Search

The efficiency of RNA interference triggered by the genetic constructs encoding siRNAs and directed against human immunodeficiency virus type 1 (HIV-1) transcripts was investigated in the non-viral test system. The investigation showed 6 biologically active siRNAs attacking 6 conservative targets in the HIV-1 genome. Expression of these genetic constructs failed to induce a nonspecific interferon response.

Sense and antisense transcripts of suffix and F element were detected at different stages of Drosophila development. A short RNA, similar in size to the full-length suffix transcript, was also found. It was suggested that it could originate from the master copy of the element. Though transcription pattern of these elements changed during the development, transcription remained symmetrical. These data indicate that formation of dsRNA in the cells and triggering of the RNA interference mechanisms are possible at all stages of Drosphila development. Analysis of total RNA samples from all stages of Drosophila development showed that 21- to 25-nt long suffix--specific small interfering RNAs (siRNA), the obligatory products of the RNA interference, were detected only in pupae. Thereafter, RNA interference mechanisms are developmentally regulated and the formation of dsRNA is necessary but not sufficient for launching this potent and specific machinery of post-transcription silencing.

To analyze the copies of the suffix short retro-element, its homologs were sought in nucleic acid sequence databases of the Drosophila melanogaster genome. The search yielded several conserved (near identical in sequence) copies, which are indicative of recent suffix transposition, and numerous divergent copies, which suggest ancient suffix transposition. Analysis of the short suffix ORF revealed a conserved protein domain, which was also found as the eighth C-terminal domain in reverse transcriptases of certain long interspersed elements (LINEs). The suffix-encoded polypeptide proved to be homologous to DNA- and RNA-recognizing domains.

RNA preparations synthesized in vitro were used to study the influence of RNA interference on the Kruppel gene activity in Drosophila embryos. RNA complementary in parallel orientation to the mRNA fragment proved to induce the development of Kruppel phenocopies. The data obtained indicate that mechanisms of specific regulation of gene activity exist in Drosophila cells, which are sensitive to the formation of both parallel and antiparallel RNA-RNA duplexes that include mRNA of the corresponding gene.

To study the effect of RNA interference (RNAi) on the activity of gene lon in Escherichia coli, genetic constructs were used that could express RNA molecules complementary to the 5' region of lon mRNA in the same direction. These RNAs were termed parallel RNAs (pRNAs). Two approaches were used to control expression. In one approach, lon gene activity was estimated genetically, based on the effect of the Lon protease on bioluminescence determined by the Vibrio fischeri lux regulon. The other approach was direct testing of ATP-dependent proteolysis in vitro. It was found that pRNA considerably suppressed lon expression. The antiparallel RNA (apRNA) was a less effective suppressor of this gene. The specific RNAi was found to decay gradually by the 40th generation. The data obtained indicate that Eubacterium cells have mechanisms for specific regulation of gene activity that are sensitive to the formation of both parallel and antiparallel RNA duplexes involving mRNA of the given gene.

Transcripts of the cut locus were localized in Drosophila embryos with use of nonradioactive in situ hybridization. DIG-labeled probes were generated from two locus regions located at position -130. Distal and proximal regions were found to be transcribed in the same tissues throughout embryogenesis. As only the proximal region transcript was detected, the conclusion was made that two or more various transcripts derived from different regions of the locus and under common control, are present simultaneously in the embryonic cells.

Data on molecular analysis of the insertion sites of nine random copies of burdock retrotransposon are presented. The 12-bp consensus sequence of the insertion sites, YNNUTUTUYAYA (Y-pyrimidine; U-purine), was determined. Homology between the burdock sequence and ribosomal genes was revealed. Three copies of this element were located within the region of ribosomal repeats: one copy in the 18S RNA gene, and two copies in the same intergenic spacer region, in the so-called Alu-repeats of Drosophila, in different copies of ribosomal genes.

Molecular analysis of a copy of the novel mobile element burdock and its insertion region into the cut locus of Drosophila was performed. The burdock was shown to be a retrotransposon containing a single open reading frame (ORF). It does not contain domens coding for protease, RNAse H, reverse transcriptase, and integrase, which are required for transposition. However, multiple insertions of this copy of the mobile element into a definite region of the cut locus (hot site) were observed earlier. The polypeptide encoded by the burdock ORF contains two successive regions homologous to the proteins encoded by the ORF1 and ORF2 of the gypsy retrotransposon in N and C regions, respectively. The burdock insertion into this region of the cut locus interrupts its ORF, since the mobile element is transcribed in the opposite direction compared with the transcription in the locus. This is presumed to account for the arising of a lethal mutation. The hot site of this element integration into the locus corresponds to the recognition site of Drosophila topoisomerase II.

Nineteen DNA clones, containing copies of the suffix element retroposon of the Drosophila genome and produced by a polymerase chain reaction (PCR), were sequenced. Insertions of the copies in both orientations into microsatellite sequences (CAACA)n/(TGTTG)n and (TTTGT)n/(CACAAA)n were revealed. It was found that, if the microsatellite sequence has both a decanucleotide GCGGCCCGGG (GC-box) and a colinear alternating sequence (A)5(T)4(A)3(T)2(A)1(t)n (AT-box), the insertion of the suffix occurs in only one orientation. It is suggested, that in such apparently heterochromatic sequences, suffix element copies and probably some other retroposons can be inserted a particular orientation by means of site-specific recombination. An approach to analysis of the molecular organization of such sequences is proposed.

The investigation of sequences homologous to the suffix chains from Drosophila genome revealed the central domain of the element homologous to 16S ribosomal sequence from endosymbiotic organisms. The opposite strand of the element encodes C-domains of reverse transcriptase enzyme in F- and Doc-elements. 19 DNA clones possessing PCR-amplified stretches of genomic DNA were sequenced. It was found that micro-satellite sequences (CAACA)n/(TGTTG)n and (TTTGT)n/(CACAAA)n are the target sites for the insertions of suffix copies in heterochromatic regions of Drosophila genome in both orientations. It was found that the presence of decanucleotide GCGGCCCGGG (GC-box) followed by the alternating stretch (A)5(T)4(A)3(T)2(A)1(T)n (AT-box) led to the fixed polarity of the suffix insertions in the same micro-satellite sequences.

Conformations of parallel deoxyoligonucleotides 5'd(CTATAGGGAT)3'/5'd(GATATCCCTA)3' and 5'd(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)3'/'5'd (ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)3' were studied in solution by CD method. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at decreased water activity (relative humidity). This distinctive change is supposed to stem from a cooperative conformational transition of parallel double helix from a B-like form with C2'endo sugar conformation to a A-like form designated as Ap. The free energy difference between Ap- and B-like conformations of the parallel decaduplex is close to that for antiparallel decaduplex with the nucleotide sequence studied. A-phility of a parallel helix is dependent on its sequence.

Sequences homologous to the suffix repeat involved in 3'maturation of many Drosophila melanogaster genes have been searched in various organisms by molecular hybridization technique. Several species from evolutionary close and distant to Drosophila melanogaster taxons have been found to contain homology with the suffix in their genomes.

The lambdagt clones containing fragments of D. melanogaster genome were prepared and characterized by hybridization of their DNA with complementary RNA synthesized on the lambdagt DNA, C fragment of lambdagt DNA and total D. melanogaster DNA, and also with mRNA and a stable cytoplasmic poly(A)-RNA both isolated from D. melanogaster cells grown in culture. The technique for a simple selection of hybrid clones is described. The hybridization with mRNA allows one to select the clones containing structural genes of D. melanogaster. It was found that in all cases when the clone contains the structural gene it also contains the reiterated base sequences of the D. melanogaster genome. Several clones containing D. melanogaster DNA fragments with a size of (2--4) X 10(6) daltons which hybridized with a relatively large portion of mRNA were selcted for further analysis.

The majority of D. melanogaster salivary gland nuclei contains many nucleoli which vary in size and number. All nucleoli hybridize in situ with a cloned Drosophila DNA fragment containing 26S ribosomal gene. Autoradiographic analysis of preparations after pulse H3-uridine or H3-thymidine labelling of the salivary gland indicates an intensive transcription and replication of DNA within nucleoli. The nucleoli are bound to different sites of polytene chromosomes by chromatin fibers similar to strands of ectopic pairing and they are most often bound to regions which may be defined as intercalary heterochromatin.

The data are reported on suppression of mutations at the cut locus induced by a mdg4 insertion carrying the other mobile element, "jockey". All mutations containing mdg4 with the jockey (ctMRpN) are suppressed by a classic suppressor su(Hw)2 and two new alleles obtained in this work. The extent of suppression increases, depending on the orientation of the jockey in mdg4 up to the point, when su(Hw) alleles known as recessive become semi-dominant. The jockey and mdg4 have been also found to influence the locus transcription in the norm and in case of suppression.

An investigation of the properties of a number of genes of Drosophila, obtained by cloning recombinant DNAs, led to the detection of a new type of organization of genetic material. It was found that a number of actively working structural genes of Drosophila are represented by a large number of copies, scattered over its chromosomes. Their localization in the chromosomes is variable, although they are always detected in regions of intercalary heterochromatin. The latter evidently is a site of accumulation of various multiple genes.

The nucleotide sequences of 8 genomic and 2 mRNA copies of the suffix were studied. It was found that this short repeat (265 bp) forms the last exon (73 bp) in different developmentally regulated Drosophila genes. The functioning genes contain short insertions carrying polyadenylation signals and polyadenylation sites at the same position of the suffix. It was shown that the suffix sequence is directly involved in the formation of the last splicing site and 3'-end maturation of mRNA.