13 results on '"Turini, Thomas"'
Search Results
2. Multi-location evaluation of cantaloupe (Cucumis melo L.) cultivars for their aroma and flavor related volatile composition using a metabolomics approach
- Author
-
Metrani, Rita, Singh, Jashbir, Jayaprakasha, G.K., Crosby, Kevin M., Jifon, John L., Ravishankar, Sadhana, Brierley, Paul E., Leskovar, Daniel I., Turini, Thomas A., Schultheis, Jonathan, Coolong, Timothy, Guan, Wenjing, and Patil, Bhimanagouda S.
- Published
- 2023
- Full Text
- View/download PDF
3. Development of an IPM Strategy for Thrips and Tomato spotted wilt virus in Processing Tomatoes in the Central Valley of California.
- Author
-
Batuman, Ozgur, Turini, Thomas A, LeStrange, Michelle, Stoddard, Scott, Miyao, Gene, Aegerter, Brenna J, Chen, Li-Fang, McRoberts, Neil, Ullman, Diane E, and Gilbertson, Robert L
- Subjects
Frankliniella occidentalis ,Orthotospovirus ,Solanum lycopersicum ,epidemiology and integrated pest management ,inoculum sources ,tomato spotted wilt disease ,western flower thrips ,Immunology ,Medical Microbiology - Abstract
Tomato spotted wilt virus (TSWV; species Tomato spotted wilt orthotospovirus; genus Orthotospovirus; family Tospoviridae) is a thrips-transmitted virus that can cause substantial economic losses to many crops, including tomato (Solanum lycopersicum). Since 2005, TSWV emerged as an economically important virus of processing tomatoes in the Central Valley of California, in part due to increased populations of the primary thrips vector, western flower thrips (WFT; Frankliniella occidentalis). To develop an understanding of the epidemiology of TSWV in this region, population densities of WFT and incidence of TSWV were monitored in California's processing tomato transplant-producing greenhouses and associated open fields from 2007 to 2013. Thrips were monitored with yellow sticky cards and in tomato flowers, whereas TSWV incidence was assessed with indicator plants and field surveys for virus symptoms. All thrips identified from processing tomato fields were WFT, and females were three-fold more abundant on sticky cards than males. Symptoms of TSWV infection were observed in all monitored processing tomato fields. Incidences of TSWV ranged from 1 to 20%, with highest incidence found in late-planted fields. There was no single primary inoculum source, and inoculum sources for thrips/TSWV varied depending on the production region. These results allowed us to develop a model for TSWV infection of processing tomatoes in the Central Valley of California. The model predicts that low levels of primary TSWV inoculum are amplified in early-planted tomatoes and other susceptible crops leading to highest levels of infection in later-planted fields, especially those with high thrips populations. Based upon these findings, an integrated pest management (IPM) strategy for TSWV in processing tomatoes in California was devised. This IPM strategy focuses on strategic field placement (identification of high-risk situations), planting TSWV- and thrips-free transplants, planting resistant varieties, monitoring for TSWV symptoms and thrips, roguing infected plants, thrips management targeting early generations, extensive sanitation after harvest, and strategic cropping to avoid overlap with winter bridge crops.
- Published
- 2020
4. Profiling carotenoid and sugar contents in unique Cucumis melo L. cultigens harvested from different climatic regions of the United States
- Author
-
Singh, Jashbir, Metrani, Rita, Jayaprakasha, G.K., Crosby, Kevin M., Jifon, John L., Ravishankar, Sadhana, Brierley, Paul, Leskovar, Daniel L., Turini, Thomas A., Schultheis, Jonathan, Coolong, Timothy, Guan, Wenjing, and Patil, Bhimanagouda S.
- Published
- 2022
- Full Text
- View/download PDF
5. Bacterial diversity and composition on the rinds of specific melon cultivars and hybrids from across different growing regions in the United States.
- Author
-
Goforth, Madison, Obergh, Victoria, Park, Richard, Porchas, Martin, Crosby, Kevin M., Jifon, John L., Ravishankar, Sadhana, Brierley, Paul, Leskovar, Daniel L., Turini, Thomas A., Schultheis, Jonathan, Coolong, Timothy, Miller, Rhonda, Koiwa, Hisashi, Patil, Bhimanagouda S., Cooper, Margarethe A., Huynh, Steven, Parker, Craig T., Guan, Wenjing, and Cooper, Kerry K.
- Subjects
BACTERIAL diversity ,CULTIVARS ,MELONS ,MUSKMELON ,BACTERIAL communities ,FOOD pathogens ,BACILLACEAE - Abstract
The goal of this study was to characterize the bacterial diversity on different melon varieties grown in different regions of the US, and determine the influence that region, rind netting, and variety of melon has on the composition of the melon microbiome. Assessing the bacterial diversity of the microbiome on the melon rind can identify antagonistic and protagonistic bacteria for foodborne pathogens and spoilage organisms to improve melon safety, prolong shelf-life, and/or improve overall plant health. Bacterial community composition of melons (n = 603) grown in seven locations over a four-year period were used for 16S rRNA gene amplicon sequencing and analysis to identify bacterial diversity and constituents. Statistically significant differences in alpha diversity based on the rind netting and growing region (p < 0.01) were found among the melon samples. Principal Coordinate Analysis based on the Bray-Curtis dissimilarity distance matrix found that the melon bacterial communities clustered more by region rather than melon variety (R
2 value: 0.09 & R2 value: 0.02 respectively). Taxonomic profiling among the growing regions found Enterobacteriaceae, Bacillaceae, Microbacteriaceae, and Pseudomonadaceae present on the different melon rinds at an abundance of ≥ 0.1%, but no specific core microbiome was found for netted melons. However, a core of Pseudomonadaceae, Bacillaceae, and Exiguobacteraceae were found for non-netted melons. The results of this study indicate that bacterial diversity is driven more by the region that the melons were grown in compared to rind netting or melon type. Establishing the foundation for regional differences could improve melon safety, shelf-life, and quality as well as the consumers' health. [ABSTRACT FROM AUTHOR]- Published
- 2024
- Full Text
- View/download PDF
6. Unusual outbreaks of curly top disease in processing tomato fields in northern California in 2021 and 2022 were caused by a rare strain of beet curly top virus and facilitated by extreme weather events
- Author
-
Melgarejo, Tomas A., Cespedes, Margaret K., Chen, Li-Fang, Turini, Thomas, Lazicki, Patricia A., Vinchesi-Vahl, Amber, and Gilbertson, Robert L.
- Published
- 2024
- Full Text
- View/download PDF
7. No significant influence of biochar and manure application on nitrogen fate and sequestration by tomato and garlic crops: A field experiment in California, USA.
- Author
-
Gao, Suduan, Duan, Yinghua, Wang, Dong, and Turini, Thomas
- Subjects
FIELD crops ,BIOCHAR ,SOIL amendments ,MANURES ,ALMOND ,TOMATOES ,GARLIC - Abstract
Organic soil amendments can improve soil health but their role in improving N management has not been well quantified. The objectives of this research were to evaluate the influence of biochar and manure compost application on crop yield, N uptake, changes in soil and environmental losses and to use the information to assess the N requirement and project fertilization needs. A field experiment was conducted in California, USA, with processing tomato (Lycopersicon esculentum Mill.) grown first, followed by garlic (Allium sativum). The soil was a sandy loam with a pH of 7.2 and CEC of 9.1 cmol(+) kg−1. Treatments included two biochar products, derived from almond shell or softwood feedstocks, applied at 20 or 40 tonnes (t) ha−1, dairy manure compost at 20 t ha−1, combinations of the manure and the biochar (each at 20 t ha−1), and a control. Although biochar and manure applications improved the surface soil organic C and total N content, no significant effects on crop yield, biomass and N uptake, as well as ammonia volatilization and leaching loss, were observed. The amount of N sequestered by plants ranged from 3.2 to 3.8 and 9.9 to 10.0 kg N Mg−1 to produce fresh tomato fruits and garlic bulbs, respectively. However, about half of the N for tomato and 93% for garlic plants were removed from soil by harvesting. The N sequestered per unit biomass (or yield) production appears a stable parameter, which can be used to reliably project fertilization needs that target high NUE and minimal loss to the environment. [ABSTRACT FROM AUTHOR]
- Published
- 2022
- Full Text
- View/download PDF
8. Field Evaluation of Green and Red Leaf Lettuce Genotypes in the Imperial, San Joaquin, and Salinas Valleys of California for Heat Tolerance and Extension of the Growing Seasons.
- Author
-
Lafta, Abbas, Turini, Thomas, Sandoya, German V., and Beiquan Mou
- Subjects
- *
LETTUCE , *GENOTYPES , *GLOBAL warming , *EDIBLE greens , *PHYSIOLOGICAL effects of heat - Abstract
Global warming poses serious threats and challenges to the production of leafy vegetables. Being a cool-season crop, lettuce is particularly vulnerable to heat stress. To adapt to climate change, this study was conducted to evaluate the performance of leaf lettuce genotypes for heat tolerance by growing them in different locations within California that differ in temperatures during the growing season. Fifteen green leaf and 21 red leaf lettuce genotypes were selected to evaluate their performance under these environments. These genotypes were planted in March and May in Five Points (San Joaquin Valley) and El Centro (Imperial Valley) and in June 2012 in Salinas (Salinas Valley). The results suggest that lettuce planting can be extended from January to March beyond the normal growing seasons in San Joaquin and Imperial Valleys, where yield may be higher than in the Salinas Valley. The further delay in planting date from March to May in Five Points and El Centro resulted in reduction of yield and an increase in susceptibility to bolting and heat-related disorders such as tipburn and leaf desiccation in most genotypes. The susceptibility to these disorders depends on the genotype and the temperature during lettuce growth and maturation. However, heat-tolerant leaf lettuce genotypes adapted to these regions were identified. Results of this research should be useful for the development of heat-tolerant lettuce cultivars and for extending the growing season in warmer but lower land cost areas to reduce production costs. [ABSTRACT FROM AUTHOR]
- Published
- 2017
- Full Text
- View/download PDF
9. Impacts of deficit irrigation and organic amendments on soil microbial populations and yield of processing tomatoes.
- Author
-
Rodriguez-Ramos, Jean C., Turini, Thomas, Wang, Dong, and Hale, Lauren
- Subjects
- *
DEFICIT irrigation , *SOIL amendments , *MICROORGANISM populations , *SOIL profiles , *BIOGEOCHEMICAL cycles , *FATTY acid analysis - Abstract
Altered precipitation patterns and increased water demands from urban, industrial, and environmental needs often reduce the volume of irrigation water available for agriculture. Strategies that reduce irrigation water inputs, e.g., deficit irrigation (DI), need further evaluation to determine potential impacts on yield and soil microbial communities driving critical soil biogeochemical cycles. Whether soil organic amendments can stabilize DI effects on yield and microbial communities remains unknown. Processing tomato beds were established in a full factorial experimental design of soils unamended or amended with a one-time application—four to five years before sampling—of either biochar or biochar with compost and three irrigation regimes: full (100 % of plant water demand), or DI treatments at 75 % or 50 % of full irrigation. We profiled soil bacterial and archaeal community compositions for two growing seasons and determined soil C and N metabolic potentials and biomass of microbial groups using high throughput sequencing of 16S rRNA genes and phospholipid fatty acid analysis. We tested the discrete and interactive effects of DI and soil amendments on soil chemical and biological properties, and crop yield. DI had stronger effects on the bacterial and archaeal community composition than soil organic amendments. However, 75 % DI did not strongly affect bacterial and archaeal community composition or the total and individual biomass of microbial groups, but it increased irrigation water productivity of processing tomatoes. Although soil amendments did not stabilize the compositional shifts induced by DI, their recalcitrant C still had residual effects on the bacterial and archaeal community composition years after their incorporation. Furthermore, soil moisture correlated with bacterial and archaeal community's C and N metabolic potentials, likely augmenting the amendments' C and N residence time in DI soils. Our results provide insight into water-saving mechanisms that could increase profit margins in water-scarce years without affecting microbial populations that support plant growth and productivity. [Display omitted] • Deficit irrigation (DI) shifted microbial composition and biomass more than organic amendments. • Organic amendments did not mitigate negative effects of DI on microbial populations. • Moderate DI increased water productivity without affecting microbial communities. • DI augmented the residence time in of C and N in soils with organic amendments. [ABSTRACT FROM AUTHOR]
- Published
- 2022
- Full Text
- View/download PDF
10. Genetic Resistance to Cucurbit Leaf Crumple Virus in Melon.
- Author
-
McCreight, James D., Hsing-Yeh Liu, and Turini, Thomas A.
- Subjects
- *
SWEETPOTATO whitefly , *MUSKMELON , *DISEASES , *CUCURBITACEAE , *HEREDITY - Abstract
Cucurbit leaf crumple virus (CuLCrV) is a geminivirus transmitted by Bemisia tabaci (Gennadius) biotype B (SPW-B) and common in melons (Cucumis melo L.) planted from July through September in the desert southwestern United States. Symptoms include chlorotic leaf spots, leaf curling and crumpling, and interveinal yellowing, and plants may be stunted. Melon breeding line MR-1, and six plant introductions (PIs; PI 124111, PI 124112, PI 179901, PI 234607, PI 313970, and PI 414723) exhibited partial resistance to CuLCrV in naturally infected field tests and controlled inoculation greenhouse tests. PI 236355 was completely resistant in two greenhouse tests. Partially resistant plants exhibited chlorotic spots, or mild expression of other typical CuLCrV symptoms; all such plants were positive for presence of virus using polymerase chain reaction analysis with a CuLCrV-specific primer pair from the BC1 region. Genetic resistance to CuLCrV in melon was recessive. Field and greenhouse data from F1, F2, and backcrosses of the F1 to 'Top Mark' and PI 313970 demonstrated a single, recessive gene for resistance to CuLCrV. Progenies from crosses of four partially resistant cultigens with 'Top Mark' were susceptible. Resistance in PI 313970 appeared to be allelic, with resistance in the other six cultigens based on F1 data. The name cucurbit leaf crumple virus and symbol culcrv are proposed for this gene. [ABSTRACT FROM AUTHOR]
- Published
- 2008
- Full Text
- View/download PDF
11. Metagenome tracking biogeographic agroecology: Phytobiota of tomatoes from Virginia, Maryland, North Carolina and California.
- Author
-
Ottesen, Andrea, Ramachandran, Padmini, Reed, Elizabeth, Gu, Ganyu, Gorham, Sasha, Ducharme, Diane, Newell, Michael, Rideout, Steven, Turini, Thomas, Hill, Thomas, Strain, Errol, and Brown, Eric
- Subjects
- *
AGRICULTURAL ecology , *METAGENOMICS , *PLANT molecular biology , *PLANT diseases , *TOMATOES - Abstract
Abstract Describing baseline microbiota associated with agricultural commodities in the field is an important step towards improving our understanding of a wide range of important objectives from plant pathology and horticultural sustainability, to food safety. Environmental pressures on plants (wind, dust, drought, water, temperature) vary by geography and characterizing the impact of these variable pressures on phyllosphere microbiota will contribute to improved stewardship of fresh produce for both plant and human health. A higher resolution understanding of the incidence of human pathogens on food plants and co-occurring phytobiota using metagenomic approaches (metagenome tracking) may contribute to improved source attribution and risk assessment in cases where human pathogens become introduced to agro-ecologies. Between 1990 and 2007, as many as 1990 culture-confirmed Salmonella illnesses were linked to tomatoes from as many as 12 multistate outbreaks (Bell et al., 2012; Bell et al., 2015; Bennett et al., 2014; CDC, 2004; CDC, 2007; Greene et al., 2005a; Gruszynski et al., 2014). When possible, source attribution for these incidents revealed a biogeographic trend, most events were associated with eastern growing regions. To improve our understanding of potential biogeographically linked trends in contamination of tomatoes by Salmonella , we profiled microbiota from the surfaces of tomatoes from Virginia, Maryland, North Carolina and California. Bacterial profiles from California tomatoes were completely different than those of Maryland, Virginia and North Carolina (which were highly similar to each other). A statistically significant enrichment of Firmicutes taxa was observed in California phytobiota compared to the three eastern states. Rhizobiaceae, Sphingobacteriaceae and Xanthobacteraceae were the most abundant bacterial families associated with tomatoes grown in eastern states. These baseline metagenomic profiles of phyllosphere microbiota may contribute to improved understanding of how certain ecologies provide supportive resources for human pathogens on plants and how components of certain agro-ecologies may play a role in the introduction of human pathogens to plants. Highlights • At the time measured, bacterial profiles from the phyllosphere of California tomatoes were completely different than those of Maryland, Virginia and North Carolina (which were highly similar to each other). • As environmental pressures on plants (wind, dust, drought, water, temperature) vary by geography, it appears that risk factors for introduction of human pathogens to plants may also vary. • Describing baseline microbiota associated with agricultural commodities in the field is an important step towards improving our understanding of a wide range of important objectives from plant pathology and horticultural sustainability, to food safety. [ABSTRACT FROM AUTHOR]
- Published
- 2019
- Full Text
- View/download PDF
12. Nitrogen dynamics affected by biochar and irrigation level in an onion field.
- Author
-
Gao, Suduan, Wang, Dong, Dangi, Sadikshya R., Duan, Yinghua, Pflaum, Tom, Gartung, Jim, Qin, Ruijun, and Turini, Thomas
- Abstract
Soil amended with biochar has many potential environmental benefits, but its influence on the fate of nitrogen (N) under irrigated conditions is unclear. The objective of this research was to determine the effects of biochar and interactions with irrigation on N movement in soil, gas emissions, and leaching. A three-year study was conducted in an onion field with three main irrigation treatments (50, 75, and 100% of a reference that provided sufficient water for plant growth) and three biochar amendment rates (0 or control, low char - applied first year at 29 Mg ha−1, and high char - added both first and second year for a total 58 Mg ha−1) as sub-treatments in a split-plot design. Nitrogen fertilizer was applied three times during first year growing season, but weekly the second year. Ammonia (NH 3) volatilization, nitrous oxide (N 2 O) emission, and nitrate (NO 3 −) in soil pore water were monitored during growing season, and annual N (total and NO 3 −) changes in soil profile were determined for first two years. Nitrate leaching was measured in the third year. Ammonia volatilization was affected by fertilization frequency with higher loss (5–8% of total applied) when fertilizer was applied in large doses during the first year compared to the second year (4–5%). Nitrous oxide emissions were ≤0.1% of applied N for both years and not affected by any treatments or fertilization frequency. Nitrate concentration in soil profile increased significantly as irrigation level dropped, but most of the NO 3 − was leached by winter rain. There was no significant biochar effect on total N gas emissions or soil NO 3 − accumulation, but significant irrigation effect and interaction with biochar were determined on soil NO 3 − accumulation. High leaching was associated with biochar amendment and higher irrigation level. Irrigation strategies are the key to improving N management and developing the best practices associated with biochar. Unlabelled Image • Biochar increased soil organic carbon, pore water pH, and electrical conductivity. • Biochar had no effect on ammonia emission, nitrous oxide emission and soil nitrate. • Irrigation had a profound impact on soil nitrate accumulation and leaching. • Higher leaching is associated with soil amended with biochar. • Irrigation, not biochar, and their interaction had significant effects on yield. [ABSTRACT FROM AUTHOR]
- Published
- 2020
- Full Text
- View/download PDF
13. First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in melon in the Central Valley of California.
- Author
-
Mondal S, Jenkins Hladky LL, Fashing PL, McCreight JD, Turini TA, and Wintermantel WM
- Abstract
In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus , fam. Closteroviridae , have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus , fam. Luteoviridae ) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies ( B. tabaci ) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F - 5' AAGAGCGGCAGCTACAATAC 3', CABYV RdRp-R - 5' TGCCACATTCCGGTTCATAG 3'), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.
- Published
- 2021
- Full Text
- View/download PDF
Catalog
Discovery Service for Jio Institute Digital Library
For full access to our library's resources, please sign in.