminivirus more closely related to viruses of the genus Curtovirus, which was further supported by the detection of three recombination events between curtoviruses and OpV2. Both OpV2 and Opuntia becurtoviruses were identified in mixed infections, which also included the previously characterized Opuntia virus 1. Viral quantification of the co-infected cactus plants compared with single infections did not show any clear t

Plant pathogens can adapt to quantitative resistance, eroding its effectiveness. The aim of this work was to reveal the genomic basis of adaptation to such a resistance in populations of the fungus Pseudocercospora fijiensis, a major devastating pathogen of banana, by studying convergent adaptation on different cultivars. Samples from P. fijiensis populations showing a local adaptation pattern on new banana hybrids with quantitative resistance were compared, based on a genome scan approach, with samples from traditional and more susceptible cultivars in Cuba and the Dominican Republic. Whole-genome sequencing of pools of P. fijiensis isolates (pool-seq) sampled from three locations per country was conducted according to a paired population design. The findings of different combined analyses highly supported the existence of convergent adaptation on the study cultivars between locations within but not between countries. Five to six genomic regions involved in this adaptation were detected in each country. An annotation analysis and available biological data supported the hypothesis that some genes within the detected genomic regions may play a role in quantitative pathogenicity, including gene regulation. The results suggested that the genetic basis of fungal adaptation to quantitative plant resistance is at least oligogenic, while highlighting the existence of specific host-pathogen interactions for this kind of resistance.

Assessing immune responses and cell death in Nicotiana benthamiana leaf agro-infiltration assays is a powerful and widely used experimental approach in molecular plant pathology. Here, we describe a reliable high-throughput protocol to quantify strong, macroscopically visible cell death responses in N. benthamiana agro-infiltration assays. The method relies on measuring the reduction of leaf autofluorescence in the red spectrum upon cell death induction and provides quantitative data suitable for straightforward statistical analysis. Two different well-established model nucleotide-binding and leucine-rich repeat domain proteins (NLRs) were used to ensure the genericity of the approach. Its accuracy and versatility were compared to visual scoring of the cell death response and standard methods commonly used to characterize NLR activities in N. benthamiana. A discussion of the advantages and limitations of our method compared to other protocols demonstrates its robustness and versatility and provides an effective means to select the best-suited protocol for a defined experiment.

La production du riz est affectée par des agents phytopathogènes dont le champignon Pyricularia oryzae, agent de la pyriculariose. Pour améliorer la lutte intégrée, il est nécessaire de connaître les sources d'inoculum et utile de disposer d'informations sur la diversité de l'agent pathogène. Toutefois, actuellement la prévalence de la maladie et l'importance relative des sources d'inoculum n'ont pas été évaluées en Afrique de l'Ouest, et plus spécifiquement au Mali. De même, la diversité et la structure des populations de P. oryzae sont peu documentées en Afrique. Cette thèse a donc pour objectif général de contribuer à combler ce déficit de connaissances et pour objectifs spécifiques 1) d'évaluer l'incidence et la sévérité de la pyriculariose du riz dans les différentes zones rizicoles au Mali, 2) de déterminer si les semences, les pailles et/ou le riz sauvage sont sources d'inoculum pour le riz cultivé et 3) d'établir la structure des populations de P. oryzae en Afrique. Les prospections conduites sur des parcelles paysannes et expérimentales en 2018, ont permis d'observer la pyriculariose foliaire et paniculaire dans 10 des 17 sites prospectés. Dans les champs symptomatiques, l'incidence foliaire allait de 24 à 72 % et la sévérité foliaire de 2 à 15 %. Les valeurs les plus élevées d'incidence et de sévérité paniculaires atteignaient respectivement 94 % et 52 %. En 2019, la pyriculariose a été observée sur 3 des 4 sites prospectés et l'incidence et la sévérité étaient beaucoup plus faibles (respectivement 7 % et 1% au maximum). L'incidence de la maladie n'était pas significativement différente entre culture irriguée et bas-fond. Les valeurs maximales d'incidence et de sévérité paniculaire confirment que la pyriculariose est un risque potentiel de pertes de rendement élevées. L'analyse de la mycoflore des semences a montré la présence des genres Bipolaris (ou Exserohilum) et Curvularia dans 17 des 20 lots examinés avec des moyennes de 4,6 et 4,3% de semences conta

The Coconut Industry Development for the Pacific (CIDP) Project is a joint initiative of the Pacific Community (SPC), European Union (EU) and the African, Caribbean and Pacific Group of States (ACP). CIDP aims to bolster the coconut sector in the region by improving the competitiveness of small producers, and strengthening production and regional integration of related markets. In the framework of this project, French Agricultural Research for Development (CIRAD) led and assisted with the design of improved seed production systems and developed a risk analysis for the coconut value chain. In June 2018, CIRAD launched an online survey on incentives and risks by contacting more than one thousand coconut stakeholders worldwide. The initial results of this survey and meeting output were presented at the 2018 COCOTECH conference, where the risk analysis study was also launched. A meeting was conducted in December 2018 in Fiji, both to train participants in risk mitigation and to improve this manual. Each individual risk assessment is authored by two to five experts and/or participants in the training session. The 40 risks presented in this document cover a wide diversity of themes and recommendations. They are organized in eight sections which explore the following themes: climate change and hazards; pests and diseases; planting material; agricultural practices; organizational and policy issues; post-harvest and processing; economics and marketing, and socio-cultural habits. The introduction to each of these eight sections provides generic perspectives addressing coconut development for the Pacific region. Each risk is first briefly described; then its occurrence and severity are examined, and the issues associated with its mitigation and adaptation are discussed. Finally, actions to undertake are proposed, and a short bibliography gives key information sources. In total, contributors to this manual included 52 experts from 26 countries, of which 19 are located in Oceani

Sugarcane mosaic virus (SCMV) was detected by reverse transcription polymerase chain reaction in eight different species of the Poaceae family in the Everglades Agricultural Area (EAA) of south Florida: broadleaf signalgrass (Urochloa platyphylla), Columbus grass (Sorghum almum), goosegrass (Eleusine indica), maize (Zea mays), sorghum (Sorghum bicolor), St. Augustine grass (Stenotaphrum secundatum), southern crabgrass (Digitaria ciliaris), and sugarcane (Saccharum interspecific hybrids). Based on their coat protein (CP) gene sequence, 62 isolates of SCMV from Florida and 29 worldwide isolates representing the known genetic diversity of this virus were distributed into eight major phylogenetic groups. SCMV isolates infecting Columbus grass, maize, and sorghum in Florida formed a unique group, whereas virus isolates infecting sugarcane in the United States (Florida and Louisiana) clustered with isolates from other countries. Based on the entire genome coding region, SCMV isolates infecting sugarcane in Florida were closest to virus isolates infecting sorghum species or St. Augustine grass. Virus isolates from Columbus grass, St. Augustine grass, and sugarcane showed different virulence patterns after mechanical inoculation of Columbus grass, St. Augustine grass, and sugarcane plants, thus proving that these isolates were different pathogenic strains. Sugarcane was symptomless and tested negative for SCMV by tissue blot immunoassay after inoculation with crude sap from SCMV-infected Columbus grass, indicating that Columbus grass was not a reservoir for SCMV infecting sugarcane in the EAA. Close CP sequence identity between isolates of SCMV from Columbus grass, maize, and sorghum suggested that the same virus strain was naturally spreading between these three plants in south Florida.

Les épidémies de rouille orangée du caféier (ROC) entraînent des crises socio-économiques qui menacent la durabilité des territoires de production de café en Amérique Centrale. Nous présentons le processus de co-construction d'un modèle de prévision de la ROC et sa mise en oeuvre lors d'ateliers participatifs de simulation interactive (SI) visant à renforcer les capacités des acteurs de la caféiculture pour faire face à la ROC. Basée sur un modèle de croissance du caféier et de la ROC, ce modèle fait évoluer un système caféier-ROC en fonction de la météorologie. Dans le contexte de l'agriculture familiale, les participants disposent de capacités réduites les obligeant à la parcimonie pour lutter contre la ROC. La SI a dû être virtualisée en raison de la pandémie de Covid-19, ce qui a nécessité des compromis sur les échanges entre participants mais les objectifs d'apprentissage ont été atteints. La virtualisation a permis une participation étendue, des économies substantielles, une meilleure gestion du temps, une prise en compte des opinions individuelles, le débriefing à chaud et la traçabilité des décisions. Plus contraignante, la virtualisation est aussi une opportunité pour améliorer nos pratiques de SI.

Background: Nitrogen fertilization is known to increase disease susceptibility, a phenomenon called Nitrogen-Induced Susceptibility (NIS). In rice, this phenomenon has been observed in infections with the blast fungus Magnaporthe oryzae. A previous classical genetic study revealed a locus (NIS1) that enhances susceptibility to rice blast under high nitrogen fertilization. In order to further address the underlying genetics of plasticity in susceptibility to rice blast after fertilization, we analyzed NIS under greenhouse-controlled conditions in a panel of 139 temperate japonica rice strains. A genome-wide association analysis was conducted to identify loci potentially involved in NIS by comparing susceptibility loci identified under high and low nitrogen conditions, an approach allowing for the identification of loci validated across different nitrogen environments. We also used a novel NIS Index to identify loci potentially contributing to plasticity in susceptibility under different nitrogen fertilization regimes. Results: A global NIS effect was observed in the population, with the density of lesions increasing by 8%, on average, under high nitrogen fertilization. Three new QTL, other than NIS1, were identified. A rare allele of the RRobN1 locus on chromosome 6 provides robust resistance in high and low nitrogen environments. A frequent allele of the NIS2 locus, on chromosome 5, exacerbates blast susceptibility under the high nitrogen condition. Finally, an allele of NIS3, on chromosome 10, buffers the increase of susceptibility arising from nitrogen fertilization but increases global levels of susceptibility. This allele is almost fixed in temperate japonicas, as a probable consequence of genetic hitchhiking with a locus involved in cold stress adaptation. Conclusions: Our results extend to an entire rice subspecies the initial finding that nitrogen increases rice blast susceptibility. We demonstrate the usefulness of estimating plasticity for the identificatio

The aim of this study was to develop a set of experiments to screen and decipher the mechanisms of biocontrol agents (BCAs), isolated from commercial formulation, against two major mycotoxigenic fungi in cereals, Fusarium graminearum and Fusarium verticillioides. These two phytopathogens produce mycotoxins harmful to human and animal health and are responsible for the massive use of pesticides, for the protection of cereals. It is therefore essential to better understand the mechanisms of action of alternative control strategies such as the use of BCAs in order to optimize their applications. The early and late stages of interaction between BCAs and pathogens were investigated from germination of spores to the effects on perithecia (survival form of pathogen). The analysis of antagonist activities of BCAs revealed different strategies of biocontrol where chronological, process combination and specialization aspects of interactions are discussed. Streptomyces griseoviridis main strategy is based on antibiosis with the secretion of several compounds with anti-fungal and anti-germination activity, but also a mixture of hydrolytic enzymes to attack pathogens, which compensates for an important deficit in terms of spatial colonization capacity. It has good abilities in terms of nutritional competition. Trichoderma asperellum is capable of activating a very wide range of defenses and attacks combining the synthesis of various antifungal compounds (metabolite, enzymes, VOCs), with different targets (spores, mycelium, mycotoxins), and direct action by mycoparasitism and mycophagy. Concerning Pythium oligandrum, its efficiency is mainly due to its strong capacity to colonize the environment, with a direct action via microbial predation, stimulation of its reproduction at the contact of pathogens and the reduction of perithecia formation.

BACKGROUND: Pseudocercospora fijiensis is the causal agent of the black leaf streak disease (BLSD) of banana. Bananas are important global export commodities and a major staple food. Their susceptibility to BLSD pushes disease management towards excessive fungicide use, largely relying on multisite inhibitors and sterol demethylation inhibitors (DMIs). These fungicides are ubiquitous in plant disease control, targeting the CYP51 enzyme. We examined sensitivity to DMIs in P. fijiensis field isolates collected from various major banana production zones in Colombia, Costa Rica, Dominican Republic, Ecuador, the Philippines, Guadalupe, Martinique and Cameroon and determined the underlying genetic reasons for the observed phenotypes. RESULTS: We observed a continuous range of sensitivity towards the DMI fungicides difenoconazole, epoxiconazole and propiconazole with clear cross‐sensitivity. Sequence analyses of PfCYP51 in 266 isolates showed 28 independent amino acid substitutions, nine of which correlated with reduced sensitivity to DMIs. In addition to the mutations, we observed up to six insertions in the Pfcyp51 promoter. Such promoter insertions contain repeated elements with a palindromic core and correlate with the enhanced expression of Pfcyp51 and hence with reduced DMI sensitivity. Wild‐type isolates from unsprayed bananas fields did not contain any promoter insertions. CONCLUSION: The presented data significantly contribute to understanding of the evolution and global distribution of DMI resistance mechanisms in P. fijiensis field populations and facilitate the prediction of different DMI efficacy. The overall reduced DMI sensitivity calls for the deployment of a wider range of solutions for sustainable control of this major banana disease.

A thorough knowledge of genotypic and phenotypic variations (e.g., virulence, resistance to antimicrobial compounds) in bacteria causing plant disease outbreaks is key for optimizing disease surveillance and management. Using a comprehensive strain collection, tandem repeat-based genotyping techniques and pathogenicity assays, we characterized the diversity of X. citri pv. citri from the South West Indian Ocean (SWIO) region. Most strains belonged to the prevalent lineage 1 pathotype A that has a wide host range among rutaceous species. We report the first occurrence of genetically unrelated, nonepidemic lineage 4 pathotype A* (strains with a host range restricted to Mexican lime and related species) in Mauritius, Moheli and Réunion. Microsatellite data revealed that strains from the Seychelles were diverse, grouped in three different clusters not detected in the Comoros and the Mascarenes. Pathogenicity data suggested a higher aggressiveness of strains of one of these clusters on citron (Citrus medica). With the noticeable exception of the Comoros, there was no sign of recent interisland movement of the pathogen. Consistent with this finding, the copL gene, a marker for the plasmid-borne copLAB copper resistance that was recently identified in Réunion, was not detected in 568 strains from any islands in the SWIO region apart from Réunion.

Madagascar is a high diversity hotspot in the world, and palms are highly represented with nearly 200 endemic species (Rakotoarinivo et al., 2014). Coconut tree (Cocos nucifera) could have been introduced in Madagascar by Austronesians around AD 400 or 700 (Beaujard, 2011). Sporadic coconut trees showing very severe wilt were observed in 2016 in three localities of the western and northern coast of the island: Katsepy (Sample MG16-001), Antsohyhi (MG16-004 and MG16-005) and Ambaritsatrana (MG16-010). Symptoms correspond on a severe ascendant wilt of the leaves, associated with necrosis of the inflorescences and absence of nuts and death of all trees was confirmed eventually. We investigated the implication of phytoplasma because of the apparent similarity in the symptomatology with Coconut Lethal Yellowing Disease and Coconut Lethal Decline occurring in East Africa (Mpunami et al., 1999), and because the western coast of Madagascar faces the Mozambican channel only 400 km apart from areas along the East African coast where those two diseases occur. Symptomatic (n=4) and asymptomatic (n=6) coconut trees were sampled by stem drilling. DNA was extracted from sawdust samples using a modified CTAB protocol (Mpunami et al., 1999). A direct polymerase chain reaction (PCR) targeting the 16S rRNA gene plus Internal transcribed spacer with the P1-1T (AAGAGTTTGATCCTGGCTCAGGAT)/P7 primers (Schneider et al., 1998) amplified a product of about 1.8 kb for MG16-001 and MG16-005 samples only, while the four DNA extracts from symptomatic trees showed a 1.2 kb amplicon by nested PCR using R16F2n/R16R2 primer pairs in the second round (Lee et al., 1998). Amplification of the secA gene using the primer pair secAFor1/secARev3 (Hodgetts et al., 2008) was performed in a single round and gave a product of 850 bp exclusively for the symptomatic tree DNAs. All amplicons were double strand sequenced (Genewiz, UK). Corresponding high quality sequences were deposited in GenBank and submitted to

The family Cactaceae comprises a diverse group of typically succulent plants that are native to the American continent but have been introduced to nearly all other continents, predominantly for ornamental purposes. Despite their economic, cultural, and ecological importance, very little research has been conducted on the viral community that infects them. We previously identified a highly divergent geminivirus that is the first known to infect cacti. Recent research efforts in non-cultivated and asymptomatic plants have shown that the diversity of this viral family has been under-sampled. As a consequence, little is known about the effects and interactions of geminiviruses in many plants, such as cacti. With the objective to expand knowledge on the diversity of geminiviruses infecting cacti, we used previously acquired high-throughput sequencing results to search for viral sequences using BLASTx against a viral RefSeq protein database. We identified two additional sequences with similarity to geminiviruses, for which we designed abutting primers and recovered full-length genomes. From 42 cacti and five scale insects, we derived 42 complete genome sequences of a novel geminivirus species that we have tentatively named Opuntia virus 2 (OpV2) and 32 genomes of an Opuntia-infecting becurtovirus (which is a new strain of the spinach curly top Arizona virus species). Interspecies recombination analysis of the OpV2 group revealed several recombinant regions, in some cases spanning half of the genome. Phylogenetic analysis demonstrated that OpV2 is a novel geminivirus more closely related to viruses of the genus Curtovirus, which was further supported by the detection of three recombination events between curtoviruses and OpV2. Both OpV2 and Opuntia becurtoviruses were identified in mixed infections, which also included the previously characterized Opuntia virus 1. Viral quantification of the co-infected cactus plants compared with single infections did not show any clear t

Plant pathogens can adapt to quantitative resistance, eroding its effectiveness. The aim of this work was to reveal the genomic basis of adaptation to such a resistance in populations of the fungus Pseudocercospora fijiensis, a major devastating pathogen of banana, by studying convergent adaptation on different cultivars. Samples from P. fijiensis populations showing a local adaptation pattern on new banana hybrids with quantitative resistance were compared, based on a genome scan approach, with samples from traditional and more susceptible cultivars in Cuba and the Dominican Republic. Whole-genome sequencing of pools of P. fijiensis isolates (pool-seq) sampled from three locations per country was conducted according to a paired population design. The findings of different combined analyses highly supported the existence of convergent adaptation on the study cultivars between locations within but not between countries. Five to six genomic regions involved in this adaptation were detected in each country. An annotation analysis and available biological data supported the hypothesis that some genes within the detected genomic regions may play a role in quantitative pathogenicity, including gene regulation. The results suggested that the genetic basis of fungal adaptation to quantitative plant resistance is at least oligogenic, while highlighting the existence of specific host-pathogen interactions for this kind of resistance.

The Meloidogyne-based disease complexes (MDCs) are caused by the interaction of different root-knot nematode species and phytopathogenic fungi. These complexes are devastating several important crops worldwide including tomato and coffee. Despite their relevance, little is known about the role of the bacterial communities in the MDCs. In this study 16s rDNA gene sequencing was used to analyze the bacterial microbiome associated with healthy and infested roots, as well with females and eggs of Meloidogyne enterolobii and M. paranaensis, the causal agents of MDC in tomato and coffee, respectively. Each MDC pathosystems displayed a specific taxonomic diversity and relative abundances constituting a very complex system. The main bacterial drivers of the MDC infection process were identified for both crops at order level. While corky-root coffee samples presented an enrichment of Bacillales and Burkholderiales, the corcky-root tomato samples presented an enrichment on Saprospirales, Chthoniobacterales, Alteromonadales, and Xanthomonadales. At genus level, Nocardia was common to both systems, and it could be related to the development of tumor symptoms by altering both nematode and plant systems. Furthermore, we predicted the healthy metabolic profile of the roots microbiome and a shift that may result in an increment of activity of central metabolism and the presence of pathogenic genes in both crops.

Inferring the dispersal processes of vector-borne plant pathogens is a great challenge because the plausible epidemiological scenarios often involve complex spread patterns at multiple scales. The spatial genetic structure of 'Candidatus Phytoplasma prunorum', responsible for European stone fruit yellows disease, was investigated by the application of a combination of statistical approaches to genotype data of the pathogen sampled from cultivated and wild compartments in three French Prunus-growing regions. This work revealed that the prevalence of the different genotypes is highly uneven both between regions and compartments. In addition, we identified a significant clustering of similar genotypes within a radius of 50 km or less, but not between nearby wild and cultivated Prunus. We also provide evidence that infected plants are transferred between production areas, and that both species of the Cacopsylla pruni complex can spread the pathogen. Altogether, this work supports a main epidemiological scenario where 'Ca. P. prunorum' is endemic in — and generally acquired from — wild Prunus by its immature psyllid vectors. The latter then migrate to shelter plants that epidemiologically connect sites less than 50 km apart by later providing infectious mature psyllids to their “migration basins”. Such multi-scale studies could be useful for other pathosystems.

Members of the genus Pantoea have been reported as pathogens for many economically important crops, including rice. Little is known about their host−pathogen interactions at the molecular level and the lack of comprehensive genome data impedes targeted breeding strategies toward resistant rice cultivars. Here, we describe the structural and functional annotation of the draft genome sequences of three rice-pathogenic Pantoea ananatis strains, ARC272, ARC310, and ARC311, which were isolated in Burkina Faso, Togo, and Benin, respectively. The genome sequences of these strains will help in developing molecular diagnostic tools and provide new insight into common traits that may enable P. ananatis to infect rice.

We present an amended description of the bacterial species Xanthomonas vasicola to include the causative agent of banana Xanthomonas wilt, as well as strains that cause disease on Areca palm, Tripsacum grass, sugarcane, and maize. Genome-sequence data reveal that these strains all share more than 98% average nucleotide with each other and with the type strain. Our analyses and proposals should help to resolve the taxonomic confusion that surrounds some of these pathogens and help to prevent future use of invalid names.

Bacterial wilt and brown rot disease caused by Ralstonia solanacearum species complex (RSSC) is one of the major constraints of potato (Solanum tuberosum) production around the globe. During 2017 to 2018, an extensive field survey was conducted in six potato-growing provinces of Iran to monitor the status of bacterial wilt disease. Pathogenicity and host range assays using 59 bacterial strains isolated in Iran showed that they were pathogenic on eggplant, red nightshade, pepper, potato and tomato, while nonpathogenic on common bean, cowpea, cucumber, sunflower, zinnia and zucchini. PCR-based diagnosis revealed that the strains belong to the phylotype IIB/sequevar 1 (IIB/I) lineage of the RSSC. Furthermore, a five-gene multilocus sequence analysis and typing (egl, fliC, gyrB, mutS, and rplB) confirmed the phylogenetically near-homogeneous nature of the strains within IIB/I lineage. Four sequence types were identified among 58 IIB/1 strains isolated in Iran. Phylogenetically near-homogeneous nature of the strains in Iran raise questions about the mode of inoculum entry of the bacterial wilt pathogen into the country (one-time introduction versus multiple introductions), while the geographic origin of the Iranian R. solanacearum strains remains undetermined. Furthermore, sequence typing showed that there were shared alleles (haplotypes) and sequence types among the strains isolated in geographically distant areas in Iran, suggesting intranational transmission of the pathogen in the country.

Ralstonia solanacearum, the causal agent of bacterial wilt and brown rot disease, is one of the major pathogens of solanaceous crops, including potato, around the globe. Biovar 2T (phylotype II/sequevar 25) of R. solanacearum is adapted to tropical lowlands and is only reported in South America and Iran. Thus far, no genome resource of the biovar 2T of the pathogen has been available. Here, we present the near-complete genome sequences of the biovar 2T strain CFBP 8697 as well as strain CFBP 8695 belonging to biovar 2 race 3, both isolated from potato in Iran. The genomic data of biovar 2T will extend our understanding of the virulence features of R. solanacearum and pave the way for research on biovar 2T functional and interaction genetics.

Plant diseases have a significant impact on global food security and the world's agricultural economy. Their early detection and classification increase the chances of setting up effective control measures, which is why the search for automatic systems that allow this is of major interest to our society. Several recent studies have reported promising results in the classification of plant diseases from RGB images on the basis of Convolutional Neural Networks (CNN). These studies have been successfully experimented on a large number of crops and symptoms, and they have shown significant advantages in the support of human expertise. However, the CNN models still have limitations. In particular, CNN models do not necessarily focus on the visible parts affected by a plant disease to allow their classification, and they can sometimes take into account irrelevant backgrounds or healthy plant parts. In this paper, we therefore develop a new technique based on a Recurrent Neural Network (RNN) to automatically locate infected regions and extract relevant features for disease classification. We show experimentally that our RNN-based approach is more robust and has a greater ability to generalize to unseen infected crop species as well as to different plant disease domain images compared to classical CNN approaches. We also analyze the focus of attention as learned by our RNN and show that our approach is capable of accurately locating infectious diseases in plants. Our approach, which has been tested on a large number of plant species, should thus contribute to the development of more effective means of detecting and classifying crop pathogens in the near future.

Alfalfa (Medicago sativa L.), also known as lucerne, is a major forage crop worldwide. In the United States, it has recently become the third most valuable field crop, with an estimated value of over $9.3 billion. Alfalfa is naturally infected by many different pathogens, including viruses, obligate parasites that reproduce only inside living host cells. Traditionally, viral infections of alfalfa have been considered by breeders, growers, producers and researchers to be diseases of limited importance, although they are widespread in all major cultivation areas. However, over the past few years, due to the rapid development of high-throughput sequencing (HTS), viral metagenomics, bioinformatics tools for interpreting massive amounts of HTS data and the increasing accessibility of public data repositories for transcriptomic discoveries, several emerging viruses of alfalfa with the potential to cause serious yield losses have been described. They include alfalfa leaf curl virus (family Geminiviridae), alfalfa dwarf virus (family Rhabdoviridae), alfalfa enamovirus 1 (family Luteoviridae), alfalfa virus S (family Alphaflexiviridae) and others. These discoveries have called into question the assumed low economic impact of viral diseases in alfalfa and further suggested their possible contribution to the severity of complex infections involving multiple pathogens. In this review, we will focus on viruses of alfalfa recently described in different laboratories on the basis of the above research methodologies.

Among all causes of grapevine decline, Grapevine Trunk Diseases (GTDs) are major concerns for grape growers. This paper reviews knowledge and proposes hypotheses on two major GTDs, esca and Botryosphaeria dieback, and assembles a conceptual model. The objective was to collect information into a sequence, from grapevine nursery propagation processes, through foliar symptom expression, to plant death in mature vineyards. Pathogen infection and colonization steps in woody vine tissues, and the hypotheses that have been formulated to explain the outburst of foliar symptoms, are reported and discussed. Factors that could aggravate or repress GTD symptoms and incidence expansion are also addressed. Vine physiology and pathology together could expand understanding of these diseases. Knowledge and hypotheses that need validation are summarized, and a conceptual model is proposed to explain the occurrence of symptoms and the influencing factors. The model could be useful to cope with the complexity of GTDs, and as a starting point for research to unravel knowledge gaps and suggest new disease management strategies.

The Meloidogyne-based disease complexes (MDCs) are caused by the interaction of different root-knot nematode species and phytopathogenic fungi. These complexes are devastating several important crops worldwide including tomato and coffee. Despite their relevance, little is known about the role of the bacterial communities in the MDCs. In this study 16s rDNA gene sequencing was used to analyze the bacterial microbiome associated with healthy and infested roots, as well with females and eggs of Meloidogyne enterolobii and M. paranaensis, the causal agents of MDC in tomato and coffee, respectively. Each MDC pathosystems displayed a specific taxonomic diversity and relative abundances constituting a very complex system. The main bacterial drivers of the MDC infection process were identified for both crops at order level. While corky-root coffee samples presented an enrichment of Bacillales and Burkholderiales, the corcky-root tomato samples presented an enrichment on Saprospirales, Chthoniobacterales, Alteromonadales, and Xanthomonadales. At genus level, Nocardia was common to both systems, and it could be related to the development of tumor symptoms by altering both nematode and plant systems. Furthermore, we predicted the healthy metabolic profile of the roots microbiome and a shift that may result in an increment of activity of central metabolism and the presence of pathogenic genes in both crops.

We present an amended description of the bacterial species Xanthomonas vasicola to include the causative agent of banana Xanthomonas wilt, as well as strains that cause disease on Areca palm, Tripsacum grass, sugarcane, and maize. Genome-sequence data reveal that these strains all share more than 98% average nucleotide with each other and with the type strain. Our analyses and proposals should help to resolve the taxonomic confusion that surrounds some of these pathogens and help to prevent future use of invalid names.

Bacterial wilt and brown rot disease caused by Ralstonia solanacearum species complex (RSSC) is one of the major constraints of potato (Solanum tuberosum) production around the globe. During 2017 to 2018, an extensive field survey was conducted in six potato-growing provinces of Iran to monitor the status of bacterial wilt disease. Pathogenicity and host range assays using 59 bacterial strains isolated in Iran showed that they were pathogenic on eggplant, red nightshade, pepper, potato and tomato, while nonpathogenic on common bean, cowpea, cucumber, sunflower, zinnia and zucchini. PCR-based diagnosis revealed that the strains belong to the phylotype IIB/sequevar 1 (IIB/I) lineage of the RSSC. Furthermore, a five-gene multilocus sequence analysis and typing (egl, fliC, gyrB, mutS, and rplB) confirmed the phylogenetically near-homogeneous nature of the strains within IIB/I lineage. Four sequence types were identified among 58 IIB/1 strains isolated in Iran. Phylogenetically near-homogeneous nature of the strains in Iran raise questions about the mode of inoculum entry of the bacterial wilt pathogen into the country (one-time introduction versus multiple introductions), while the geographic origin of the Iranian R. solanacearum strains remains undetermined. Furthermore, sequence typing showed that there were shared alleles (haplotypes) and sequence types among the strains isolated in geographically distant areas in Iran, suggesting intranational transmission of the pathogen in the country.

Ralstonia solanacearum, the causal agent of bacterial wilt and brown rot disease, is one of the major pathogens of solanaceous crops, including potato, around the globe. Biovar 2T (phylotype II/sequevar 25) of R. solanacearum is adapted to tropical lowlands and is only reported in South America and Iran. Thus far, no genome resource of the biovar 2T of the pathogen has been available. Here, we present the near-complete genome sequences of the biovar 2T strain CFBP 8697 as well as strain CFBP 8695 belonging to biovar 2 race 3, both isolated from potato in Iran. The genomic data of biovar 2T will extend our understanding of the virulence features of R. solanacearum and pave the way for research on biovar 2T functional and interaction genetics.