Search

An electrochemical sensor for the detection of uric acid was constructed using cobalt oxide-modified porous carbon@multi-walled carbon nanotube (MWCNTs) composite material for the modification of the electrode. Firstly, ZIF-67 is generated on carbon nanotubes using the surfactant cetylammonium bromide (CTAB) as template. The vesicles generated by CTAB act as nucleation sites for the in situ growth of ZIF-67. Then, cobalt oxide-modified porous carbon was obtained after high-temperature carbonization of ZIF-67, leading to the formation of cobalt oxide-modified porous carbon@MWCNT composite materials. Co-N and Co-O active sites on the composite material can improve the oxidation of uric acid on the electrode surface, leading to enhanced sensitivity and selectivity for uric acid detection. The sensor has a good linear range from 1 to 40 μM for uric acid detection with a detection limit of 0.09 μM. The sensor was utilized for determination of uric acid in actual serum samples. [ABSTRACT FROM AUTHOR]

Smart and precise sensing is very important for the protection of both environment and personal security in modern civilized society. There are numerous sensing devices for detecting physical and chemical changes such as temperature, humidity, pressure, and chemical species. In this regard, conducting polymers is at the core of attention for the fabrication of next-generation sensor applications. Polypyrrole (PPy), is one of the emerging intelligent materials with a wide range of applications in the field of optical, electronic, and electrochromic devices and sensors. The stability in a different environment, ease of deposition from aqueous and non-aqueous media, adherence to diverse substrates, and high electrical conductivity made PPy a unique choice for sensor development. In recent years, PPy has proven an excellent candidate for sensing volatile organic compounds (VOCs) due to its selectivity and sensitivity towards target gas molecules, and detection of inorganic gases and VOCs. Consequently, to develop outstanding sensing devices attempts have been dedicated to developing PPy-based sensors for excellent mechanical and electrochemical performance. This review aims to provide a recent overview of progress in PPy-based advanced sensing devices. This review aims to provide a recent overview of progress in PPy-based advanced sensing devices. We have systematically discussed the challenges and future development of various sensing devices. Furthermore, the current understanding and performance evaluation of gas sensing mechanisms in PPy-based sensors are discussed theoretically and experimentally. We have also identified gaps in the state-of-the-art and hope that this study would lead to further research works into using PPy to make gas sensors. Finally, the future directions of various sensors with advanced PPy-based sensing systems have been prospected. [Display omitted] • Polypyrrole (PPy) was an excellent candidate for capturing a broad range of VOCs. • Doping, surface modification, side-chain selection, and PPy-chain-arrangements were reported. • The complementary roles of experimental and theoretical studies were clearly described. • Reported families of PPy and their current utilities were elaborated. • Gaps were identified both from fundamental and applied standpoints. [ABSTRACT FROM AUTHOR]

Abstract: A facile method for the preparation of ferrocene (FC) loaded porous polyelectrolyte nanoparticles (FC-PPN) using CaCO3 as template was reported. Polyelectrolyte, ferrocene and CaCO3 nanoparticles were dispersed in ethanol/water solution. After the evaporation of solution under stirring, the FC-PPN was prepared with the polyelectrolyte layer adsorbed onto CaCO3 surface during the solution evaporation process, and FC encapsulated within the polyelectrolyte framework. The resulted FC-PPN showed high FC loading and good stability. Sensitive electrochemical immunosensor for the detection of oral cancer biomarker interleukin-6 (IL-6) using this FC-PPN as label was prepared. Using the redox current of FC as signal, the immunosensor displays high sensitivity, wide linear range (0.002–20ng/mL), low detection limit (1pg/mL) and good reproducibility. In addition, this porous nanoparticle preparation method could be extended to the incorporation of different interesting materials onto nanoparticles and find wide applications in various areas, such as bioassay, drug delivery and catalysis. [Copyright &y& Elsevier]

Abstract: Quantum dot (QD) functionalized graphene sheets (GS) were prepared and used as labels for the preparation of sandwich-type electrochemical immunosensors for the detection of a cancer biomarker (i.e., prostate specific antigen (PSA)). The primary anti-PSA antibody was also immobilized onto the GS. The immunosensor displayed a wide range of linear response (0.005–10ng/mL), low detection limit (3pg/mL), and good reproducibility, selectivity and stability. The immunosensor was used to detect PSA in patient serum samples with satisfactory results. Thus, this unique immunosensor may provide many applications in clinical diagnosis. [Copyright &y& Elsevier]

Abstract: The synergistic effect between graphene sheet (GS) and cobalt hexacyanoferrate nanoparticle (CoNP) was investigated, and showed that the electroactivity of CoNP was greatly enhanced in the presence of GS due to great electron-transfer ability of GS. A label-free electrochemical immunosensor for the sensitive detection of prostate specific antigen (PSA) was fabricated. Molecule 1-pyrenebutanoic acid, succinimidyl ester (PBSE) was adsorbed onto GS and the colloidal solution containing GS–CoNP–PBSE was added onto glassy carbon electrode surface to form stable thin film with high electroactivity. After anti-PSA antibody was conjugated onto PBSE, the modified electrode could be used as an amperometric immunosensor for the detection of PSA. The specific antibody–antigen immunocomplex formed on the electrode resulted in the decrease of amperometric signal of the electrode. The amperometric signal decreased linearly with PSA concentration in the range of 0.02–2ng/mL with a low detection limit of 0.01ng/mL. The immunosensor has the advantages of high sensitivity, good selectivity and stability, and could become a promising technique for cancer marker detection. [Copyright &y& Elsevier]

Abstract: Platinum nanowires (PtNWs) prepared by electrodeposition method with the help of porous anodic aluminum oxide (AAO) templates have been solubilized in chitosan (CHIT) together with carbon nantubes (CNTs) to form a PtNW–CNT–CHIT organic–inorganic system. The resulting PtNW–CNT–CHIT material brings capabilities for utilizing synergic action of PtNWs and CNTs to facilitate electron-transfer process in electrochemical sensor design. The PtNW–CNT–CHIT film modified electrode offered a significant decrease in the overvoltage for the hydrogen peroxide and showed to be excellent amperometric sensors for hydrogen peroxide at −0.1V over a wide range of concentrations, and the sensitivity is 260μAmM−1 cm−2. As an application example, by linking glucose oxidase (GOx), an amplified biosensor toward glucose was prepared. The glucose biosensor exhibits a selective determination of glucose at −0.1V with a linear response range of 5×10−6 to 1.5×10−2 M with a correlation coefficient of 0.997, and response time <10s. The high sensitivity of the glucose biosensor is up to 30μAmM−1 cm−2 and the detection limit was 3μM. The biosensor displays rapid response and expanded linear response range, and excellent repeatability and stability. [Copyright &y& Elsevier]

An ultra-sensitive photoelectrochemical (PEC) sensor based on perovskite composite was developed for the determination of alkaline phosphatase (ALP) in human serum. In contrast to CsPbBr3 or Y6 that generated anodic current, the heterojunction of CsPbBr3/Y6 promoted photocarriers to separate and generated cathodic photocurrent. Ascorbic acid (AA) was produced by ALP hydrolyzing L-ascorbic acid 2-phosphate trisodium salt (AAP), which can combine with the holes on the photoelectrode surface, accelerating the transmission of photogenerated carriers, leading to enhanced photocurrent intensity. Thus, the enhancement of PEC current was linked to ALP activity. The PEC sensor exhibits good sensitivity for detection of ALP owing to the unique photoelectric properties of the CsPbBr3/Y6 heterojunction. The detection limit of the sensor was 0.012 U·L−1 with a linear dynamic range of 0.02–2000 U·L−1. Therefore, this PEC sensing platform shows great potential for the development of different PEC sensors. [ABSTRACT FROM AUTHOR]

Graphene@MXene composite nanomaterials were utilized to construct an electrochemical sensor for alanine aminotransferase (ALT) detection. The combination of graphene nanosheets with MXene avoids the self-stacking of MXene and graphene, and broadens the charge transfer channel. In addition, the composite nanomaterial provides increased loading sites for pyruvate oxidase. The principle of ALT detection is a two-step enzymatic reaction. l-Alanine was initially transferred to pyruvate catalyzed by ALT. The formed pyruvate was then oxidized by pyruvate oxidase, generating H2O2. Through the detection of the generated H2O2, ALT activity was measured. The linear range of the sensor to ALT was from 5 to 400 U·L−1 with a detection limit of 0.16 U·L−1 (S/N = 3). For real sample analysis, the spiked recovery test results of ALT in serum samples were between 96.89 and 103.93% with RSD < 5%, confirming the reliability of the sensor testing results and potential clinical application of the sensor. [ABSTRACT FROM AUTHOR]

In this work, a simple and sensitive electrochemical sensor was proposed for the detection of β-site amyloid precursor protein cleaving enzyme 1 (BACE1) activity. Firstly, the BACE1 specific peptide was modified onto the Au electrode to graft a single-strand DNA with polycytosine DNA sequence (dC12) via amide bonding between peptide and dC12. Because the dC12 is abundant in phosphate groups, thus it can react with molybdate to form redox molybdophosphate, which can generate electrochemical current. Using BACE1 as a model peptidase, the proposed sensor shows a linear response range from 1 to 15 U/mL and limit of detection down to 0.05 U/mL. The sensor displays good performance for the BACE1 activity detection in human serum samples, which may have potential applications in the clinical diagnostics of Alzheimer's disease. [ABSTRACT FROM AUTHOR]

A polycytosine DNA-based immunosensor for electrochemical detection was developed and tested for detection of human epidermal growth factor receptor 2 (HER2), a breast cancer biomarker. We utilized gold nanoparticles (AuNPs) as supporting matrix to immobilize polycytosine DNA sequence (dC20) for electrochemical current generation and anti-HER2 antibodies. In the presence of target HER2, a sandwiched immunocomplex forms between a peptide specific to HER2 immobilized on the gold electrode and the anti-HER2 antibodies on the AuNPs. The HER2 captured by the sensor is detected because of the reaction of the dC20 phosphate backbone with molybdate, forming redox molybdophosphate precipitate that generates an electrochemical current on the surface of the electrode. The assay is sensitive: the calculated limit of detection of HER2 was as low as 0.5 pg/mL and the detection was linear to HER2 from 1 pg/mL to 1 ng/mL. The sensor's specificity is high, and there is no cross reactivity with several potential interferents, such as human IgG, human IgA, p53, carcinoembryonic antigen, and protein kinase. The sensor's performance with HER2 in clinical serum samples is similar to the performance of commercial ELISA assays. The configuration of polycytosine DNA as electrochemical current generating label and anti-HER2 antibodies on AuNPs is versatile and can be reconfigured to detect low levels of different analytes, or made more sensitive by amplifying the DNA to produce more phosphate to react with Na2MoO4. [ABSTRACT FROM AUTHOR]

• Electrochemical sensor for the detection of uric acid in serum was reported. • Platinum nanoparticles were synthesized within the porous structure of ZIF-8. • ZIF-8 was carbonized to form platinum nanoparticles modified porous carbon. • The modified porous carbon was able to detect uric acid selectively and sensitively. In this study, we prepared an electrochemical sensor for the detection of uric acid (UA) in serum. Platinum nanoparticles (PtNPs) were synthesized within the porous structure of ZIF-8 and the nanocomposite was then carbonized at high temperatures to improve the adhesion rate of PtNPs in porous carbon. The synthesized materials were characterized by scanning electron microscopy and transmission electron microscopy. The sensor was able to detect uric acid in serum sensitively with good selectivity and stability. [ABSTRACT FROM AUTHOR]

Abstract: Ferrocene (Fc) functionalized self-assembled peptide nanowire (Fc-PNW) was synthesized, functionalized and used as label for the fabrication of electrochemical immunosensors to detect substance P (SP). To prepare the label, gold nanoparticles (AuNPs) were immobilized onto the Fc-PNW for the following adsorption of horseradish peroxidase (HRP) and secondary anti-SP antibody (Ab2, Fc-PNW-HRP-Ab2). The role of Fc-PNW in the electrochemical label was not only as supporting matrix for HRP and Ab2, but also as the mediator for HRP to enhance the sensitivity of HRP toward H2O2 detection. The immunosensor was fabricated based on the traditional sandwich protocol with primary anti-SP antibody (Ab1) immobilized onto graphene surface. The catalytic current of HRP toward H2O2 in the presence of mediator Fc was used as signal of the immunosensor. Different parameters, such as the weight ratio of HRP to Ab2 on the Fc-PNW and the antibody–antigen incubation time were optimized to improve the performance of the immunosensor. The resulting immunosensor has high sensitivity, wide linear range (0.01–50ng/mL) and low detection limit (5pg/mL). [Copyright &y& Elsevier]

Abstract: A new electrochemical immunosensor for the detection of protein biomarker platelet-derived growth factor BB (PDGF-BB) was developed based on graphene oxide (GO) initiated silver enhancement. The immunosensor was fabricated based on the traditional sandwich protocol using secondary anti-PDGF-BB antibody (Ab2) modified GO as label. Gold electrode was first modified with self-assembled monolayer (SAM) to block the electron transfer between the electrode and K3Fe(CN)6 solution. After the immobilization of primary anti-PDGF-BB antibody (Ab1) onto electrode via aminidation to the carboxylic group of SAM and the formation of the sandwich immuno-structure onto electrode surface, the electrode was immersed into silver enhancement solution for silver deposition. The deposited metal silver onto GO then mediated electron transfer across the SAM, producing redox current. The resulting immunosensor displays a wide range of linear response, low detection limit, good reproducibility and stability. The immunosensor was used to the detection of PDGF-BB contents in serum samples with satisfactory results. [Copyright &y& Elsevier]

• Electrochemical sensor for detecting circulating tumor cells is reported. • Fe 3 O 4 magnetic nanospheres were utilized to capture MCF-7 cell. • LiFePO 4 particles were chosen as electrochemical label. • Electrochemical signals are generated by reaction of LiFePO 4 with molybdate. • The sensor was applied for detection of tumor cells in blood sample. In this study, we reported an electrochemical assay for detecting circulating tumor cells (CTCs) in whole blood. Breast cancer cell MCF-7 was chosen as a model for study. Fe 3 O 4 magnetic nanospheres (MNs) modified with anti-epithelial cell adhesion molecule (EpCAM) antibody were utilized to capture MCF-7 from samples and gold nanoparticles modified LiFePO 4 (LiFePO 4 /Au) particles were chosen as electrochemical label. Aptamer can be linked onto LiFePO 4 /Au via Au-S bond, and then the LiFePO 4 /Au-aptamer complex can specifically bind to the MUC1 protein that is over-expressed on the cell surface of MCF-7. Electrochemical signals are generated by the reaction of phosphate in LiFePO 4 with molybdate to form redox molybdophosphate. The utilization of LiFePO 4 for signal probe may expand the application of LiFePO 4 in biosensing fields. [ABSTRACT FROM AUTHOR]

The authors describe a dual signal amplification strategy for improving the sensitivity of electrochemical aptasensor. Hydroxyapatite nanoparticles (HAP-NPs) serve as the support for deposition of the respective aptamer. Both the HAP-NPs and the aptamer contain phosphate groups which can react with molybdate to form a redox-active molybdophosphate precipitate on the surface of a glassy carbon electrode (GCE). On applying a relatively low voltage of 0.21 V (vs. Ag/AgCl), a current is generated whose intensity depends on the concentration of the analyte. The cancer biomarker platelet-derived growth factor BB (PDGF-BB) is chosen as a model antigen (analyte). The assay works by sequential deposition of antibody against PDGF-BB, analyte (PDGF-BB) and anti-PDGF-BB aptamer modified HAP-NPs on the GCE to form a sandwich structure. The amperometric signal is linear in the 0.1 pg.mL to 10 ng.mL PDGF-BB concentration range, with a detection limit as low as 50 fg.mL. The assay was successfully applied to the determination of PDGF-BB in serum samples. In our perception, this signal amplification strategy has a wide scope in that it can be adapted to the preparation of other aptasensors for biomarkers and related species. [ABSTRACT FROM AUTHOR]

We have developed a new DNA self-assembly amplification technology that generates electric current for electrochemical biosensing. The new technology was used for detection of human epidermal growth factor receptor 2 (HER2). In our technology, an aptamer was utilized both as a ligand for recognition and as a signal generating reporter. The aptasensor is based on a sandwich format and a DNA primer on a HER2 aptamer initiates auxiliary DNA self-assembled on the electrode to form a long one-dimensional DNA. The resulting DNA is then reacted with molybdate to generate electrochemical current. The sensitivity of the aptasensor with DNA self- assembly was greater than that of the aptasensor without DNA self-assembly due to the extended length of the DNA strand. Aptasensor analysis of HER2 in serum of breast cancer patients and healthy individuals is highly correlated (R² = 0.9924) with ELISA measurements, with a p value of 1.37 x 10-7. The analysis of HER2 in serum (confirmed by ELISA) suggests that HER2 levels in breast cancer patients are much higher than healthy individuals. For HER2 positive patients, the levels are higher than those of HER2 negative patients. After surgery, there is a drop of HER2 levels in serum, suggesting potential clinical applications of the new self-assembled DNA electric current generating biosensor. Unlike proteins, DNA is easily amplifiable. The DNA signal amplification method presented here enables effective current generation, which can find wide range of biomedical applications for protein detection. [ABSTRACT FROM AUTHOR]

Protein kinase (PKA) and alkaline phosphatase (ALP) are clinically relevant enzymes for a number of diseases. In this work, we developed a new simple electrochemical biosensor for the detection of the activity and inhibition of both PKA and ALP. One common feature of the PKA and ALP catalyzing process is that PKA can hydrolysis adenosine-5′-triphosphate (ATP) and ALP can hydrolysis pyrophosphate, both reactions produce phosphate ions, and the amount of phosphate ion produced is proportional to enzyme activity. Our assay is based on the principle that phosphate ions react with molybdate to form redox molybdophosphate precipitates on the electrode surface, thus generating electrochemical current. The detection limit for PKA and ALP were much lower than existing assays. The biosensor has good specificity and was used to measure drug-stimulated PKA from lysates of HeLa cells. We also evaluated the use of the biosensor as a screening tool for enzyme inhibitors. To the best of our knowledge, this is the first report of a biosensor capable of detecting the activity of both PKA and ALP. This tool has the potential to simplify PKA and ALP clinical measurement, thereby improving diagnostics of relevant diseases. It also may serve as the basis for a simple screening method for new enzyme inhibitors for disease treatment. [ABSTRACT FROM AUTHOR]

An electrochemical immunoassay is described for the detection of the protein biomarker mucin 1 (MUC-1) and of breast cancer cells of type MCF-7 where MUC-1 is overexpressed. The method is based on the use of silver nanoclusters (Ag-NCs) acting as a signalling probe. The Ag-NCs were synthesized via chemical reduction in the presence of a DNA strand with the sequence of 5′-GCAGTTGATCCTTTGGATACCCTGG-C-3′. The strand contains mucin 1 aptamer (GCAGTTGATCCTTTGGATACCCTGG) that can specifically bind to MUC1 and the template (C) for synthesis of Ag-NCs. The assay involves the following steps: (1) Construction of an immunosensor by immobilizing the antibody against MUC-1 on a glassy carbon electrode; (2) addition of sample containing MUC-1; (3) addition of Ag-NCs; (4) signal amplification via silver enhancement process (deposition of metal silver on Ag-NCs); (5) measurement via square wave voltammetry. The current measured at a potential of 0.11 V (vs. SCE) is logarithmically related to the concentration of MUC-1 in the 1 to 500 nM range, with a detection limit of 0.5 nM. We also demonstrate that MCF-7 cancer cells can be detected by this method with high sensitivity (50 cells per mL) due to the presence of MUC-1 proteins on the cell surface. [Figure not available: see fulltext.] [ABSTRACT FROM AUTHOR]

Bimetallic Pd–Au cluster was synthesized through a direct chemical reduction method and utilized for the fabrication of electrochemical sensing platform. Scanning electron microscopy (SEM) characterization indicated the obtained Pd–Au cluster displays branch-type structure that composed of nanowires. As a demonstration of the application of the sensing platform, the performance of the platform toward non-enzymatic electrochemical detection of glucose was studied. Analytical results show improved activity of the Pd–Au cluster toward glucose oxidation with high sensitivity, wide linear range and good stability. When the electrode was used for the detection of glucose in blood samples, the glucose contents detected by the electrode was in good agreement with those from the hospital. The proposed electrochemical sensing platform can certainly be expanded to the fabrication of other kinds of electrochemical sensors and biosensors. [ABSTRACT FROM AUTHOR]

Abstract: A simple and novel supramolecular hydrogel was prepared from ferrocene (Fc) modified amino acid phenylalanine (F) and utilized as electrochemical immunosensing platform for the detection of human IgG. Scanning electron microscopy (SEM) characterization indicated that the hydrogel is composed of fibrils with diameter around 50–100nm and length extend to 1mm. When the prepared hydrogel was reacted with H2O2, the Fc moieties on the amino acid was oxidized, leading to the disruption of the hydrogel structure and the decrease of its redox signal, which was characterized in detail by SEM and the electrochemical method. Regarding the redox current decrease upon the reaction of the hydrogel with H2O2, the hydrogel modified electrode was utilized as immunosensing interface. After the construction of the immunosensor based on the traditional sandwich protocol with glucose oxidase (GOx) functionalized carbon nanotube (CNT) as detection antibody label, the GOx attached onto electrode surface would catalyze glucose reaction to produce H2O2 and cause the decrease of redox current of the electrode. The current change is proportional to the concentration of IgG detected in the range from 0.1 to 100pg/mL. The high sensitivity, wide linear range and good reproducibility of the immunosensor indicate this immunosensing platform can be easily extended to the detection of other protein biomarkers. [Copyright &y& Elsevier]

A ferrocence (Fc)-tagged peptide comprising the phenylalanine–phenylalanine (Phe–Phe) sequence was synthesized and allowed to self-assemble into uniform nanowires with a diameter of ca. 100nm and lengths in the range of 5–10µm. The Fc-tagged peptide nanowire (Fc-PNW) become well dispersed in aqueous solution when coated with poly(diallyldimethylammonium chloride) (PDDA). Gold nanoparticles (AuNPs) and antibody molecules can then be adsorbed onto the Fc-PNW surface. The resultant antibody modified Fc-PNW was explored as a detection probe for sensitive electrochemical immunosensing in a sandwich assay wherein the capture antibody was attached onto a graphene/gold nanoparticle (AuNPs–GN) composite film. The as prepared electrochemical immunosensor possesses a low detection limit (5fg/mL) for human IgG and a wide linear range encompassing four orders of magnitude (from 10fg/mL to 100pg/mL). Such a low detection limit stems from the significant signal amplification by the large number of Fc moieties on the PNW (for a 5-µm-long Fc-PNW, the number of Fc moieties is 5×105). The electrochemical immunosensor is also highly selective and the sensor was demonstrated to be amenable to real sample analysis. [ABSTRACT FROM AUTHOR]

Abstract: Multiplexed electrochemical immunosensor was developed for ultrasensitive detection of interleukin-6 (IL-6) and interleukin-17 (IL-17) using electrochemical tag incorporated polystyrene sphere (PS) as label. The electrochemical tag contained in the PS, cadmium ion (Cd2+) or ferrocene (Fc), could be effectively detected by square wave voltammetry (SWV) after dissolving the PS with organic solvent to release the electrochemical tags onto electrode surface. With the immobilization of two different antibodies onto the PS surface, respectively, the position and intensity of the current peaks due to the two electrochemical tags could reflect the identity and level of the corresponding protein biomarkers. The significant amount of electrochemical tags incorporated into PS greatly enhanced the detection sensitivity. The proposed immunoassay exhibited high sensitivity and good selectivity for the detection of IL-6 and IL-17. The response current was linear to the logarithm concentrations of IL-6 and IL-17 in the range from 1pg/mL to1ng/mL and 2pg/mL to 1ng/mL, respectively. The detection limits of IL-6 and IL-17 were 0.5 and 1pg/mL (S/N=3). These results suggested that this electrochemical immunosensor would be widely applied for clinical screening of protein biomarkers. [Copyright &y& Elsevier]

Abstract: Sensitive electrochemical immunosensor for the detection of interleukin-17 (IL-17) was prepared using cadmium (Cd2+) ion incorporated polystyrene sphere (PS, PS–Cd2+) as label. With the linking of the detection anti-IL-17 antibody (Ab2) onto PS (PS–Cd2+–Ab2), the modified PS can be captured onto the electrode surface through immuno-reaction. Tetrahydrofuran (THF) was then dropped onto the electrode surface to dissolve the PS and release the contained Cd2+ ions onto electrode surface for the following stripping voltammetric detection. Compared to the electrochemical label based on quantum dots (QD), this method for the detection of Cd2+ ion is much simpler and straightforward. With the immobilization of primary anti-IL-17 antibody (Ab1) onto graphene surface, the resulting immunosensor displays high sensitivity, which can be ascribed to the significant number of Cd2+ ions incorporated into PS and a large number of Ab2 linked onto PS surface. The response current was linear to the logarithm of IL-17 concentration in the range from 0.1pg to 1ng/mL with a detection limit of 50fg/mL. The immunosensor results were validated through the detection of IL-17 in serum samples with satisfactory results. [Copyright &y& Elsevier]

Abstract: A novel kind of hydrogel was prepared from ferrocene (Fc) functionalized amino acid phenylalanine (Phe) and applied for the fabrication of electrochemical immunosensor to detect tumor necrosis factor α (TNF-α). The prepared hydrogel displays high redox activity due to the incorporation of a significant number of Fc moieties into the hydrogel. When the hydrogel was reacted with ascorbic acid (AA), the redox activity of the hydrogel was decreased as the Fc moieties in the hydrogel were reduced by AA. Based on this phenomenon, the immunosensor was constructed utilizing the traditional sandwich format using the hydrogel modified electrode as sensing platform and alkaline phosphatase (ALP) modified polystyrene sphere (PS) as label. First, primary anti-TNF-α antibody was immobilized onto the electrode surface via gold nanoparticles (AuNPs), then TNF-α and ALP were sequentially captured onto electrode. The ALP captured onto the electrode will catalyzes the hydrolysis of ascorbic acid 2-phosphate (AA-p) to form AA. The latter, in return, will cause the decrease of the redox current of the electrode. The decrease of the redox current is proportional to the concentration of TNF-α detected in the range from 1pg/mL to 10ng/mL. The immunosensor testing results were validated through the detection of clinical serum sample with satisfactory results. [Copyright &y& Elsevier]

Abstract: Sensitive electrochemical immunosensor for the detection of protein biomarker tumor necrosis factor α (TNF-α) was reported that uses ferrocene carboxylic acid (Fc) functionalized self-assembled peptide nanowire (Fc-PNW) as sensor platform and glucose oxidase (GOx) modified gold nanorod (GNR) as label. Greatly enhanced sensitivity is achieved based on a dual signal amplification strategy: first, the synthesized Fc-PNW used as the sensor platform increased the loading of primary anti-TNF-α antibody (Ab1) onto electrode surface due to its large surface area. At the same time, the Fc moiety on the nanowire is used as a mediator for GOx to catalyze the glucose reaction. Second, multiple GOx and secondary anti-TNF-α antibody (Ab2) molecules are bounded onto each GNR to increase the sensitivity of the immunosensor. After the preparation of the immunosensor based on the traditional sandwich protocol, the response of the immunosensor towards glucose was used as a signal to differentiate various concentrations of TNF-α. The resulting immunosensor has high sensitivity, wide linear range (0.005–10ng/mL) and good selectivity. This immunosensor preparation strategy is a promising platform for clinical screening of protein biomarkers. [Copyright &y& Elsevier]

Abstract: A label-free amperometric immunosensor based on graphene sheet(GS)-nafion(Nf)/thionine(TH)/Pt nanoparticles modified electrode is proposed for the ultrasensitive detection of kanamycin. The anti-kanamycin antibody was immobilised onto the GS-Nf/TH/Pt modified glassy carbon electrode (GCE) through electrostatic adsorption. TH was selected as an electron transfer mediator, and the synergistic effects among GS, TH and Pt were investigated. The electroactivity of TH was greatly improved in the presence of GS and Pt due to their good electron-transfer ability. The proposed immunosensor shows good performance such as low detection limit (5.74pg/mL), wide linear range (from 0.01 to 12.0ng/mL), high stability, and good selectivity in the detection of kanamycin. The reliability of the developed immunosensor was proved by determination of kanamycin in animal derived foods with satisfactory results. [Copyright &y& Elsevier]

Abstract: In this paper, thionine was electro-polymerized onto the surface of carbon nanotube (CNT)-modified glassy carbon (GC) to fabricate the polythionine (PTH)/CNT/GC electrode. It was found that the electro-reduction current of nitrite was enhanced greatly at the PTH/CNT/GC electrode. It may be demonstrated that PTH was used as a mediator for electrocatalytic reduction of nitrite, and CNTs as an excellent nanomaterial can improve the electron transfer between the electrode and nitrite. Therefore, based on the synergic effect of PTH and CNTs, the PTH/CNT/GC electrode was employed to detect nitrite, and the high sensitivity of 5.81μAmM−1, and the detection limit of 1.4×10−6 M were obtained. Besides, the modified electrode showed an inherent stability, fast response time, and good anti-interference ability. These suggested that the PTH/CNT/GC electrode was favorable and reliable for the detection of nitrite. [Copyright &y& Elsevier]

Abstract: A novel electrochemical aptasensor involving quantum dots-coated silica nanospheres (QDs/Si) and the screen-printed gold electrodes (SPGE) was developed for the detection of thrombin. The screen-printed electrodes with several advantages, including low cost, versatility, miniaturization, and mechanical regeneration after each measurement cycle, were employed. On the other hand, the gold nanoparticles (AuNPs) were electrodeposited on the surface of SPGE to obtain AuNPs/SPGE. And this sandwich format (Apt/thrombin/Apt–QDs/Si) was fixed on the AuNPs/SPGE to fabricate the electrochemical aptasensor. The bound CdTe QDs were dissolved in an acid-dissolution step and were detected by electrochemical stripping analysis. The proposed aptasensor has excellent performance such as high sensitivity, good selectivity and analytical application in real samples. The combination of nanoparticles with the screen-printed electrode is favorable for amplifying electrochemical signals, and useful for large-scale fabrication of the electrochemical aptasensors, which would lay a potential foundation for the development of the electrochemical aptasensor. [Copyright &y& Elsevier]

Abstract: Ultrasensitive electrochemical immunosensor for the detection of tumor necrosis factor-α (TNF-α) was reported based on Prussian Blue (PB) functionalized ceria nanoparticles (PB-CeO2) as label. To prepare PB-CeO2, CeO2 was first coated with a positively charged chitosan (CS) layer to adsorb negatively charged Fe(CN)6 3−. Then, with the addition of FeCl2, PB nanoparticles were synthesized within the CS layer on the CeO2 surface. The synthesized PB-CeO2 was found to have high sensitivity toward H2O2 detection. Secondary anti-TNF-α antibody (Ab2) was cross-linked to the PB-CeO2 through glutaraldehyde to obtain the label (PB-CeO2-Ab2). The electrochemical immunosensor for the detection of TNF-α was constructed based on the traditional sandwich structure with the immobilization of primary anti-TNF-α antibody (Ab1) onto gold nanoparticles (AuNPs) modified carbon nanotube (CNT) surface. With the response of the immunosensor toward 1mM H2O2 as signal, the proposed immunosensor has wide linear range (0.005–5ng/mL) and low detection limit (2pg/mL) to TNF-α. The proposed immunosensor preparation strategy successfully demonstrated a simple, sensitive and specific method that can be expanded to the detection of other proteins. [Copyright &y& Elsevier]

Abstract: Pd nanorod array modified sol–gel silica thin film was prepared by electro-deposition method. In solution containing silica precursor and surfactant, the film can be self-assembled onto the electrode surface under a suitable potential. The synthesized silica film was composed of mesopore channels that were oriented perpendicular to the electrode surface. If PdCl2 solution was added into the above precursor, the mesopore channels can be used as template for the growth of Pd nanorod array. The structure of the film was characterized by scanning electron microscopy (SEM). The electrocatalytic activity of the thin film was investigated for the detection of different important compounds, such as glucose, dopamine (DA) and uric acid (UA). Experimental results demonstrated that the modified electrode could achieve non-enzymatic detection of glucose, as well as the simultaneously detection of DA and UA in the mixture that contains ascorbic acid (AA), UA and DA. [Copyright &y& Elsevier]

Abstract: A sandwich electrochemical immunosensor for the sensitive determination of alpha fetoprotein (AFP) has been fabricated. Prussian blue modified hydroxyapatite (PB@HAP) was firstly prepared and used as electrochemical label due to the wonderful conductivity and good biocompatibility of HAP. The results proved that the immunosensor fabricated using the label based on PB@HAP loaded with horse radish peroxidase (HRP) and secondary anti-AFP antibody (Ab2) (PB@HAP-HRP-Ab2) had high sensitivity, and the sensitivity of the label PB@HAP-HRP-Ab2 was much higher than labels of PB@HAP-Ab2, PB-HRP-Ab2 and HAP-HRP-Ab2. The mixture of graphene sheet (GS) and thionine (TH) was not only used to immobilize anti-AFP antibody (Ab1) but also took part in the signal amplification. The amperometric signal increased linearly with AFP concentration in the range of 0.02–8ng/mL with a low detection limit of 9pg/mL. The immunosensor had the advantages of high sensitivity, good selectivity and good stability, and was applied to the analysis of AFP in serum sample with satisfactory results. Due to the low-cost and easy synthesis of PB@HAP, the screen-printed electrodes could be used instead of the bare glass carbon electrode in order to achieve mass production. In addition, it had potential application in the detection of other tumor markers. [Copyright &y& Elsevier]

Abstract: Ultrasensitive sandwich type electrochemical immunosensors for the detection of cancer biomarker prostate specific antigen (PSA) is described which uses graphene sheet (GS) sensor platform and ferrocene functionalized iron oxide (Fe3O4) as label. To fabricate the labels, dopamine (DA) was first anchored onto Fe3O4 surface followed by conjugating ferrocene monocarboxylic acid (FC) and secondary-antibody (Ab2) onto Fe3O4 through the amino groups of DA (DA-Fe3O4-FC-Ab2). The great amount of DA molecules anchored onto Fe3O4 surface increased the immobilization of FC and Ab2 onto the Fe3O4 nanoparticle, which in turn increased the sensitivity of the immunosensor. GS used as biosensor platform increased the surface area to capture a great amount of primary antibodies (Ab1) and the good conductivity of GS enhanced the detection sensitivity to FC. Using the redox current of FC as signal, the immunosensor displays high sensitivity, wide linear range (0.01–40ng/mL), low detection limit (2pg/mL), good reproducibility and stability. In addition, this method could be extended to the immobilization of other interesting materials (fluorescence dyes) onto Fe3O4 for preparing various kinds of labels to meet the different requirements in immunoassays. [Copyright &y& Elsevier]

Abstract: A novel electrochemical immunosensor for sensitive detection of cancer biomarker prostate specific antigen (PSA) based on nitrodopamine (NDA) functionalized iron oxide nanoparticles (NDA–Fe3O4) is described. NDA–Fe3O4 was used both for the immobilization of primary anti-PSA antibody (Ab1) and as secondary anti-PSA antibody (Ab2) label. For the preparation of the label, mediator thionine (TH) was first conjugated onto NDA–Fe3O4 based on the amino groups of NDA, and then the amino group of TH was used to immobilize horseradish peroxidase (HRP) and Ab2. Due to the high amount of NDA anchored onto Fe3O4 surface, the loading of antibodies as well as mediator and enzyme onto NDA–Fe3O4 was substantially increased, which increased the sensitivity of the immunosensor. The resulting immunosensor displayed a wide range of linear response (0.005–50ng/mL), low detection limit (4pg/mL), good reproducibility and stability. The immunosensor was used to detect the PSA contents in serum samples with satisfactory results. [ABSTRACT FROM AUTHOR]

Abstract: Norethisterone is one kind of widely used anabolic steroid hormones which can help to promote livestock growth and sometime has been illegally used for livestock breeding. The residues of norethisterone in animal food will harm people''s health, therefore, it has been banned to use for the growth promotion purposes in livestock. In this study, amino-group functionalized mesoporous silica nanoparticles (MSN) were prepared and used to immobilize Au nanoparticles, which was further utilized for the adsorption of horseradish peroxidase (HRP) and the secondary antibody (Ab2). The resulting nanoparticles, Au-MSN-HRP-Ab2 were used as labels for immunosensors to detect norethisterone antigen. A sandwich-type protocol was used to prepare the immunosensor with the primary antibody (Ab1) immobilized onto thionine (TH) and graphene sheet (GS) modified glassy carbon electrode surface. The sensitivity of the sandwich-type immunosensor using Au-MSN-HRP-Ab2 as labels for norethisterone antigen detection was much higher than that using either Au-MSN-Ab2 or MSN-HRP-Ab2 as labels. Within norethisterone concentration range (0.01–10ng/mL), a linear calibration plot (Y =0.55671+8.27101X, r =0.9993) was obtained with a detection limit of 3.58pg/mL under optimal conditions. The proposed immunosensor shows good reproducibility, selectivity, and acceptable stability. This new type of labels for immunosensors may provide many potential applications for the detection of growth hormone in animal derived food. [Copyright &y& Elsevier]

Molecularly imprinted electrochemical sensor for ascorbic acid detection was prepared based on MXene modified glassy carbon electrode. • Molecularly imprinted electrochemical sensor detection was prepared. • MXene was utilized to modify glassy carbon electrode. • Mxene with layered structure was prepared by chemical etching method. • O-phenylenediamine was electrochemically polymerized onto MXene modified electrode. • The imprinted polymer provides binding sites for target analytes. Molecularly imprinted electrochemical sensor for ascorbic acid (AA) detection was prepared based on MXene modified glassy carbon electrode (MIPs/MXene/GCE). MXene with layered structure was synthesized by chemical etching method and the o-phenylenediamine (o-PD) polymer was electrochemically polymerized onto MXene modified electrode surface. With the binding of AA molecules onto electrode, the current response of the sensor was decreased. Under the optimized experimental conditions, the current response change of the sensor was in linear with the concentration of AA in the range from 0.5 μM to 10 μM with detection limit of 0.27 μM. The sensor has good selectivity, which was applied to the determination of AA in vitamin C tablets. [ABSTRACT FROM AUTHOR]

This study reports on a simple approach for the fabrication of an electrode modified with biocompatible C-dot wrapped ZnO nanoparticles for selective photoelectrochemical monitoring of H2O2 released from living cells. The biocompatibility of the ZnO nanoparticles was confirmed through in-vitro cellular testing using the MTT assay on Huh7 cell lines. The ZnO nanoparticles wrapped with dopamine-derived C-dots possess numerous catalytically active sites, excessive surface defects, good electrical conductivity, and efficient separation ability of photo-induced electrons and holes. These properties offer highly sensitive and selective non-enzymatic photo-electrochemical monitoring of H2O2 released from HeLa cells after stimulation with N-formylmethionyl-leucyl-phenylalanine. The sensor has a wide linear range (20-800 nM), low detection limit (2.4 nM), and reliable reproducibility, this implying its suitability for biological and biomedical applications.Schematic of the fabrication of ZnO nanoparticles by using a plant extract as a reducing agent. Wrapping of ZnO with C-dots enhances the photoelectrocatalytic efficacy. Sensitive and selective photoelectrochemical monitoring of H2O2 released from cancer cells is demonstrated. [ABSTRACT FROM AUTHOR]

An ultrasensitive electrochemical sensor is described for the determination of the activity of telomerase. It is based on a DNA-generated current that is due to the reaction of the phosphate groups on DNA with molybdate to form a redox-active molybdophosphate. A telomerase substrate primer was first immobilized on a gold electrode. In the presence of telomerase and deoxyribonucleoside triphosphates (dNTPs), the primer can be extended with repetitive nucleotide sequences (TTAGGG). The subsequent reaction of the sensor with molybdate results in the enhancement of electrochemical current intensity due to an increased amount of nucleotides on the electrode. Sensitivity can be further improved by introducing a hairpin probe that partially hybridizes with the repetitive TTAGGG sequence and further enhances the amount of DNA on the electrode. The biosensor, best operated at 0.2 V (vs. Ag/AgCl) shows a linear response to telomerase activity from 1×102 to 107 Hela cells mL−1. The assay was applied to the detection of telomerase activity in HeLa cancer cells treated with the anticancer drug epigallocatechin gallate, and the results indicate that it holds great potential in anticancer drug screening.Schematic presentation of an ultrasensitive electrochemical sensor for the determination of telomerase activity based on DNA generated electrochemical current. dNTPs in the scheme represents deoxyribonucleoside triphosphates. [ABSTRACT FROM AUTHOR]

The authors describe a sensitive electrochemical immunoassay for the cancer biomarker α-fetoprotein (AFP). It is based on a combination of an immunoassay with DNA-based signal amplification. Two-dimensional MnO2 nanosheets modified with gold nanoclusters (AuNC-MnO2) were synthesized through one-pot process and utilized as an electrochemical probe. Bovine serum albumin served as templating agent to guide the formation and assembly of the modified sheets. The detection antibody against AFP and a polycytosine DNA sequence (dC20) were immobilized onto the modified nanosheets. The electrochemical assay follows the usual sandwich protocol. The antibodies on the nanosheets then bind to AFP, while dC20 causes signal amplification. The reaction of the phosphate backbone of dC20 with molybdate leads to the formation of redox-active molybdophosphate which generates an electrochemical current, typically measured at 0.20 V (vs. Ag/AgCl). The method allows AFP to be determined in the 0.01 to 10 ng·mL−1 concentration range, and the detection limit is as low as 5 pg·mL−1. This strategy overcomes the drawbacks of conventional immunoassays whose sensitivity is often limited because many immunoassays are rather difficult to amplify. The method has a wide scope in that various other DNA signal amplification methods such as rolling circle amplification and hybridization chain reactions may also be applied.Schematic of an electrochemical immunosensor for the detection of alpha fetoprotein (AFP) by combining an antibody based immunoassay with DNA based signal amplification utilizing gold clusters anchored 2D MnO2 (Au NCs-MnO2) nanosheets as electrochemical probe. [ABSTRACT FROM AUTHOR]