Search

Understanding the cellular and molecular mechanisms underlying the formation and maintenance of memories is a central goal of the neuroscience community. It is well regarded that an organism's ability to lastingly adapt its behavior in response to a transient environmental stimulus relies on the central nervous system's capability for structural and functional plasticity. This plasticity is dependent on a well-regulated program of neurotransmitter release, post-synaptic receptor activation, intracellular signaling cascades, gene transcription, and subsequent protein synthesis. In the last decade, epigenetic markers like DNA methylation and post-translational modifications of histone tails have emerged as important regulators of the memory process. Their ability to regulate gene transcription dynamically in response to neuronal activation supports the consolidation of long-term memory. Furthermore, the persistent and self-propagating nature of these mechanisms, particularly DNA methylation, suggests a molecular mechanism for memory maintenance. In this review, we will examine the evidence that supports a role of epigenetic mechanisms in learning and memory. In doing so, we hope to emphasize (1) the widespread involvement of these mechanisms across different behavioral paradigms and distinct brain regions, (2) the temporal and genetic specificity of these mechanisms in response to upstream signaling cascades, and (3) the functional outcome these mechanisms may have on structural and functional plasticity. Finally, we consider the future directions of neuroepigenetic research as it relates to neuronal storage of information.

Memory formation is a multi-stage process that initially requires cellular consolidation in the hippocampus, after which memories are downloaded to the cortex for maintenance, in a process termed systems consolidation (1). Epigenetic mechanisms regulate both types of consolidation (2-7), but histone variant exchange, in which canonical histones are replaced with their variant counterparts, is an entire branch of epigenetics that has received limited attention in the brain (8-12) and has never, to our knowledge, been studied in relation to cognitive function. Here we show that histone H2A.Z, a variant of histone H2A, is actively exchanged in response to fear conditioning in the hippocampus and the cortex, where it mediates gene expression and restrains the formation of recent and remote memory. Our data provide evidence for H2A.Z involvement in cognitive function and specifically implicate H2A.Z as a negative regulator of hippocampal consolidation and systems consolidation, probably through downstream effects on gene expression. Moreover, alterations in H2A.Z binding at later stages of systems consolidation suggest that this histone has the capacity to mediate stable molecular modifications required for memory retention. Overall, our data introduce histone variant exchange as a novel mechanism contributing to the molecular basis of cognitive function and implicate H2A.Z as a potential therapeutic target for memory disorders. AGCACCTGCGATCCTTTCC GCTTACCTTTCACCACCCTGT CGCGTGTGTGCTGGTTATTT, As a first step in exploring the role of H2A.Z in cognitive function, we used immunohistochemistry to confirm its expression throughout the hippocampus (Extended Data Fig. 1a-c). Next, we showed [...]

• New evidence shows that chromatin regulation is highly dynamic during memory formation. • Chromatin is modified by incorporating functionally distinct histone variants to impact transcription and memory. • Chromatin remodeling enzymes, which reposition and remove nucleosomes, regulate memory formation and cell-wide functions. • Differing breadths of genome coverage by histone marks can impact learning-induced transcription. Nearly two decades of research on epigenetic mechanisms in the brain have demonstrated that epigenetic marks that were once thought to be relatively static are dynamically and reversibly regulated in the brain during memory formation. Here, we focus on new research that has further expanded the dynamic nature of chromatin in memory formation through three key mechanisms. First, we discuss the emerging role of histone variants, which undergo learning-induced turnover or exchange, a process in which one histone type replaces another in chromatin. Next, we focus on chromatin remodeling complexes, which are tightly intertwined with all aspects of chromatin regulation and as such, can reposition or evict nucleosomes to promote transcriptional induction, and mediate histone variant exchange. Finally, we discuss how differential distribution of histone marks to localized narrow genomic regions and/or broadly distributed chromatin domains impact transcriptional outcomes and memory formation. Together, these studies mark a shift toward unraveling the complexity of chromatin function in memory and offer new strategies for fine tuning transcriptional outcomes to modify longevity, specificity and strength of memories. [ABSTRACT FROM AUTHOR]

Abstract Estradiol moderates the effects of drugs of abuse in both humans and rodents. Estradiol's enhancement of behavioral effects resulting from high (> 2.5 mg/kg) doses of amphetamine is established in rats; there is less evidence for the role of estradiol in locomotor effects elicited by lower doses, which are less aversive, increase incentive motivation, involve different neural mechanisms than higher doses, and often more readily reveal group differences than do higher doses. Further, the extent to which estradiol is required for the induction versus the expression of sensitization is unknown. To establish a protocol, we replicated the effects of estradiol on locomotor sensitization to amphetamine reported in a previous study that involved a high locomotor-activating dose (1.5 mg/kg) of amphetamine, but with a lower dose. Ovariectomized female rats received 5 μg of estradiol benzoate (EB) or OIL 30 min before each of 5 treatments of 1.0 mg/kg amphetamine or saline; all received a 0.5 mg/kg challenge dose three days later. Compared with results for OIL, EB enhanced the locomotor-activating effects of repeated 1.0 mg/kg amphetamine across treatment days. In contrast, on challenge day, there was no difference between EB-saline and EB-amphetamine to the lower dose (i.e., no sensitization). Experiments 2 and 3 involved a shorter induction (2 days) and a lengthier withdrawal (9 days) before the challenge test for the expression of sensitization to better differentiate the induction phase from the expression phase. In Expt2, EB-, and not OIL-, treated rats showed sensitization to 0.5 mg/kg amphetamine; neither group showed sensitization to 1.5 mg/kg amphetamine (ceiling effect?). In Expt3, rats were treated with EB either in both the induction and expression phases, in one of the phases only, or in neither phase. There was an effect of hormone treatment on challenge day and not on induction day; rats given EB on Challenge day showed sensitization to 0.5 mg/kg amphetamine; OIL rats did not. The results suggest rapid effects of estradiol on amphetamine sensitization consistent with rapid effects of estradiol reported for other behaviours. Highlights • We investigate rapid effects estrogen on amphetamine sensitization. • Involve an induction phase (2 days) and an expression phase (1 day 9 days later). • Minimal estrogen treatment (3x) increased sensitization to 0.5 mg/kg amphetamine compared with oil treatment. [ABSTRACT FROM AUTHOR]

The triple-transgenic (3xTg-AD) mouse strain is a valuable model of Alzheimer's disease (AD) because it develops both amyloid-β (Aβ) and tau brain pathology. However, 1-year-old 3xTg-AD males no longer show plaques and tangles, yet early in life they exhibit diverse signs of systemic autoimmunity. The current study aimed to address whether females, which exhibit more severe plaque/tangle pathology at 1 year of age, show similar autoimmune phenomena and if so, whether these immunological changes coincide with prodromal markers of AD pathology, markers of learning and memory formation, and epigenetic markers of neurodegenerative disease. Six-month-old 3xTg-AD and wild-type mice of both sexes were examined for T-cell phenotype (CD3+, CD8+, and CD4+ populations), serological measures (autoantibodies, hematocrit), soluble tau/phospho-tau and Aβ levels, brain-derived neurotrophic factor (BDNF) expression, and expression of histone H2A variants. Although no significant group differences were seen in tau/phospho-tau levels, 3xTg-AD mice had lower brain mass and showed increased levels of soluble Aβ and downregulation of BDNF expression in the cortex. Splenomegaly, depleted CD+ T-splenocytes, increased autoantibody levels and low hematocrit were more pronounced in 3xTg-AD males than in females. Diseased mice also failed to exhibit sex-specific changes in histone H2A variant expression shown by wild-type mice, implicating altered nucleosome composition in these immune differences. Our study reveals that the current 3xTg-AD model is characterized by systemic autoimmunity that is worse in males, as well as transcriptional changes in epigenetic factors of unknown origin. Given the previously observed lack of plaque/tangle pathology in 1-year-old males, an early, sex-dependent autoimmune mechanism that interferes with the formation and/or deposition of aggregated protein species is hypothesized. These results suggest that more attention should be given to studying sex-dependent differences in the immunological profiles of human patients. [ABSTRACT FROM AUTHOR]

The social environment can alter pubertal timing through neuroendocrine mechanisms that are not fully understood; it is thought that stress hormones (e.g., glucocorticoids or corticotropin-releasing hormone) influence the hypothalamic-pituitary-gonadal axis to inhibit puberty. Here, we use the eusocial naked mole-rat, a unique species in which social interactions in a colony (i.e. dominance of a breeding female) suppress puberty in subordinate animals. Removing subordinate naked mole-rats from this social context initiates puberty, allowing for experimental control of pubertal timing. The present study quantified gene expression for reproduction- and stress-relevant genes acting upstream of gonadotropin-releasing hormone in brain regions with reproductive and social functions in pre-pubertal, post-pubertal, and opposite sex-paired animals (which are in various stages of pubertal transition). Results indicate sex differences in patterns of neural gene expression. Known functions of genes in brain suggest stress as a key contributing factor in regulating male pubertal delay. Network analysis implicates neurokinin B (Tac3) in the arcuate nucleus of the hypothalamus as a key node in this pathway. Results also suggest an unappreciated role for the nucleus accumbens in regulating puberty. [ABSTRACT FROM AUTHOR]

Histone variants were recently discovered to regulate neural plasticity, with H2A.Z emerging as a memory suppressor. Using whole-genome sequencing of the mouse hippocampus, we show that basal H2A.Z occupancy is positively associated with steadystate transcription, whereas learning-induced H2A.Z removal is associated with learning-induced gene expression.AAV-mediatedH2A.Zdepletionenhanced fear memory and resulted in gene-specific alterations of learning-induced transcription, reinforcing the role of H2A.Z as a memory suppressor. H2A.Z accumulated with age, although it remained sensitive to learning-induced eviction. Learning-related H2A.Z removal occurred at largely distinct genes in young versus aged mice, suggesting that H2A.Z is subject to regulatory shifts in the aged brain despite similar memory performance. When combined with prior evidence of H3.3 accumulation in neurons, our data suggest that nucleosome composition in the brain is reorganized with age. [ABSTRACT FROM AUTHOR]

Gene editing tools are essential for uncovering how genes mediate normal brain-behavior relationships and contribute to neurodegenerative and neuropsychiatric disorders. Recent progress in gene editing technology now allows neuroscientists unprecedented access to edit the genome efficiently. Although many important tools have been developed, here we focus on approaches that allow for rapid gene editing in the adult nervous system, particularly CRISPR/Cas9 and anti-sense nucleotide-based techniques. CRISPR/Cas9 is a flexible gene editing tool, allowing the genome to be manipulated in diverse ways. For instance, CRISPR/Cas9 has been successfully used to knockout genes, knock-in mutations, overexpress or inhibit gene activity, and provide scaffolding for recruiting specific epigenetic regulators to individual genes and gene regions. Moreover, the CRISPR/Cas9 system may be modified to target multiple genes at one time, affording simultaneous inhibition and overexpression of distinct genetic targets. Although many of the more advanced applications of CRISPR/Cas9 have not been applied to the nervous system, the toolbox is widely accessible, such that it is poised to help advance neuroscience. Anti-sense nucleotide-based technologies can be used to rapidly knockdown genes in the brain. The main advantage of anti-sense based tools is their simplicity, allowing for rapid gene delivery with minimal technical expertise. Here, we describe the main applications and functions of each of these systems with an emphasis on their many potential applications in neuroscience laboratories. [ABSTRACT FROM AUTHOR]

Chromatin is a critical regulator of neural plasticity, but basic principles of chromatin function in neurons are unclear. In this issue of Neuron , Maze et al. (2015) establish histone H3.3 turnover as a novel mechanism contributing to CNS gene regulation, synaptic plasticity, and cognition. [ABSTRACT FROM AUTHOR]

One of the most exciting discoveries in the learning and memory field in the past two decades is the observation that active regulation of gene expression is necessary for experience to trigger lasting functional and behavioral change, in a wide variety of species, including humans. Thus, as opposed to the traditional view of 'nature' (genes) being separate from 'nurture' (environment and experience), it is now clear that experience actively drives alterations in central nervous system (CNS) gene expression in an ongoing fashion, and that the resulting transcriptional changes are necessary for experience to trigger altered long-term behavior. In parallel over the past decade, epigenetic mechanisms, including regulation of chromatin structure and DNA methylation, have been shown to be potent regulators of gene transcription in the CNS. In this review, we describe data supporting the hypothesis that epigenetic molecular mechanisms, especially DNA methylation and demethylation, drive long-term behavioral change through active regulation of gene transcription in the CNS. Specifically, we propose that epigenetic molecular mechanisms underlie the formation and stabilization of context- and cue-triggered fear conditioning based in the hippocampus and amygdala, a conclusion reached in a wide variety of studies using laboratory animals. Given the relevance of cued and contextual fear conditioning to post-traumatic stress, by extension we propose that these mechanisms may contribute to post-traumatic stress disorder (PTSD) in humans. Moreover, we speculate that epigenetically based pharmacotherapy may provide a new avenue of drug treatment for PTSD-related cognitive and behavioral function. [ABSTRACT FROM AUTHOR]

Rapid removal of histone H2A.Z from neuronal chromatin is a key step in learning-induced gene expression and memory formation, but mechanisms underlying learning-induced H2A.Z removal are unclear. Anp32e was recently identified as an H2A.Z-specific histone chaperone that removes H2A.Z from nucleosomes in dividing cells, but its role in non-dividing neurons is unclear. Moreover, prior studies investigated Anp32e function under steady-state rather than stimulus-induced conditions. Here, we show that Anp32e regulates H2A.Z binding in neurons under steady-state conditions, with lesser impact on stimulus-induced H2A.Z removal. Functionally, Anp32e depletion leads to H2A.Z-dependent impairment in transcription and dendritic arborization in cultured hippocampal neurons, as well as impaired recall of contextual fear memory and transcriptional regulation. Together, these data indicate that Anp32e regulates behavioral and morphological outcomes by preventing H2A.Z accumulation in chromatin rather than by regulating activity-mediated H2A.Z dynamics. [Display omitted] • Anp32e depletion leads to accumulation of H2A.Z in neuronal chromatin • Anp32e depletion impairs dendritic branching via H2A.Z accumulation • Anp32e has a limited role in activity-mediated H2A.Z removal • Anp32e impairs memory formation through H2A.Z accumulation Histone variants are highly dynamic regulators of neural plasticity and memory formation. Stefanelli et al. show that histone H2A.Z in neurons is regulated by Anp32e, whereby Anp32e keeps H2A.Z binding in check. In cases of Anp32e deficiency, neurons accumulate H2A.Z, their development is impaired, and mice exhibit impaired memory formation. [ABSTRACT FROM AUTHOR]

The neuronal epigenome is highly sensitive to external events and its function is vital for producing stable behavioral outcomes, such as the formation of long-lasting memories. The importance of epigenetic regulation in memory is now well established and growing evidence points to altered epigenome function in the aging brain as a contributing factor to age-related memory decline. In this review, we first summarize the typical role of epigenetic factors in memory processing in a healthy young brain, then discuss the aspects of this system that are altered with aging. There is general agreement that many epigenetic marks are modified with aging, but there are still substantial inconsistencies in the precise nature of these changes and their link with memory decline. Here, we discuss the potential source of age-related changes in the epigenome and their implications for therapeutic intervention in age-related cognitive decline. [ABSTRACT FROM AUTHOR]

The replication independent (RI) histone H2A.Z is one of the more extensively studied variant members of the core histone H2A family, which consists of many replication dependent (RD) members. The protein has been shown to be indispensable for survival, and involved in multiple roles from DNA damage to chromosome segregation, replication, and transcription. However, its functional involvement in gene expression is controversial. Moreover, the variant in several groups of metazoan organisms consists of two main isoforms (H2A.Z-1 and H2A.Z-2) that differ in a few (3–6) amino acids. They comprise the main topic of this review, starting from the events that led to their identification, what is currently known about them, followed by further experimental, structural, and functional insight into their roles. Despite their structural differences, a direct correlation to their functional variability remains enigmatic. As all of this is being elucidated, it appears that a strong functional involvement of isoform variability may be connected to development. [ABSTRACT FROM AUTHOR]

Memory formation is a protracted process that initially involves the hippocampus and becomes increasingly dependent on the cortex over time, but the mechanisms of this transfer are unclear. We recently showed that hippocampal depletion of the histone variant H2A.Z enhances both recent and remote memories, but the use of virally mediated depletion reduced H2A.Z levels throughout testing, making its temporally specific function unclear. Given the lack of drugs that target histone variants, we tested existing drugs for efficacy against H2A.Z based on their targeting of known H2A.Z regulators. The Tip60 (part of H2A.Z deposition complex) inhibitor Nu9056 reduced H2A.Z binding, whereas the histone deacetylase (HDAC) inhibitor Trichostatin-A increased H2A.Z acetylation without influencing total H2A.Z in cultured hippocampal neurons. Tip60 (but not HDAC) inhibition 23 h after learning enhanced remote (tested at 7 d) and not recent (tested at 24 h) contextual fear memory in mice. In contrast, Tip60 inhibition 30 d after learning impaired recall of remote memory after 1 h, but protected the memory from further decline 24 h later. These data provide the first evidence of a delayed postlearning role for histone variants in supporting memory transfer during systems consolidation.

Post-traumatic stress disorder (PTSD) is a psychiatric condition characterized by intrusive and persistent memories of a psychologically traumatic event that leads to significant functional and social impairment in affected individuals. The molecular bases underlying persistent outcomes of a transient traumatic event have remained elusive for many years, but recent studies in rodents have implicated epigenetic modifications of chromatin structure and DNA methylation as fundamental mechanisms for the induction and stabilization of fear memory. In addition to mediating adaptations to traumatic events that ultimately cause PTSD, epigenetic mechanisms are also involved in establishing individual differences in PTSD risk and resilience by mediating long-lasting effects of genes and early environment on adult function and behavior. In this review, we discuss the current evidence for epigenetic regulation of PTSD in human studies and in animal models and comment on ways in which these models can be expanded. In addition, we identify key outstanding questions in the study of epigenetic mechanisms of PTSD in the context of rapidly evolving technologies that are constantly updating and adjusting our understanding of epigenetic modifications and their functional roles. Finally, we discuss the potential application of epigenetic approaches in identifying markers of risk and resilience that can be utilized to promote early intervention and develop therapeutic strategies to combat PTSD after symptom onset.