Search

The article shows the results of research on the development of a test system by polymerase chain reaction with «real-time» detection for the identification of phytopathogenic fungi Penicillium expansum, which cause apple disease – blue mold. It can infect a wide range of hosts, including pears, strawberries, tomatoes, corn and rice. P. expansum produces the carcinogenic metabolite patulin, which levels in food are regulated by the governments of many countries. The authors selected a section of genome, the gene patF Penicillium expansum strain NRRL 35695. It is a cluster of genes that mediates the biosynthesis of patulin, a derivative of tetraquetide mycotoxin acetate. The test system for Penicillium expansum includes specific primers: upstream primer (f) 5'-3' GTGGGTCCGCAGGCCTTTAT, downstream primer (r) 3'-5' GCCCATTCTCCATCGACCAC. Reaction setting protocol: pre-denaturation – 95 0C-5 minutes (1 cycle); denaturation-95 0C-5 sec, annealing-60 0C-15 sec (50 cycles). Probe: GCCCATTCTCCATCGACCAC, fluorescent dye – ROX, quencher-BHQ2. The optimal concentration of primers equal to 7 pM of each primer per reaction has been established. The optimal concentration of the probe is 0.4 pM. The approbation of the scientific development was carried out on 29 strains of Penicillium spp. isolated from samples of apples, eggplants, onions, strawberries, grapes, peaches with signs of spoilage, and soil samples from various natural geographical zones of the Russian Federation, and presumably typed as Penicillium expansum by dichotomous keys. It was established that only 15 belong to this species on the basis of conducted studies. The study was carried out according to the thematic plan-task of the Ministry of agriculture of the Russian Federation, the registration number of the INIS RTD 122030200367-8. [ABSTRACT FROM AUTHOR]

The article presents the results of research on the development of test system by the method of polymerase chain reaction with real-time detection for the identification of phytopathogenic fungi Fusarium oxysporum. These fungi are cosmopolitan for many types of agricultural (wheat, soybeans, peas, alfalfa) and fruit and vegetable crops (tomatoes, cucumbers) in various geographical areas. The authors selected for the work a section of genome that encodes endopolygalacturonase-Fusarium oxysporum isolate TD586 (pg1) gene. Specific primers were selected (f) 5'-3' GGGATCTGGGAGTACGGTTGC and (r) 3'-5' CCTACAGGCAGCGTTGAAGC and a protocol for setting up the reaction has been developed, including preliminary denaturation – 95 0C-5 minutes (1 cycle); denaturation-95 0C-5 sec, annealing-60 0C-15 sec (50 cycles). Studying the sensitivity of the test system, the authors selected a probe (GCTATTGCGGCTTTGCTGC), fluorescent dye-ROX, quencher-BHQ-2. The scientific development was tested on 28 field strains and 1 reference strains (Fusarium oxysporum VKM No. F-140) which was tested on 28 field strains and 1 reference strains with a 15 positive result. The study was carried out according to the thematic plan-task of the Ministry of agriculture of the Russian Federation, the registration number of the INIS RTD 122030200367-8. [ABSTRACT FROM AUTHOR]

Multi-stage hydraulic cylinders are often used as drives for space rocket lifting to the launch position. A sharp change in the lift angular velocity at the time of switching the hydraulic cylinder stages is one of the disadvantages of such drives. This feature leads to the appearance of additional inertial loads which affect the space rocket payload. This paper presents the results of modeling and computational analysis of inertial loads during the launch vehicle ascent for two variants. As a part of the first option, modeling has been performed for a classical mechanism with multistage hydraulic cylinders. The second option is a simulation of a new mechanism with hydraulic cylinders installed at different initial angles. In both cases, the acceleration of the center of mass of the payload is analyzed at the moment of switching the hydraulic cylinder stages. The result of the analysis shows a significant decrease in acceleration when the hydraulic cylinders of the lifting mechanism are installed at different initial angles. [ABSTRACT FROM AUTHOR]

The present research attempts to define the current state and prospects of using MOOCs in the higher education system of the Russian Federation, including integration process. The article provides characteristics of the Russian platforms hosting mass open online courses National Platform for Open Education, Universarium Inter-university platform for electronic education, Stepik Educational platform, INTUIT National Open University, and an enlightenment project Lektorium. The themes, content, and methodological structure of the courses were analyzed. The authors studied the level of awareness of the key target audience of online courses (university students) about the opportunities provided by the Russian educational establishments in the form of MOOC, and identified the popularity of the educational platforms and the students' expectations regarding this format of learning. Thus, the polling showed that students are aware of the opportunities granted by Lektorium (60%), Open Education (49%), Stepik (32%), and to a less extent Universarium (15%) and INTUIT (6%), while 33% of the respondents know nothing about this format of education. A comparative analysis of the two types of research allowed revealing the problem zones in the Russian MOOCs development as a part of the Russian education system. [ABSTRACT FROM AUTHOR]

In the presented article, authors describe the implementation and functioning of the system of transport hubs in urban agglomerations on the example of the Oryol urban agglomeration. In particular, an exemplary scheme of a transport interchange point and the system of transport hubs in Russia are presented. Also, discussed are problems of urban public transport organization in the Oryol urban agglomeration and a scheme for the implementation of transport hubs within its limits is proposed. [ABSTRACT FROM AUTHOR]

The article proposes to use the ontological model of knowledge representation to develop special information support for social-cyber-physical decision support systems. It includes metaontology, ontologies of concepts and problems, as well as an inference machine. Based on them, a multi-agent network is formed, which is a knowledge base of this subject area. Based on its rules, presented in a language close to natural, a parametric and structural synthesis of a system (robotic line) adapted to solving new problems (production of new mechanical engineering products) is carried out. As the main tools for building a multi-agent network, it is proposed to use modified diagrams of the UML visual modeling language and the IDEF0 functional modeling methodology. [ABSTRACT FROM AUTHOR]

The theory of pattern recognition is used in computers, in city's video surveillance cameras, when recognizing car license plates of the violators, for unlocking of smartphones, in drones, in security systems, etc. The paper is considering the solution to the problem of using image recognition methods for detecting road's signs. The purpose of the research is to develop a mobile application for the recognizing of road signs. The methodology includes a description of the stages of the video sequence for recognizing of road signs, choosing methods for their localization, classification and data storage in recognition systems. A significant result of the research is the development of a model based on convolutional neural networks for the classification of road signs. The developed model is used in a mobile application applying the methods of the libraries of computer vision. The application can be used by car drivers with installed file on the device and an autofocus camera. Testing of the application confirms its ability to perform the assigned tasks. In conclusion, findings are drawn about the effectiveness of the application. And options are proposed for improving the model for recognizing of road signs. [ABSTRACT FROM AUTHOR]

The article presents the concept of transport accessibility, proposes the application of transport accessibility as a criterion for the transport infrastructure development of the region, lists the parameters determining transport accessibility, as well as the existing indicators of transport accessibility. In addition, a methodology for a comprehensive assessment of the region's transport accessibility is proposed. [ABSTRACT FROM AUTHOR]