Search

Testicular adrenal rest tumor (TART) is a prevalent complication associated with congenital adrenal hyperplasia (CAH), culminating in gonadal dysfunction and infertility. Early hormonal intervention is preventive, but excessive glucocorticoid poses risks. Developing reliable methods for early TART diagnosis and monitoring is crucial. The present study aims to formulate a scoring system to identify high-risk infertility through analysis of TART ultrasound features. Grayscale and power Doppler ultrasound were employed in this retrospective study to evaluate testicular lesions in male CAH patients. Lesion assessment encompassed parameters such as range, echogenicity, and blood flow, and these were subsequently correlated with semen parameters. Results of 49 semen analyzes from 35 patients demonstrated a notable inverse correlation between lesion scores and both sperm concentration (r s  = - 0.83, P < 0.001) and progressive motility (r s  = - 0.56, P < 0.001). The ROC curve areas for evaluating oligospermia and asthenozoospermia were calculated as 0.94 and 0.72, respectively. Establishing a lesion score threshold of 6 revealed a sensitivity of 75.00% and specificity of 93.94% for oligospermia and a sensitivity of 53.85% and specificity of 100.00% for asthenozoospermia. These findings underscore the potential utility of incorporating ultrasound into routine CAH patient management, facilitating timely interventions to preserve male fertility., (© 2024. The Author(s).)

Background and Importance: Moyamoya syndrome causes progressive stenosis of intracranial internal carotid arteries and may be associated with genetic disorders like Down's or Turner's syndromes. We treated a male pseudohermaphrodite patient with congenital adrenal hyperplasia (CAH) with clinical and radiological features of moyamoya vasculopathy. To our knowledge, this association has not been reported., Clinical Presentation: The 42-year-old patient presented with an intraventicular bleed. Cerebral angiography revealed moyamoya vasculopathy. He was hypertensive and had primary amenorrhea. Secondary sexual characteristics were poorly developed and he had ambiguous genitalia. Breast development was Tanner stage 3. Investigation revealed hypokalemia. With primary amenorrhea, persistent hypokalemia, hypertension and ambiguous genitalia, CAH was considered as a possibility and confirmed on hormone profile. Karyotyping revealed 46XY pattern. Abdominal ultrasound revealed hyperplasia of the adrenal glands, absent uterus and ovaries and ectopic testicles in inguinal canals. He was put on steroids and his blood pressure controlled., Conclusions: To the best of our knowledge we report the first case of moyamoya syndrome occurring in association with CAH.

Introduction: Patients with classical congenital adrenal hyperplasia (CAH) have prenatal and postnatal hormonal imbalances. To characterize the ontogeny of reported brain and behavior changes in older children with CAH, we aimed to study the brain structure in infants with CAH compared to healthy controls., Methods: We performed neuroimaging in 16 infants with classical CAH due to 21-hydroxylase deficiency (8 males, gestational age 38.2 ± 1.7 weeks, post-conceptional age [PCA] 42.2 ± 3.0 weeks) and 14 control infants (9 males, gestational age 38.5 ± 1.8 weeks, PCA 42.5 ± 2.4 weeks) utilizing 3-Tesla magnetic resonance imaging. Regional brain volumes were adjusted for PCA and sex, along with an additional adjustment for total brain volume (TBV), for group comparisons by regression analyses (mean, 95% confidence interval [CI]). The degree to which each brain region was differentiated between CAH and control infants was examined by relaimpo analyses, adjusting for all other brain regions, PCA, and sex., Results: Infants with CAH had significantly smaller thalamic volumes (8,606 mm3, 95% CI [8,209, 9,002]) compared to age-matched control infants (9,215 mm3, 95% CI [8,783, 9,647]; β = -609; p = 0.02) which remained smaller after further adjustment for TBV. Upon further adjustment for TBV, the temporal lobe was larger in infants with CAH (66,817 mm3, CI [65,957, 67,677]) compared to controls (65,616 mm3, CI [64,680, 66,551]; β = 1,202, p = 0.03). The brain regions most differentiated between CAH versus controls were the thalamus (22%) and parietal lobe (10%)., Conclusions: Infants with CAH exhibit smaller thalamic regions from early life, suggesting a prenatal influence on brain development in CAH. Thalamic emergence at 8-14 weeks makes the region particularly vulnerable to changes in the intrauterine environment, with potential implications for later maturing brain regions. These changes may take time to manifest, meriting longitudinal study through adolescence in CAH., (© 2023 S. Karger AG, Basel.)

Background: Congenital adrenal hyperplasia (CAH) is a group of genetic disorders that affects the adrenal glands and is the most common cause of primary adrenal insufficiency in children. In the past few decades, magnetic resonance imaging (MRI) has been implemented to investigate how the brain may be affected by CAH. A systematic review was conducted to evaluate and synthesize the reported evidence of brain findings related to CAH using structural, functional, and diffusion-weighted MRI., Methods: We searched bibliographical databases through July 2021 for brain MRI studies in individuals with CAH., Results: Twenty-eight studies were identified, including 13 case reports or series, 10 studies that recruited and studied CAH patients vs unaffected controls, and 5 studies without a matched control group. Eleven studies used structural MRI to identify structural abnormalities or quantify brain volumes, whereas 3 studies implemented functional MRI to investigate brain activity, and 3 reported diffusion MRI findings to assess white matter microstructure. Some commonly reported findings across studies included cortical atrophy and differences in gray matter volumes, as well as white matter hyperintensities, altered white matter microstructure, and distinct patterns of emotion and reward-related brain activity., Conclusions: These findings suggest differences in brain structure and function in patients with CAH. Limitations of these studies highlight the need for CAH neuroimaging studies to incorporate larger sample sizes and follow best study design and MRI analytic practices, as well as clarify potential neurologic effects seen across the lifespan and in relation to clinical and behavioral CAH phenotypes.

We report a case of a fetus with a prenatal diagnosis of classical congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency. Although CAH is typically assessed postnatally, this fetal case had multiple prenatal clinical assessments made feasible by an interdisciplinary CAH center. The approach facilitated the development and delivery of comprehensive and earlier care for the fetus, and the family living with this complex, congenital condition, with perinatology, endocrinology, genetic counseling, psychology, and urology involvement. As well, the addition of fetal MRI to standard ultrasound revealed significant deficits in the biparietal diameter, occipitofrontal diameter, and total intracranial volume of the fetal CAH brain. These early anomalies in the brain suggest that neurological comorbidities observed in older children and adults with CAH should be studied as early as prenatally, with the addition of fetal MRI to ultrasound potentially being useful for identifying and understanding prenatal anomalies in CAH.

Context: Patients with congenital adrenal hyperplasia (CAH) are treated with life-long glucocorticoid (GC) replacement therapy. Negative effects on cognition, brain structure and function during working memory tasks have been identified. To date, no studies on functional connectivity during rest have been performed in patients with CAH., Objective: To investigate resting-state functional connectivity in patients with CAH compared with healthy untreated controls and the association between functional connectivity in the precuneus and disease severity, dose of GC and working memory (WM)., Design, Setting and Participants: Thirty-one patients with CAH (18 females) and 38 healthy controls (24 females), aged 16-33 years, from a single research institute, underwent functional magnetic resonance imaging of the brain during rest., Results: Patients with CAH showed increased functional connectivity in the precuneus compared with controls. Post-hoc tests within the precuneus showed that only patients with simple virilising CAH had stronger connectivity compared to controls. Further, while both patients with salt-wasting and simple virilising CAH performed worse on a WM task compared to controls, functional connectivity in the precuneus was not associated with executive function performance., Conclusion: Patients with CAH demonstrated altered functional connectivity during rest in the precuneus. Such a change may reflect a functional reorganisation in response to the CAH disease. The change in functional connectivity may depend on the severity of CAH., (Copyright © 2022 The Author(s). Published by Elsevier Inc. All rights reserved.)

Context: Gray matter morphology in the prefrontal cortex and subcortical regions, including the hippocampus and amygdala, are affected in youth with classical congenital adrenal hyperplasia (CAH). It remains unclear if white matter connecting these aforementioned brain regions is compromised in youth with CAH., Objective: To examine brain white matter microstructure in youth with CAH compared to controls., Design: A cross-sectional sample of 23 youths with CAH due to 21-hydroxylase deficiency (12.9 ± 3.5 year; 61% female) and 33 healthy controls (13.1 ± 2.8 year; 61% female) with 3T multishell diffusion-weighted magnetic resonance brain scans., Main Outcome Measures: Complementary modeling approaches, including diffusion tensor imaging (DTI) and neurite orientation dispersion and density imaging (NODDI), to examine in vivo white matter microstructure in six white matter tracts that innervate the prefrontal and subcortical regions., Results: DTI showed CAH youth had lower fractional anisotropy in both the fornix and stria terminalis and higher mean diffusivity in the fornix compared to controls. NODDI modeling revealed that CAH youth have a significantly higher orientation dispersion index in the stria terminalis compared to controls. White matter microstructural integrity was associated with smaller hippocampal and amygdala volumes in CAH youth., Conclusions: These patterns of microstructure reflect less restricted water diffusion likely due to less coherency in oriented microstructure. These results suggest that white matter microstructural integrity in the fornix and stria terminalis is compromised and may be an additional related brain phenotype alongside affected hippocampus and amygdala neurocircuitry in individuals with CAH., (© The Author(s) 2021. Published by Oxford University Press on behalf of the Endocrine Society. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.)

Background: The effects of hyperandrogenism and steroid treatment on bone mineral density (BMD) in patients with congenital adrenal hyperplasia (CAH) are controversial., Objectives: The objectives of this study were to characterize BMD and fractures in patients with CAH and to identify whether there is an association between alterations in BMD, nutritional status, and variables related to the disease., Methods: A cross-sectional descriptive study was conducted to explore clinical, hormonal, dairy consumption, physical activity, and BMD variables in patients with CAH due to 21-hydroxylase deficiency and controls matched by age, gender, skin color, body mass index, and Tanner scale., Results: Fifty subjects (CAH n = 25; females n = 42 [84%]) with a mean age of 15.9 ± 5.8 years were included in the study. White skin color predominated in 34 subjects (68%), mestizo in 11 (22%), and black in 5 (10%). In patients with CAH, BMD lumbar spine was decreased compared to that in controls (0.83 ± 0.23 vs. 0.98 ± 0.26 g/cm3, p = 0.004). BMD femur was also decreased in patients with CAH; however, this was not significant (0.95 ± 0.20 vs. 1.04 ± 0.24 g/cm3, p = 0.17). There was a positive relationship between age at diagnosis, age of initiation of glucocorticoid treatment, and testosterone levels with all measurements of BMD. The daily glucocorticoid dose was negatively related to BMD. No fractures were found., Conclusions: Patients with CAH had decreased BMD, especially in lumbar spine. Increased androgen exposure seemed to improve, while increased glucocorticoid dose impaired BMD., (© 2021 S. Karger AG, Basel.)

Congenital adrenal hyperplasia (CAH) has been associated with brain structure alterations, but systematic studies are lacking. We explore brain morphology in 37 (21 female) CAH patients and 43 (26 female) healthy controls, aged 16-33 years, using structural magnetic resonance imaging to estimate cortical thickness, surface area, volume, subcortical volumes, and white matter (WM) microstructure. We also report data on a small cohort of patients (n = 8) with CAH, who received prenatal dexamethasone (DEX). Patients with CAH had reduced whole brain volume (4.23%) and altered structure of the prefrontal, parietal, and superior occipital cortex. Patients had reduced mean FA, and reduced RD and MD, but not after correcting for brain volume. The observed regions are hubs of the visuospatial working memory and default mode (DMN) networks. Thickness of the left superior parietal and middle frontal gyri was associated with visuospatial working memory performance, and patients with CAH performed worse on this task. Prenatal treatment with DEX affected brain structures in the parietal and occipital cortex, but studies in larger cohorts are needed. In conclusion, our study suggests that CAH is associated with brain structure alterations, especially in the working memory network, which might underlie the cognitive outcome observed in patients., (© The Author(s) 2019. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.)

Purpose: In this report, we aim to define the different degrees of structural abnormality affecting the female genitalia in cases of CAH by using the multiplanar capabilities and high soft tissue resolution of MRI., Patients and Methods: The study included cases of CAH who were referred to our pediatric surgical facility for genital reconstruction during the period 2016 through 2019. We studied the pelvic MRI anatomy in cases of CAH while referring to clinical and operative findings. To set up a grading scale for the degree of virilization in cases of CAH, we included another two control groups of normal boys and girls representing the two ends of the spectrum., Results: The study included 23 cases of CAH who underwent preoperative pelvic MRI examination. All cases had normal chromosomal analysis (46 XX). Their age ranged from 1 to 156 months at time of MRI examination (mean 42.4; median 25). The level of the lower end of the vagina was identified in midsagittal T2WI and confirmed in sequential axial cuts. Based on the level of the lower end of the vagina in relation to the pubic symphysis, we classified cases of CAH into either low or high types. Moreover, we could observe a correlation between the degree of vaginal descent and structural transformation of erectile tissue between both genders., Conclusion: MRI can have an important role in the evaluation of cases of CAH by displaying the severity of internal anomaly which is crucial for proper preoperative counseling., Type of Study: Case control study., Level of Evidence: Level III., (Copyright © 2020 Elsevier Inc. All rights reserved.)

Context: Primary bilateral macronodular adrenal hyperplasia (BMAH) is a rare form of adrenal Cushing syndrome conventionally treated with adrenalectomy. Medical treatment is often reserved for patients not eligible for surgery. However, to date there have been few studies about the efficacy of mifepristone for the treatment of BMAH associated with hypercortisolism., Objective: To describe a series of patients with hypercortisolism due to BMAH treated with mifepristone from multiple medical practices., Design: We retrospectively assessed four patients treated with mifepristone for hypercortisolism due to BMAH who had either failed unilateral adrenalectomy, declined surgery, or were poor surgical candidates., Results: Mifepristone induced clinical improvement and remission of the signs and symptoms of hypercortisolism in all described patients with BMAH. The median treatment duration at the time of efficacy response assessment was 5 months (range: 3 to 18 months). Improvement in cardiometabolic parameters was observed as early as 2 weeks after treatment was started. All patients achieved improvements in glycemic control and hypertension and had significant weight loss. The most common adverse event observed with mifepristone therapy was fatigue. Increases in TSH level occurred in two patients., Conclusion: Mifepristone can be an effective medical alternative to surgery in patients with hypercortisolism due to BMAH., (Copyright © 2019 Endocrine Society.)

Imaging of the reproductive tract is challenging and requires a general knowledge of congenital variations in anatomy. The anatomy of the developing fetus, whether a male phenotype or female phenotype, is also a dynamic process with many changes occurring during gestation. Families may ask details about the genitalia during prenatal imaging and when variations in what is thought to be normal are present, further investigation is sometimes needed to make sense of what is seen. This overview will describe categories of disorders of sex development (DSD), whether chromosomal or structural or both, and the current state of imaging of these anomalies., (Copyright © 2019 Elsevier Inc. All rights reserved.)

Objective: Adrenonodular hyperplasia and tumour formation are potential long-term complications of congenital adrenal hyperplasia (CAH) with little known regarding the clinical implications. Our aim was to describe volumetric adrenal morphology and determine the association between radiological findings and comorbidities in adults with classic CAH., Design: This was a cross-sectional study of 88 patients (mean age 29.2 ± 13 years, 47 females) with classic CAH seen in a tertiary referral centre., Methods: CT imaging, performed at study entry or when reaching adulthood, was used to create 3-dimensional volumetric models. Clinical, genetic and hormonal evaluations were collected and correlated with adrenal morphology and tumour formation., Results: Over one-third of the cohort was obese. 53% had elevated 17-OH-progesterone or androstenedione; and 60% had adrenal hyperplasia. Tumours included 11 myelolipomas, 8 benign adrenocortical adenomas, 1 pheochromocytoma and 50% of men had testicular adrenal rest tissue. CAH patients with adrenal hyperplasia had significantly higher number of comorbidities than those with morphologically normal adrenals (P = 0.03). Variables that positively correlated with adrenal volume included hypogonadal/oligomenorrhoeic status, hypertension, androstenedione, aldosterone, and triglyceride levels, and in women, low HDL and insulin resistance. Elevated aldosterone was observed in a subset of patients with simple virilizing CAH., Conclusions: Adrenocortical hyperplasia is associated with a number of comorbidities, especially hypogonadism. Aldosterone production associated with adrenal enlargement may play a role in the development of metabolic risk factors. Further studies are needed to assess the long-term impact of the excess adrenal steroid milieu associated with adrenal enlargement to develop improved management strategies for CAH., (Published 2019. This article is a U.S. Government work and is in the public domain in the USA.)

Background Testicular adrenal rest tumors (TARTs) leading to primary gonadal failure are the main etiology of infertility in congenital adrenal hyperplasia (CAH). We aimed at identifying the evolution of TART and related findings in young CAH patients. Methods Twelve male patients (3-23 years old) with 21-hydroxilase deficiency (11 with classic salt-wasting form) were included. Testicular ultrasonography (US) was performed in two moments, by a single blinded specialist in pediatric diagnostic imaging. Tumor progression was classified according to the Response Evaluation Criteria in Solid Tumors (RECIST). The clinical and laboratory data were retrieved from medical records. Serum 17-OH-progesterone (17OHP) and androstenedione concentrations were evaluated during the whole period of follow-up, from the CAH diagnosis. A logistic regression model with repeated measures was developed for the analysis. Results The prevalence of TART was 41.6% (n = 5) in the initial US evaluation and 66.6% (n = 8) after 6 years of follow-up. Tumor progression was detected in 4 of the 5 patients, and 1 presented with a stable tumor. Three patients presented with new tumors in the second evaluation. Most of the patients (n = 11) were pubertal, including a 7-year-old child with TART who presented with central precocious puberty. At regression analysis, it was observed that an inadequate hormonal control led to a 16 times greater chance of a patient to present with TART (OR = 16.08; confidence interval [CI] 95% = 2.38-108.81; p = 0.004). Conclusions We found a high prevalence of progressive TART in young pubertal subjects. US testicular screening should help in improving therapeutic optimization in CAH patients to reduce future impairment in fertility.

Objective: Epicardial fat thickness (EFT) is an emerging cardio-metabolic risk factor and has been shown to be related to atherosclerosis. EFT has not been studied in the context of CAH. This study aimed to evaluate EFT in children with CAH and its relation to carotid artery intima-media thickness (CA-IMT) and left ventricular (LV) functions., Methods: Thirty-six children with classical CAH were compared with 36 healthy controls. All patients had confirmed CAH and were receiving steroid substitution therapy. Patients and controls underwent anthropometric evaluation, measurement of fasting lipids, glucose, insulin, homeostasis model assessment for insulin resistance (HOMA-IR). LV functions and EFT were assessed using conventional echocardiography. Duplex ultrasonography was used to measure CA-IMT., Results: Compared to controls, patients had greater EFT (p=0.001), CA-IMT (p=0.01), LV mass index (LVMI) (p=0.001) and prolonged mitral deceleration time (DcT) (p=0.01). CAH patients also had significantly worse HOMA-IR (p=0.001) than controls. Abnormalities were worse in uncontrolled CAH on treatment. Multivariate analysis in CAH subjects showed EFT correlated positively with waist circumference odds ratio (OR) [OR=1.9; 95% confidence interval (CI): 1.07-1.14; p=0.01], 17-hydroxyprogesterone [OR=1.6; 95% CI: 1.33-2.89; p=0.05], testosterone concentration (OR=1.7; 95% CI: 1.55-2.13; p=0.01), LVMI (OR=1.14; 95% Cl: 1.08-1.13; p=0.01), mitral DcT (OR=2.25; 95% CI: 1.15-2.05; p=0.01) and CA-IMT (OR=1.6; 95% CI: 1.15-2.05; p=0.01)., Conclusion: EFT is elevated in children with classical CAH, particularly in those with poor control, and is correlated with CA-IMT, LV mass and mitral DcT. Measurement of EFT in CAH children may help to identify those at high risk of developing LV dysfunction and subclinical atherosclerosis.

Background: Congenital adrenal hyperplasia (CAH) resulting from steroid 11β-hydroxylase deficiency (11β-OHD) is caused by mutations in the CYP11B1 gene. It is the second major form of CAH associated with hypertension and hypopotassemia. The aim of this study was to provide a genetic analysis of 11β-OHD in a Chinese family., Case Presentation: A 19-year-old Chinese man was clinically diagnosed with 11β-OHD. His initial clinical manifestations included precocious puberty, hyperpigmentation, hypertension, and hypopotassemia. The patient had taken an overdose of dexamethasone (0.75 mg/d) for more than 10 years before finally developing iatrogenic Cushing's syndrome. Our aim was to perform a molecular diagnosis of his family. Mutations in the CYP11B1 gene of the patient and his parents were examined using polymerase chain reaction (PCR) resequencing. Additionally, to predict the possible effects of novel mutations on the structure and function of 11β-hydroxylase, these mutations were analyzed by MutationTaster software. Two novel pathogenic mutations were found in the CYP11B1 gene: a heterozygous in-frame insertion deletion mutation c.1440&#95;1447delinsTAAAAG in exon 9 inherited from the father and a heterozygous mutation c.1094&#95;1120delTGCGTGCGGCCCTCAAGGAGACCTTGC (p.364&#95;372del) in exon 6 inherited from the mother., Conclusions: A clear genetic diagnosis can be made by analyzing the functional and structural consequences of CYP11B1 gene mutations that lead to 11β-OHD. Because the dosage of glucocorticoid should be adjusted to minimize the risk of iatrogenic Cushing's syndrome, clinical follow-up should be conducted with these patients.

Persistent urogenital sinus (PUGS) is a congenital pathological condition characterized by an abnormal communication between the urethra and vagina, which has an estimated incidence of 0.6/10,000 female births. It could be the only known malformation or part of a syndrome. PUGS is commonly shown by a pelvic mass, related to a distended bladder, hydrometrocolpos which is due to an obstruction leading to the dilation of the vagina and uterus (i.e., imperforate hymen, transverse vaginal septum or atresia, and PUGS) or both. We present a case of female patient with classical congenital adrenal hyperplasia, diagnosed on the 7th day of life, with ambiguous genitalia, untreated surgically only with hormone therapy by parental decision. The patient, at the age of 5 years and 5 months, came to our observation for a pelvic ultrasound, which revealed retrovesical neoformation with anechoic content and regular walls. We performed the ultrasound examination that showed the dilation of the cervix and the vaginal canal with anechoic finely corpuscolated content in the declining portion, compatible with hydrometrocolpos from probable persistence of the urogenital sinus. The voiding cystourethrography (VCUG) confirmed the ultrasound diagnosis, with evidence of urogenital sinus. In conclusion, ultrasound is the first diagnostic tool, but need to be completed by other technical procedures, which VCUG or magnetic resonance imaging to observe the site of fusion of the urinary and genital tract.

Combined 17 α-hydroxylase/17,20-lyase deficiency (17OHD) is a rare autosomal recessive disease that is a type of congenital adrenal hyperplasia, which results in hypertension, hypokalemia, sexual infantilism, primary amenorrhea in females (46,XX), or pseudohermaphroditism in males (46,XY). It is mainly caused by mutation in the CYP17A1 gene, which encodes a key enzyme in the steroidogenic pathway. However, these patients rarely experience adrenal crisis, due to abnormally high corticosterone levels. Here, we report a 17OHD patient who experienced clinical adrenal crisis on day 1 after gonadectomy. Her (46,XY) genetic defect was c0.715 C > T p.Arg239-stop in exon 4 of CYP17A1, which was confirmed by targeted sequence capture/high-throughput sequencing and Sanger sequencing technology. To the best of our knowledge, 17OHD with adrenal crisis has not been reported previously, and the reason why it arose in this patient might have been inappropriate glucocorticoid administration during the perioperative period.

Context: Brain white matter hyperintensities are seen on routine clinical imaging in 46% of adults with congenital adrenal hyperplasia (CAH). The extent and functional relevance of these abnormalities have not been studied with quantitative magnetic resonance imaging (MRI) analysis., Objective: To examine white matter microstructure, neural volumes, and central nervous system (CNS) metabolites in CAH due to 21-hydroxylase deficiency (21OHD) and to determine whether identified abnormalities are associated with cognition, glucocorticoid, and androgen exposure., Design, Setting, and Participants: A cross-sectional study at a tertiary hospital including 19 women (18 to 50 years) with 21OHD and 19 age-matched healthy women., Main Outcome Measure: Recruits underwent cognitive assessment and brain imaging, including diffusion weighted imaging of white matter, T1-weighted volumetry, and magnetic resonance spectroscopy for neural metabolites. We evaluated white matter microstructure by using tract-based spatial statistics. We compared cognitive scores, neural volumes, and metabolites between groups and relationships between glucocorticoid exposure, MRI, and neurologic outcomes., Results: Patients with 21OHD had widespread reductions in white matter structural integrity, reduced volumes of right hippocampus, bilateral thalami, cerebellum, and brainstem, and reduced mesial temporal lobe total choline content. Working memory, processing speed, and digit span and matrix reasoning scores were reduced in patients with 21OHD, despite similar education and intelligence to controls. Patients with 21OHD exposed to higher glucocorticoid doses had greater abnormalities in white matter microstructure and cognitive performance., Conclusion: We demonstrate that 21OHD and current glucocorticoid replacement regimens have a profound impact on brain morphology and function. If reversible, these CNS markers are a potential target for treatment.

Background: Reduced fertility is a common potential problem among males with congenital adrenal hyperplasia (CAH), with nearly half experiencing impaired sperm production. The major cause of oligo/azoospermia in CAH is testicular adrenal rest tumors (TARTs). Studies indicate that ultrasound screening for TARTs should begin during childhood, yet it remains unclear whether boys with CAH are routinely screened for TARTs and/or counseled about infertility risk and potential interventions such as fertility testing and/or preservation., Objective: The purpose of this study was to examine TART screening and fertility counseling practices among boys with CAH., Study Design: An IRB-approved retrospective chart review was conducted of all males with ICD-9/10 codes for CAH (2007-2016) at a large pediatric academic center to examine: age and indication for diagnosis; age at first and last documented pediatric endocrinology and urology visit; history of ultrasound examinations; and documentation of fertility counseling., Results: Forty-six patients were included, of whom 38 had 21-hydroxylase deficiency. Median age at diagnosis was 2 weeks (range 7 days-10 years). Median age at the most recent pediatric endocrinology clinic visit was 14 years (range 2-42 years). Twenty-nine patients were >11 years old (63% of the sample) at the time of the study and 14 of these were >18 years old (30% of the sample). Seven patients (15%) had a screening ultrasound at some point in their care, of whom three had TARTs. Fertility was mentioned in the records of six subjects (13% of the sample). Six of the subjects (13%) had any mention of fertility in their records. None of the patients had biochemical testing or semen analysis to assess gonadal function, and none were offered fertility preservation. Only one patient was seen by a pediatric urologist., Discussion: Despite the limitations of a single-center retrospective design, our findings highlight that TART screening and fertility counseling remain underutilized in boys with CAH. There is a need for increased awareness and development of practice guidelines within pediatric urology and endocrinology to address this common and understudied problem., Conclusion: In addition to a screening ultrasound in puberty and consideration of semen analysis after puberty, these boys may benefit from seeing a pediatric urologist independently or in an interdisciplinary program. Boys with CAH and their families should be educated about infertility risk and potential interventions, with the goal of improving reproductive outcomes in this population., (Published by Elsevier Ltd.)

Background: Bilateral macronodular adrenal hyperplasia (BMAH) is a rare cause of Cushing's syndrome (CS). BMAH is predominantly believed to be caused by two mutations, a germline and somatic one, respectively, as described in the two-hit hypothesis. In many familial cases of BMAH, mutations in armadillo repeat containing 5 (ARMC5), a putative tumor suppressor gene, are thought to induce the disorder. The objective of this study was to report a case in which the patient presented with BMAH induced by a novel heterozygous germline ARMC5 mutation (c. 517C > T, p. Arg173*) alone rather than a two-hit mutation., Case Presentation: A 51-year-old woman was identified with masses in the bilateral adrenals. Serum cortisol levels were increased significantly both in the morning (08:00 AM) and late at night (24:00 AM), while plasma adrenocorticotropic hormone was normal. The patient underwent a left adrenalectomy and histopathology substantiated the BMAH diagnosis. WES of the germline DNA discovered a novel heterozygous germline ARMC5 mutation (c. 517C > T, p. Arg173*) and in silico analysis predicted that the mutation significantly impaired protein function, resulting in inactivated ARMC5. Subsequently, WES of the tumor specimen identified 79 somatic single nucleotide polymorphisms (SNPs)/insertion-deletion (indel) mutations, including 32 missense/nonsense/splice/stop-loss mutations. None of these mutations were CS-related., Conclusions: A novel germline ARMC5 mutation (c. 517C > T, p. Arg173*) was identified that induced BMAH alone without a second mutation. ARMC5 sequencing may improve the identification of clinical forms of BMAH and allow earlier diagnosis of this disease.

Primary bilateral macronodular adrenocortical hyperplasia (PBMAH) is an uncommon cause of adrenal Cushing syndrome (CS) in which cortisol and occasionally other steroid hormones can be secreted under the influence of aberrantly expressed G-protein coupled receptors (GPCRs) in the adrenal cortex. We describe the unique case of a 64-year-old postmenopausal female with PBMAH whose adrenal lesions expressed luteinizing hormone receptors (LHr). She presented initially with CS and underwent right adrenalectomy; a few years later she presented with macromastia and mastodynia, possibly due to estrogen excess from her remaining left adrenocortical masses. Testing before and after treatment with quarterly leuprolide acetate therapy and immunohistochemistry on tissue and targeted sequencing of the genes of interest were performed. Tissue from the patient's right adrenal was tested for P450 aromatase (CYP19A1) and LHr expression; both were expressed throughout the hyperplastic cortex, although expression was more intense in the adenomatous areas. Targeted sequencing revealed a pathogenic PDE11A mutation, as well as variants in the ARMC5 and INHA genes. PDE11A expression was decreased in the adenoma but there was no loss of heterozygosity for the PDE11A locus. Because of the clinical presentation and LHr expression, quarterly leuprolide acetate therapy was started. Shortly after initiation of therapy, the patient reported decreased breast size and pain; she remains well controlled to date, after 10 years of treatment. This is the first description of a patient with PBMAH presenting with severe macromastia and mastodynia from what appears to be excess estrogen production from her adrenal tumor. The patient had a long-lasting response to chronic leuprolide acetate treatment, showing that drug therapy exploiting the aberrant receptor expression in PBMAH is possible even in the absence of cortisol overproduction., Competing Interests: The authors declare that they have no conflict of interest., (© Georg Thieme Verlag KG Stuttgart · New York.)

21-hydroxylase deficiency is a rare kind of autosomal recessive disorders, which can result in congenital adrenal hyperplasia and/or testicular adrenal rest tumors. 21-hydroxylase deficiency with TARTs is prone to be misdiagnosed as Leydig cell tumors. Although the sonographic characteristics of TARTs have been summarized in previous reports, its features in computed tomography images were rarely reported. In this study, we presented and summarized the clinical and imaging data of a special case suffering this disease, aiming to improve the imaging diagnosis performance.

Background/aims: Homocysteine is an important and independent risk factor for atherosclerotic diseases. The aim of this study was to evaluate serum levels of homocysteine in children with congenital adrenal hyperplasia (CAH) and their relation to carotid artery intima-media thickness (CA-IMT) and left ventricular (LV) function., Methods: This study included 36 children with classic CAH and 36 healthy children. All underwent anthropometric evaluation. Measurement of serum levels of total homocysteine was carried out. The LV mass (LVM) and function were assessed using conventional echocardiography. Duplex ultrasonography was used to measure CA-IMT., Results: Compared to the controls, the patients had higher homocysteine levels (p = 0.001), a thicker CA-IMT (p = 0.01), a higher LVM index (LVMI) (p = 0.001), and a prolonged mitral deceleration time (DcT) (p = 0.01). Abnormalities were marked in children who were uncontrolled on medical treatment. In multivariate analysis, homocysteine levels were significantly correlated with systolic (OR = 2.2; 95% CI: 1.10-1.18; p = 0.01) and diastolic blood pressures (OR = 2.9; 95% CI: 1.45-2.4; p = 0.01), atherogenic index (OR = 2.6; 95% CI: 1.33-2.89; p = 0.01), HOMA-IR (OR = 1.3; 95% CI: 1.04-1.34; p = 0.001), LVMI (OR = 2.6; 95% CI: 1.1-1.13; p = 0.001), mitral DcT (OR = 2.4; 95% CI: 1.15-2.05; p = 0.01), and CA-IMT (OR = 1.6; 95% CI: 1.16-1.57; p = 0.01)., Conclusions: Serum total homocysteine was elevated in children with classic CAH, particularly in those with poor control on medical treatment, and it was correlated with CA-IMT, LVMI, and mitral DcT. Measurement of homocysteine in children with CAH may help to identify those at high risk of developing LV dysfunction and subclinical atherosclerosis., (© 2018 S. Karger AG, Basel.)

Background: The enlargement of suprarenal gland is related to preterm birth and the birth weight. The ultrasound measurement of fetal adrenal gland volume may identify women at risk for impending preterm birth. The aim of our study was to investigate the newborns in the region of western Slovakia followed up due to suprarenal gland enlargement. To set the ratio of prenatally diagnosed suprarenal gland enlargment, postnatal managment and treatment and interventions. The newborns with congenital adrenal hyperplasia were excluded., Methods: We have analyzed 6 years of medical records of all cases from the western Slovakia region of suprarenal gland enlargement encountered to 1st Pediatric Department, Children's University Hospital Bratislava Republic in the time period of January 2010 to Janurary 2016. The diagnosis of suprarenal gland enlargement was set by ultrasound examination performed on the 4th postnatal day as an overall screening test. Newborns with positive laboratory screening on congenital adrenal hyperplasia (CAH) were excluded from our study. We analyzed the origin of surarenal gland enlargement, gestation week on the due date, the birth weight and other comorbidities and genetic pathologies in newborns with the enlarged suprarenal glands., Results: There were 6 newborns followed up due to suprarenal gland enlargement. All of the patients had diagnosed the adrenal haemorrhage. Adrenal lesions like adrenal cysts or neuroblastomas were not confirmed. All of the adrenal enlargements were benign with no need of other medical or surgical intervention. None of the newborn patients had other genetic abnormalities, mineral or hormonal imbalances, problems with arterial pressure or haemodynamic instability. All of the patients underwent at least 5 prenatal ultrasound tests and at least 2 postnatal ultrasound measurements. The avarage birth weight was 3030 grams (2700 grams - to 3750 grams). The avarage birth lenght was 50 cm (47 centimeter to 53 cm).The average gestation week (gw) on due date was 39 gw. 85% from the patients were born on 40 gw, 15% on 39 gw., Conclusion: We didn't confirm the relation between the suprarenal gland enlargement and the preterm birth (≤ 34 weeks' gestation). In the period of 6 years we didn't find a newborn patient with the prenatal diagnosis of suprarenal gland enlargement. The adrenal gland enlargement didn't have a relation with the low gestation birth, weight, length or the preterm birth.

Adrenal cortical hyperplasia manifests radiologically as a non-malignant growth, or enlargement, of the adrenal glands, specifically the cortex, although the cortex cannot be definitively identified by conventional imaging. Controlled by the pituitary gland, the adrenal cortex drives critical processes, such as the production of cortisol, mineralocorticoid and sex hormones. Any disruption in the multiple enzymes and hormones involved in these pathways may cause serious or life-threatening symptoms, often associated with anatomical changes in the adrenal glands. Diagnosis and treatment of adrenal cortical hyperplasia requires a thorough clinical evaluation. As imaging has become more robust so has its role in the diagnosis and treatment of adrenal conditions. CT has been the primary modality for adrenal imaging owing to reproducibility, temporal and spatial resolution and broad access. MRI serves a complimentary role in adrenal imaging and can be used to further evaluate indeterminate CT findings or serve as an adjunct tool without the use of ionizing radiation. Ultrasound and fluoroscopy (genitography) are most commonly used in children and foetuses to evaluate congenital adrenal hyperplasia. This article will discuss the clinical presentation, laboratory workup and imaging features of adrenal cortical hyperplasia, both congenital and acquired.

Background: Patients with congenital adrenal hyperplasia (CAH) are at risk of vascular and metabolic complications due to steroid therapy and increased adrenal androgens exposure., Objective: of the study was to evaluate the relation between patient's genotype and (1) intima media thickness of abdominal aorta (AIMT) and common carotid arteries (CIMT) and (2) metabolic profile., Material and Methods: In 71 patients (27 boys) aged from 1.5 to 17.9 years, with 21-hydroxylase deficiency (21OHD) CAH: 9 with nonclassic (NC) CAH, 62 with classic CAH: 10 with simple virilising (SV) and 52 with salt wasting (SW) CAH (13-Del/Del, 8-Del/I2G, 7-I2G/I2G and 24-other genotypes), and in 77 lean and 36 normotensive obese, age and gender matched controls, assessment of CIMT and AIMT as well as hormonal and biochemical evaluation were performed., Results: The highest AIMT was observed in SW Del/Del and I2G/I2G groups and the highest CIMT in SV CAH subgroup. CIMT and AIMT correlated significantly with testosterone and free androgen index (FAI), and were significantly higher in patients with advanced bone age and obesity independent. Significantly higher HOMA, testosterone and FAI values were found in SV CAH., Conclusion: In CAH patients CIMT and AIMT are influenced by androgens and obesity independent. In the examined group vascular and metabolic abnormalities are pronounced more in certain subgroups of CAH (SV and SW: Del/Del) and in patients with advanced bone age.

Objective: Discuss exciting new research in the area of adrenal disorders that has emerged in the last few years. Advances in genetics, biochemical diagnosis, and imaging modalities that have set new standards for diagnosis and treatment are described., Methods: A literature review was conducted on adrenal disorders using PubMed., Results: We highlight new developments in adrenal diseases from new genes discovered in aldosterone-producing adenomas, cortisol-producing tumors to pheochromocytomas/paragangliomas. In addition, we discuss new information regarding the question of whether nonfunctional adrenal adenomas are really functional or not. In congenital adrenal hyperplasia, emerging steroids that might be helpful in the near future for diagnostic purposes are discussed. New types of imaging are now available to identify endocrine neoplasms to help clinicians find lesions after biochemical confirmation., Conclusion: The tremendous knowledge gained thus far in adrenal diseases sets the stage for not only new precision treatment modalities for individualized care but also for prevention., Abbreviations: ACC = adrenal cortical carcinoma; APA = aldosterone-producing adenoma; APCC = aldosterone-producing cell cluster; CAH = congenital adrenal hyperplasia; CT = computed tomography; DOTATATE = [ 68 Ga]-DOTA(0)-Tyr(3)-octreotate; FDG = fluorodeoxyglucose; FH = fumarate hydratase; MR = miner-alocorticoid; MDH2 = malate dehydrogenase 2; PCC = pheochromocytoma; PET = positron emission tomography; PGL = paraganglioma; SCS = subclinical cortisol-secreting; SDHB = succinate dehydrogenase subunit B; TCGA = The Cancer Genome Atlas.

We report the case of 2 sisters (46,XX) born from consanguineous Moroccan parents. Both sisters had normal female genitalia, but within 2 weeks after birth, they presented with a severe salt-wasting crisis. Hormonal investigations suggested the diagnosis of congenital adrenal hyperplasia, which was confirmed by subsequent molecular analysis to be caused by 3β-hydroxysteroid dehydrogenase type 2 deficiency. Here, we discuss the main features like onset, possible complications, genetics, and replacement therapy of this rare disease., (© 2017 S. Karger AG, Basel.)

A variable spectrum of urogenital malformations exists in girls with congenital adrenal hyperplasia (CAH). The vagina may enter the urethra at a variable level, and relations to the sphincter complex vary accordingly. Furthermore, an enlarged clitoris and variations in the bladder sphincter anatomy can be found. Endoscopy, genitography or magnetic resonance imaging (MRI) are commonly used for the assessment of these anomalies, and to provide information for counselling and treatment. When surgery is planned, introitoplasty cosmetical reduction of the clitoris and labioplasty are discussed with the families; introitoplasty is the most demanding aspect. In order to plan the most appropriate surgical approach, the entrance level of the vagina into the urethra and its relation to the bladder sphincter must be known. Thus, imaging has an important role in CAH. The imaging techniques mentioned above require sedation, anaesthesia or involve ionizing radiation of the gonads and, thus, are relatively invasive. It would therefore be highly desirable to have a minimally invasive and accurate technique that provides images of the individual anatomic situation. The present paper describes experience with perineal ultrasound in the initial imaging evaluation of girls with CAH. Ultrasound findings were compared to the results of endoscopy that was performed before surgery. From 2006 to 2012, 11 girls had perineal ultrasound and endoscopy. Measurements of clinical relevance for introitoplasty were: the length of the urogenital sinus, the distance to the vaginal opening into the urogenital sinus, and the length of the bladder neck. This retrospective analysis showed that the entrance point of the vagina into the urogenital sinus could be identified in 10 of 11 girls. In some cases, the correlation of endoscopic and ultrasound data showed a correlation between endoscopic and sonographic findings. The length of the bladder neck and the length of the urogenital sinus could be measured by ultrasound in 10 of 11 girls, and were subsequently confirmed by endoscopy. This showed, for the first time, that perineal ultrasound could provide the information required for surgical correction of the urogenital sinus anomaly in CAH. Advantages of these techniques are the minimal invasiveness and wide availability. Because long-term problems are not uncommon, perineal ultrasound may also be of value during follow-up. Widespread use of this technique has the potential to reduce costs and morbidity associated with endoscopy and genitography., (Copyright © 2016. Published by Elsevier Ltd.)

Background: This study aimed to clarify the characteristics of acute encephalopathic episodes in patients with congenital adrenal hyperplasia (CAH), which we termed "CAH-associated encephalopathy (CAHE).", Methods: This retrospective study was conducted using a questionnaire as a nationwide survey of patients with CAH with acute encephalopathy and related episodes., Results: Fifteen patients were recruited on the bases of clinical data that supported a diagnosis of CAHE. Fourteen patients displayed seizures at onset, and 12 patients exhibited refractory seizures. Deep coma lasting >24h was noted in 12 patients. Neuroimaging studies revealed some heterogeneous features. Diffuse or focal edematous lesions in the cerebrum, which produce high signal intensity on diffusion-weighted magnetic resonance imaging or low density on computer tomography, were found in the acute period in all 15 patients. In the chronic period, 14 patients survived, 11 of whom had some degree of neurological sequelae. Moreover, various degrees of cerebral shrinkage were observed in 11 of 14 surviving patients. Surprisingly, there were no abnormal neuroimaging findings in the basal ganglia, brainstem, and cerebellum in any patient., Conclusion: Our results indicated that patients with CAH have a risk of developing CAHE, and thus, they should be followed closely because not only status epilepticus or deep coma but also minor symptoms, such as fever and nausea, may lead to CAHE. Because CAHE may feature some heterogeneous encephalopathic episodes, further validation is needed to clarify its etiology., (Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.)

Purpose: Women with congenital adrenal hyperplasia (CAH) may develop a virilized voice due to late diagnosis or suboptimal suppression of adrenal androgens. Changes in the vocal folds due to virilization have not been studied in vivo. The purpose was to investigate if the thyroarytenoid (TA) muscle is affected by virilization and correlate findings to fundamental frequency (F0)., Method: A case-control study using magnetic resonance imaging and voice recordings. Four women with CAH with virilized voices (26-40 years), and 5 female and 4 male controls participated. Measurements of cross-sectional TA muscle area, vocal fold length, vocal tract length, and acoustic analyses of F0 were performed., Results: Women with CAH had larger cross-sectional TA muscle area than female control subjects and smaller than male controls. A significant negative correlation was found between TA muscle area and mean F0. The patients had a smaller physiological voice range than both female and male controls., Conclusion: Data from our small study suggest that a larger TA muscle area is strongly associated with a lower F0 and thus the anatomical explanation for a female virilized voice, suggesting an androgen effect on the vocal folds. The findings from the present study need to be confirmed in a larger study.

A 6½ years Indian boy was brought by his parents, who were anxious about the excessive increase in the size of the boy's phallus, from the age of 2 years. On physical examination, the child had a penis length greater than the 97th centile for age, a sexual maturity rating of gonads at stage 2 and pubic hair at stage 3, with height in the high normal range (90-97th centile). The bone age was 12 years. Laboratory evaluation showed pubertal levels of testosterone and pubertal gonadotropin response to stimulation, confirming central precocious puberty (CPP). Incidentally, the hormonal profile also suggested congenital adrenal hyperplasia (CAH). This case report depicts a case of CPP probably caused by CAH in boys, which is rare., (2016 BMJ Publishing Group Ltd.)

Idiopathic hyperaldosteronism (IHA) due to bilateral adrenal hyperplasia is the most common subtype of primary aldosteronism (PA). The pathogenesis of IHA is still unknown, but the bilateral disease suggests a potential predisposing genetic alteration. Heterozygous germline mutations of armadillo repeat containing 5 (ARMC5) have been shown to be associated with hypercortisolism due to sporadic primary bilateral macronodular adrenal hyperplasia and are also observed in African-American PA patients. We investigated the presence of germline ARMC5 mutations in a group of PA patients who had bilateral computed tomography-detectable adrenal alterations. We sequenced the entire coding region of ARMC5 and all intron/exon boundaries in 39 patients (37 Caucasians and 2 black Africans) with confirmed PA (8 unilateral, 27 bilateral and 4 undetermined subtype) and bilateral adrenal lesions. We identified 11 common variants, 5 rare variants with a minor allele frequency <1% and 2 new variants not previously reported in public databases. We did not detect by in silico analysis any ARMC5 sequence variations that were predicted to alter protein function. In conclusion, ARMC5 mutations are not present in a fairly large series of Caucasian patients with PA associated to bilateral adrenal disease. Further studies are required to definitively clarify the role of ARMC5 in the pathogenesis of adrenal nodules and aldosterone excess in patients with PA.

Objective: Individuals with primary adrenal insufficiency (PAI) or congenital adrenal hyperplasia (CAH) receive life-long glucocorticoid (GC) replacement therapy. Current daily GC doses are still higher than the reported adrenal cortisol production rate. This GC excess could result in long-term morbidities such as osteoporosis. No prospective trials have investigated the long-term effect of GC dose changes in PAI and CAH patients., Methods: This is a prospective and longitudinal study including 57 subjects with PAI (42 women) and 33 with CAH (21 women). Bone mineral density (BMD) was measured by dual energy X-ray absorptiometry at baseline and after 2 years. Subjects were divided into three groups (similar baseline characteristics) depending on changes in daily hydrocortisone equivalent dose (group 1: unchanged 25.2±8.2  mg (mean±S.D., n=50); group 2: increased 18.7±10.3 to 25.9±12.0  mg (n=13); group 3: decreased 30.8±8.5 to 21.4±7.2  mg (n=27))., Results: Subjects in group 1 showed normal lumbar and femoral Z-scores which were unchanged over time. Group 2 subjects showed a significant decrease in femoral neck Z-scores over time (-0.15±1.1 to -0.37±1.0 (P<0.05)), whereas group 3 subjects showed a significant increase in lumbar spine and hip Z-scores (L1-L4: -0.93±1.2 to -0.65±1.5 (P<0.05); total hip: -0.40±1.0 to -0.28±1.0 (P<0.05)). No changes in BMI over time were seen within any group. Reduction in GC dose did not increase the risk of adrenal crisis., Conclusion: This study demonstrates for the first time that cautious reduction in hydrocortisone equivalent doses leads to increases in BMD, whereas dose increments reduced BMD. These data emphasize the need for the lowest possible GC replacement dose in AI patients to maintain health and avoid long-term adverse effects., (© 2016 European Society of Endocrinology.)

Primary pigmented nodular adrenocortical disease (PPNAD) is a rare type of bilateral adrenal hyperplasia leading to hypercortisolemia. Adrenal nodularity is often appreciable with computed tomography (CT); however, accurate radiologic characterization of adrenal size in PPNAD has not been studied well. We used 3-dimensional (3D) volumetric analysis to characterize and compare adrenal size in PPNAD patients, with and without Cushing's syndrome (CS). Patients diagnosed with PPNAD and their family members with known mutations in PRKAR1A were screened. CT scans were used to create 3D models of each adrenal. Criteria for biochemical diagnosis of CS included loss of diurnal variation and/or elevated midnight cortisol levels, and paradoxical increase in urinary free cortisol and/or urinary 17-hydroxysteroids after dexamethasone administration. Forty-five patients with PPNAD (24 females, 27.8±17.6 years) and 8 controls (19±3 years) were evaluated. 3D volumetric modeling of adrenal glands was performed in all. Thirty-eight patients out of 45 (84.4%) had CS. Their mean adrenal volume was 8.1 cc±4.1, 7.2 cc±4.5 (p=0.643) for non-CS, and 8.0cc±1.6 for controls. Mean values were corrected for body surface area; 4.7 cc/kg/m(2)±2.2 for CS, and 3.9 cc/kg/m(2)±1.3 for non-CS (p=0.189). Adrenal volume and midnight cortisol in both groups was positively correlated, r=0.35, p=0.03. We conclude that adrenal volume measured by 3D CT in patients with PPNAD and CS was similar to those without CS, confirming empirical CT imaging-based observations. However, the association between adrenal volume and midnight cortisol levels may be used as a marker of who among patients with PPNAD may develop CS, something that routine CT cannot do., (© Georg Thieme Verlag KG Stuttgart · New York.)

Objective: Increased arterial intima-media thickness has been observed in adults with congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency (21-OHD). CAH has also been associated with obesity, insulin resistance, and hypertension. The aim of the present study was to compare youths with CAH with healthy, normal-weight individuals, evaluating carotid intima-media thickness (CIMT) and indicative factors of cardiovascular risk to seek for abnormalities in the CAH group., Subjects and Methods: Clinical, biochemical, and ultrasonographic evaluations, according to published criteria, were performed in 113 subjects (5 to 20 years old): 40 patients with 21-OHD and 73 healthy individuals matched for gender, pubertal status, and age., Results: Most CAH patients were female (80%), salt-losers (72.5%), and pubescent (80%); 10 (25%) patients were overweight. An increase in CIMT was observed both on the right (p = 0.0240) and left (p = 0.0003) sides in 38 CAH patients compared with the healthy individuals. The body mass index, BMI/age Z score, and systolic blood pressure (SBP) were higher in patients compared with controls (p < 0.000 and p = 0.0219, respectively)., Conclusions: Findings of increased CIMT, BMI, and SBP in young patients with 21-OHD indicate the need for early identification and intervention regarding cardiovascular risk. Validating these findings might result in improved therapeutic approaches for children with 21-OHD in the future.

Objectives: Computed tomography (CT) and magnetic resonance imaging (MRI) are the main imaging modalities used for analysis of adrenal lesions. We compared the ability of CT and MRI to detect and characterize benign adrenal lesions., Patients and Methods: Unenhanced abdominal CT and MRI were performed in 16 patients (age range 39-77), and reviewed by a radiologist with 6years of experience in abdominal imaging. The presence, number, size and structure of each mass were analyzed and compared between the two modalities., Results: There were 18 adrenal masses in 11 patients, four patients had adrenal hyperplasia (AH), whereas one patient had left-sided AH and right-sided adenoma. Ten masses were≥2cm in diameter, and were perfectly depicted using CT and all MRI techniques. There were nine masses with diameter<2cm detected by CT, three of them were missed using MRI. AH was detected in five patients using CT, but its mild form was missed in one patient using MRI. Four masses with attenuation values of>10Hounsfield units could not be characterized using unenhanced CT, but three of them were characterized using MRI., Conclusion: CT has higher sensitivity for detection of small adrenal tumours and adrenal hyperplasia than MRI. MRI is an important tool in characterization of adrenal masses that could not be characterized using unenhanced CT., (Copyright © 2015 Elsevier Masson SAS. All rights reserved.)

Congenital adrenal hyperplasia (CAH) is an autossomic recessive disorder caused by impaired steroidogenesis. Patients with CAH may present adrenal insufficiency with or without salt-wasting, as well as various degrees of virilization and fertility impairment, carrying a high incidence of testicular adrenal rest tumors and increased incidence of adrenal tumors. The diagnosis of CAH is made based on the adrenocortical profile hormonal evaluation and genotyping, in selected cases. Follow-up is mainly based on hormonal and clinical evaluation. Utility of imaging in this clinical setting may be helpful for the diagnosis, management, and follow-up of the patients, although recommendations according to most guidelines are weak when present. Thus, the authors aimed to conduct a narrative synthesis of how imaging can help in the management of patients with CAH, especially focused on genitography, ultrasonography, computed tomography, and magnetic resonance imaging.

Introduction: The relationship between the washout pattern and constituent cell in adrenal hyperplasia (AH) has not been fully investigated. The purpose of this study was to elucidate the radiological or pathological factors determining the washout pattern of AH on dynamic CT., Methods: Ten patients with 14 surgically proven AHs were enrolled. Dynamic CT was scanned before (pre-contrast image) and 60 seconds (early phase) and 240 seconds (delayed phase) after administration of iodine contrast. The absolute percentage washout (APW) of each nodular lesion was calculated using the following formula: APW(%) = (TAearly-TAdelay)/(TAearly-TApre) × 100, when TApre, TAearly and TAdelay were defined as tumour attenuation values of pre-contrast, early and delayed phases, respectively. Pathologically, the clear cell ratio (CCR) constituting each nodular lesion was qualitatively assessed. Regression analysis was performed to evaluate a correlation between each pair of CCR, TApre, (TAearly-TAdelay) and APW., Results: There was a significant correlation between each pair of CCR, TApre and APW. CCR decreased as TApre increased (r = 0.81, P < 0.001). APW increased as CCR decreased (r = 0.80, P < 0.001) or as TApre increased (r = 0.74, P < 0.01)., Conclusions: The key factors of washout pattern of AH on dynamic CT were CCR and TApre. The difference in constituent cell was associated with variability in APW of AH., (© 2014 The Royal Australian and New Zealand College of Radiologists.)

Purpose: Patients with congenital adrenal hyperplasia (CAH) are at increased risk for cardiovascular disease due to many factors. The aim of this study is to investigate the presence of dyslipidemia, insulin resistance, and subclinical atherosclerosis as indicated by carotid intima media thickness in children with congenital adrenal hyperplasia., Methods: Thirty-two children with congenital adrenal hyperplasia (3-17 years) were compared with 32 healthy controls. All underwent anthropometric evaluation, measurement of fasting lipids, glucose, insulin, oral glucose tolerance test (OGTT), homeostasis model assessment for insulin resistance (HOMA-IR), and carotid intima media thickness (CIMT)., Results: Fasting glucose, glucose at 30, 60, 90, and 120 min during OGTT were significantly higher in patients. HOMA-IR was also significantly higher in patients (p = 0.036). Patients had significantly higher CIMT (p = 0.003), and higher systolic blood pressure. (p = 0.04). No significant difference existed in lipid profile. Both systolic and diastolic blood pressures correlated with treatment duration (p = 0.002, p = 0.043, respectively)., Conclusion: Children with CAH are at increased risk of insulin resistance, glucose intolerance, early atherosclerosis, and cardiovascular disease. Screening of these patients at an early age is recommended.