Search

The effluents from industries processing vegetable oils are extremely rich in sulfates, often exceeding the maximum concentration allowed to release them to the environment. Biological sulfate reduction is a promising alternative for the removal of sulfates in this type of wastewater, which has other particularities such as an acidic pH. The ability to reduce sulfates has been widely described for a particular bacterial group (SRB: sulfate-reducing bacteria), although the reports describing its application for the treatment of sulfate-rich industrial wastewaters are scarce. In this work, we describe the use of a natural SRB-based consortium able to remove above 30% of sulfates in the wastewater from one of the largest edible oil industries in Peru. Metataxonomic analysis was used to analyse the interdependencies established between SRB and the native microbiota present in the wastewater samples, and the performance of the consortium was quantified for different sulfate concentrations in laboratory-scale reactors. Our results pave the way towards the use of this consortium as a low-cost, sustainable alternative for the treatment of larger volumes of wastewater coming from this type of industries.

Elderly was the most affected population during the first COVID-19 and those living in nursing homes represented the most vulnerable group, with high mortality rates, until vaccines became available. In a previous article, we presented an open-label trial showing the beneficial effect of the strain Ligilactobacillus salivarius CECT 30632 (previously known as L. salivarius MP101) on the functional and nutritional status, and on the nasal and fecal inflammatory profiles of elderly residing in a nursing home highly affected by the pandemic. The objective of this post-hoc analysis was to elucidate if there were changes in the nasal and fecal bacteriomes of a subset of these patients as a result of the administration of the strain for 4 months and, also, its impact on their fecal fatty acids profiles. Culture-based methods showed that, while L. salivarius (species level) could not be detected in any of the fecal samples at day 0, L. salivarius CECT 30632 (strain level) was present in all the recruited people at day 120. Paradoxically, the increase in the L. salivarius counts was not reflected in changes in the metataxonomic analysis of the nasal and fecal samples or in changes in the fatty acid profiles in the fecal samples of the recruited people. Overall, our results indicate that L. salivarius CECT 30632 colonized, at least temporarily, the intestinal tract of the recruited elderly and may have contributed to improvements in their functional, nutritional, and immunological status, without changing the general structure of their nasal and fecal bacteriomes when assessed at the genus level. They also suggest the ability of low abundance bacteria to train immunity.

Made available in DSpace on 2021-06-25T12:35:01Z (GMT). No. of bitstreams: 0 Previous issue date: 2021-01-15 Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) This study investigated the effects of consumption of wheat-durum pasta added of Bifidobacterium animalis inactivated by gamma-irradiation (paraprobiotic) on health and gut microbiota of rats. Twenty-one male rats were divided into three groups as follow: control (Control) receiving standard diet; pasta control (PC) receiving diet containing pasta, and paraprobiotic pasta Bifidobacterium-irradiated (PPBI), receiving paraprobiotic pasta. The serum levels of glucose and total cholesterol were reduced (p < 0.05) in PPBI when compared to the Control (p < 0.05). PPBI showed high abundance (p < 0.05) of Firmicutes and Actinobacteria and a lower abundance of Bacteriodes compared to Control and PC. Besides, the PPBI showed high abundance (p < 0.05) of Clostridiales, Lactobacillales; Bifidobacteriales, Bacillales, and Coriobacteriales in comparison to Control. Specific genera such as Bifibacterium, Lactobacillus, Ruminococcus, Allobaculum, and Blautia were more related to PPBI. Findings reveal wheat-durum pasta as a potential vehicle for delivering paraprobiotics B. animalis. Univ Estadual Campinas, Fac Food Engn, Dept Food Sci & Nutr, Rua Monteiro Lobato 80, BR-13083862 Campinas, SP, Brazil Univ Fed Paraiba, Dept Food Engn, Joao Pessoa, Paraiba, Brazil Sao Paulo State Univ, Dept Gen & Appl Biol, Inst Biosci, Rio Claro, Brazil Univ Illinois, Res Resource Ctr, Res Informat Core, Chicago, IL USA Univ Estadual Campinas, Internal Med Dept, Fac Med Sci, Campinas, Brazil Fed Univ Great Dourados, Dept Phys Educ, Dourados, MS, Brazil Sao Paulo State Univ, Dept Gen & Appl Biol, Inst Biosci, Rio Claro, Brazil CNPq: 302763/2014-7 CNPq: 305804/2017-0 CAPES: 001

9 Páginas.-- 5 Figuras.-- 2 Tablas, In this work, a total of 72 commercial table olive packages obtained from different international markets were analysed to determine their fungal biodiversity. Viable fungal counts ranged from the detection threshold (, This research was funded through the TOBE project (RTI2018-100883-B-I00, MCIU/AEI/FEDER, UE). ABC thanks to the Junta de Andalucía for his postdoctoral contract (PAIDI2020-00162). This project has received funding from the European Union's Horizon 2020 research and innovation program under grant agreement Nº 101033411. EMP thanks for the grant RYC2018-024752-I funded by MCIN/AEI/10.13039/501100011033 and FSE “El FSE invierte en tu futuro”.

Citrus is the most cultivated fruit crop worldwide. The modern citrus industry needs new bioproducts to overcome phytopathological threats, tolerate stresses and increase yield and quality. Mutualistic microbes from roots significantly impact host physiology and health and are a potentially beneficial resource. The bacterial microbiome can be surveyed to select potentially host-beneficial microbes. To achieve this goal, a prevalent “core-citrus” bacterial microbiome was obtained by picking those operational taxonomic units (OTUs) shared among samples within and across two Citrus rootstock genotypes grown in the same soil for more than 20 years. A sub-selection of main OTUs from the defined “core-citrus” microbiome was made based on abundance, host-enriched versus bulk soil, and rhizosphere-indicator species. In parallel, an extensive census of the cultivable microbiota was performed to collect a large number of bacterial citrus isolates. Metataxonomic data were linked to cultured microbes, matching 16S rRNA gene sequences from bacterial isolates with those counterpart OTU reference sequences from the selected bacterial “core-citrus” microbiome. This approach allowed selection of potentially host-beneficial bacteria to mine for agricultural probiotics in future biotechnological applications required for the citrus industry., We thank all those undergraduate students, especially the pioneer Laura Camacho, for their contribution to the large bacterial isolation, and to Felix Morán for technical support in the bacterial sequences analysis. This work was supported by grants RTA2015–00087-C2–01, AGL2017–91803-EXP and RTI2018–098379-R-I00 from Spanish Agency of Science (AEI, Spain) and co-funded by the European Social Fund to E. Marco-Noales, R. Penyalver and M.A. Forner-Giner, respectively. Part of this work was also conducted during a visiting stay of R. Penyalver at the Universidade Federal do Pampa (Unipampa), Sao Gabriel, RS. Brazil funded by the “Programa Movilidad” from AEI (Spain) PRX15/00253. We especially thank Antonio de Vicente and Carlos Pedrós-Alió for support and suggestions; and Alice Mockford and Ansley Scudder Evans for English editing.

Kopanisti is a Greek PDO cheese, which is traditionally produced by the addition of an amount of over-mature Kopanisti, called Mana Kopanisti, to initiate cheese ripening. The aim of this study was the production of four types of Kopanisti cheese (A–D) using pasteurized cow milk, and a combination of the following starters/adjuncts in order to test their ability to be used in Kopanisti cheese production: A: Lactococcus lactis subsp. lactis and Lacticaseibacillus paracasei, B: L. lactis and Lc. paracasei/Mana Kopanisti, C: L. lactis and Lc. paracasei/Ligilactobacillus acidipiscis and Loigolactobacillus rennini, D: Lig. acidipiscis and Loig. rennini. Throughout production and ripening, classical microbiological, metataxonomics and physicochemical analyses were employed, while the final products (Day 35) were subjected to sensory analysis as well. Most interestingly, beta-diversity analysis of the metataxonomics data revealed the clusters constructed among the Kopanisti types based on the different inoculation schemes. On day 35, Kopanisti A–C types clustered together due to their similar 16S microbiota, while Kopanisti D was highly differentiated. On the contrary, ITS data clustered Kopanisti B and C together, while Kopanisti A and D were grouped seperately. Finally, based on the sensory evaluation, Kopanisti C appeared to have the most suitable bacteria cocktail for the Kopanisti cheese production. Therefore, not only were the conventional starters used, but also the Lig. acidipiscis and Loig. rennini strains could be used in a standardized Kopanisti cheese production that could lead to final products of high quality and safety.

Marine sponges commonly host a repertoire of bacterial-associated organisms, which significantly contribute to their health and survival by producing several anti-predatory molecules. Many of these compounds are produced by sponge-associated bacteria and represent an incredible source of novel bioactive metabolites with biotechnological relevance. Although most investigations are focused on tropical and temperate species, to date, few studies have described the composition of microbiota hosted by Antarctic sponges and the secondary metabolites that they produce. The investigation was conducted on four sponges collected from two different sites in the framework of the XXXIV Italian National Antarctic Research Program (PNRA) in November–December 2018. Collected species were characterized as Mycale (Oxymycale) acerata, Haliclona (Rhizoniera) dancoi, Hemigellius pilosus and Microxina sarai by morphological analysis of spicules and amplification of four molecular markers. Metataxonomic analysis of these four Antarctic sponges revealed a considerable abundance of Amplicon Sequence Variants (ASVs) belonging to the phyla Proteobacteria, Bacteroidetes, Actinobacteria and Verrucomicrobia. In particular, M. (Oxymycale) acerata, displayed several genera of great interest, such as Endozoicomonas, Rubritalea, Ulvibacter, Fulvivirga and Colwellia. On the other hand, the sponges H. pilosus and H. (Rhizoniera) dancoi hosted bacteria belonging to the genera Pseudhongella, Roseobacter and Bdellovibrio, whereas M. sarai was the sole species showing some strains affiliated to the genus Polaribacter. Considering that most of the bacteria identified in the present study are known to produce valuable secondary metabolites, the four Antarctic sponges could be proposed as potential tools for the discovery of novel pharmacologically active compounds.

Background &aim: The MaPLE study was a randomized, controlled, crossover trial involving adults 60 y.o. (n ¼ 51) living in a residential care facility during an 8-week polyphenol-rich (PR)-diet. Results from the MaPLE trial showed that the PR-diet reduced the intestinal permeability (IP) in older adults by inducing changes to gut microbiota (GM). The present work aimed at studying the changes in serum metabolome in the MaPLE trial, as a further necessary step to depict the complex crosstalk between dietary polyphenols, GM, and intestinal barrier. Methods: Serum metabolome was monitored using a semi-targeted UHPLC-MS/MS analysis. Metataxonomic analysis (16S rRNA gene profiling) of GM was performed on faecal samples. Clinical characteristics and serum levels of the IP marker zonulin were linked to GM and metabolomics data in a multi-omics network. Results: Compared to the control diet, the PR-diet increased serum metabolites related to polyphenols and methylxanthine intake. Theobromine and methylxanthines, derived from cocoa and/or green tea, were positively correlated with butyrate-producing bacteria (the order Clostridiales and the genera Roseburia, Butyricicoccus and Faecalibacterium) and inversely with zonulin. A direct correlation between polyphenol metabolites hydroxyphenylpropionic acid-sulfate, 2-methylpyrogallol-sulfate and catecholsulfate with Butyricicoccus was also observed, while hydroxyphenylpropionic acid-sulfate and 2- methylpyrogallol-sulfate negatively correlated with Methanobrevibacter. The multi-omics network indicated that participant's age, baseline zonulin levels, and changes in Porphyromonadaceae abundance were the main factors driving the effects of a PR-diet on zonulin. Conclusion: Overall, these results reveal the complex relationships among polyphenols consumption, intestinal permeability, and GM composition in older adults, and they may be important when setting personalized dietary interventions for older adults. Trial registration number: ISRCTN10214981. © 2021 The Author(s). Published by Elsevier Ltd. This is an open access article under the CC BY license

The study of the food microbiome has gained considerable interest in recent years, mainly due to the wide range of applications that can be derived from the analysis of metagenomes. Among these applications, it is worth mentioning the possibility of using metagenomic analyses to determine food authenticity, to assess the microbiological safety of foods thanks to the detection and tracking of pathogens, antibiotic resistance genes and other undesirable traits, as well to identify the microorganisms responsible for food processing defects. Metataxonomics and metagenomics are currently the gold standard methodologies to explore the full potential of metagenomes in the food industry. However, there are still a number of challenges that must be solved in order to implement these methods routinely in food chain monitoring, and for the regulatory agencies to take them into account in their opinions. These challenges include the difficulties of analysing foods and food-related environments with a low microbial load, the lack of validated bioinformatics pipelines adapted to food microbiomes and the difficulty of assessing the viability of the detected microorganisms. This review summarizes the methods of microbiome analysis that have been used, so far, in foods and food-related environments, with a specific focus on those involving Next-Generation Sequencing technologies. The work in our research groups was funded by the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 818368 (MASTER), and the grants RTI2018-095021-J-I00 (funded by (MCIU/AEI/FEDER, UE), AGL2016-78085-P and AGL2016-78311-R (funded by (MINECO/AEI/FEDER, UE). Carlos Sabater acknowledges his Postdoctoral research contract funded by the Instituto de Investigación Sanitaria del Principado de Asturias (ISPA) and Postdoctoral research contract Juan de la Cierva-Formación from Spanish Ministry of Science and Innovation (FJC2019-042125-I).

The floods of 2018 caused havoc in the State of Kerala, situated in the extreme south‐west of India, in terms of infrastructure and health. This research article provides the first‐ever assessment of the bacterial diversity and its antibiotic susceptibility of the inundated areas of Pampa, Periyar and Vembanad waterbodies by comparing the data collected in two different time intervals succeeding the calamitous floods that is, immediately after flood and 5 months post‐flood. An elevated total coliform count was detected in the waterbodies after the flood thereby rendering it unsafe for drinking. Variation in bacterial diversity was observed in the river and lake water samples with a distinct increase in that of the river samples immediately after flood indicated by shannon diversity index (>5.5). Resistance to ampicillin and cefotaxime was observed in a major proportion of isolates from the three biotopes thus indicating the influence of antibiotic wastes accumulated from different sources of human interventions. Furthermore, operational taxonomic units clustering to Acinetobacter, Legionella, Pseudomonas and Burkholderia genera were detected by metataxonomic analysis which portray as a potential health risk in the future. The article emphasises the importance of adopting sanitation programmes for effective management of epidemic outbreaks post floods.

Background Vaginal microbiota (VMB) composition is altered in women with cervical intra-epithelial neoplasia (CIN) compared to healthy controls and is associated with disease progression. However, the impact of CIN excision on the VMB and innate immunity is not known. This observational study aims to explore the impact of CIN excision on the VMB, antimicrobial peptides (AMP) and proinflammatory cytokines. Methods We sampled 103 non-pregnant, premenopausal women at the time of excisional treatment for CIN and at their 6-month follow-up visit. A further 39 untreated controls with normal cytology were also sampled. We used metataxonomics to group vaginal swab samples into community state types (CSTs) and ELISA to quantify cytokine and AMP levels in matched vaginal secretions. Analyses were performed to compare the bacterial composition and immune analyte levels before and after CIN excision and in healthy controls. Results Women with CIN had significantly higher rates of Lactobacillus species depletion pre-treatment compared to healthy controls (CST IV 21/103, 20% vs 1/39, 3%, p = 0.0081). Excision did not change the VMB composition, with CST IV remaining significantly more prevalent after excision compared to untreated, healthy controls (CST IV 19/103, 20% vs 1/39, 3%, p = 0.0142). Prevotella bivia and Sneathia amnii were significantly higher in samples before treatment compared to untreated controls, and Prevotella bivia remained significantly higher amongst the treated, with less Lactobacillus crispatus compared to untreated controls. IL-1β and IL-8 remained significantly elevated pre- (p < 0.0001 and p = 0.0014, respectively) and post-treatment (p < 0.0001 and p = 0.0035, respectively) compared to untreated controls. Levels of human beta-defensin-1 and secretory leukocyte protease inhibitor were both significantly reduced following CIN excision (p < 0.0001); however, their levels remained lower than controls post-treatment. Conclusions Women with CIN have an increased prevalence of Lactobacillus sp. depletion, high-diversity VMB composition, and higher levels of proinflammatory cytokines and AMPs compared to normal controls. Surgical excision of the disease reduces levels of vaginal AMPs but does not alter VMB composition or cytokine levels. These findings suggest that women with CIN have an inherent predisposition to a high-diversity proinflammatory environment that is not corrected by disease excision. The failure to re-establish a Lactobacillus-enriched CST may explain why women remain at high risk of pre-invasive and invasive disease recurrence.

Root-feeding Amphimallon solstitiale larvae and certain other scarab beetles are the main soil-dwelling pests found in Europe, while entomopathogenic nematodes (EPN) have been used as a biocontrol agent against these species. Our study provides the first detailed characterization of the bacterial community of the midgut in wild A. solstitiale larvae, based on the nanopore sequencing of the 16S rRNA gene. In the whole dataset, we detected 2586 different genera and 11,641 species, with only 83 diverse bacterial genera shared by all studied individuals, which may represent members of the core midgut microbiota of A. solstitiale larvae. Subsequently, we compared the midgut microbiota of EPN-resistant and T0 (prior to EPN exposure) individuals, hypothesizing that resistance to this parasitic infection may be linked to the altered gut community. Compared to the control, the resistant insect microbiota demonstrated lower Shannon and Evenness indices and significant differences in the community structure. Our studies confirmed that the gut microbiota alternation is associated with resistant insects; however, there are many processes involved that can affect the bacterial community. Further research on the role of gut microbiota in insect-parasitic nematode interaction may ultimately lead to the improvement of biological control strategies in insect pest management.

Purpose To compare bacteria recovered by standard cultures and metataxonomics, particularly with regard to ventilator-associated pneumonia (VAP) pathogens, and to determine if the presence of particular bacteria or microbiota in tracheal and oropharyngeal secretions during the course of intubation was associated with the development of VAP. Methods In this case–control study, oropharyngeal secretions and endotracheal aspirate were collected daily in mechanically ventilated patients. Culture and metataxonomics (16S rRNA gene-based taxonomic profiling of bacterial communities) were performed on serial upper respiratory samples from patients with late-onset definite VAP and their respective controls. Results Metataxonomic analyses showed that a low relative abundance of Bacilli at the time of intubation in the oropharyngeal secretions was strongly associated with the subsequent development of VAP. On the day of VAP, the quantity of human and bacterial DNA in both tracheal and oropharyngeal secretions was significantly higher in patients with VAP than in matched controls with similar ventilation times. Molecular techniques identified the pathogen(s) of VAP found by culture, but also many more bacteria, classically difficult to culture, such as Mycoplasma spp. and anaerobes. Conclusions Molecular analyses of respiratory specimens identified markers associated with the development of VAP, as well as important differences in the taxa abundance between VAP and controls. Further prospective trials are needed to test the predictive value of these markers, as well as the relevance of uncultured bacteria in the pathogenesis of VAP. Electronic supplementary material The online version of this article (10.1007/s00134-019-05660-8) contains supplementary material, which is available to authorized users.

Mitigation of greenhouse gas emissions is relevant for reducing the environmental impact of ruminant production. In this study, the rumen microbiome from Holstein cows was characterized through a combination of 16S rRNA gene and shotgun metagenomic sequencing. Methane production (CH4) and dry matter intake (DMI) were individually measured over 4–6 weeks to calculate the CH4 yield (CH4y = CH4/DMI) per cow. We implemented a combination of clustering, multivariate and mixed model analyses to identify a set of operational taxonomic unit (OTU) jointly associated with CH4y and the structure of ruminal microbial communities. Three ruminotype clusters (R1, R2 and R3) were identified, and R2 was associated with higher CH4y. The taxonomic composition on R2 had lower abundance of Succinivibrionaceae and Methanosphaera, and higher abundance of Ruminococcaceae, Christensenellaceae and Lachnospiraceae. Metagenomic data confirmed the lower abundance of Succinivibrionaceae and Methanosphaera in R2 and identified genera (Fibrobacter and unclassified Bacteroidales) not highlighted by metataxonomic analysis. In addition, the functional metagenomic analysis revealed that samples classified in cluster R2 were overrepresented by genes coding for KEGG modules associated with methanogenesis, including a significant relative abundance of the methyl‐coenzyme M reductase enzyme. Based on the cluster assignment, we applied a sparse partial least‐squares discriminant analysis at the taxonomic and functional levels. In addition, we implemented a sPLS regression model using the phenotypic variation of CH4y. By combining these two approaches, we identified 86 discriminant bacterial OTUs, notably including families linked to CH4 emission such as Succinivibrionaceae, Ruminococcaceae, Christensenellaceae, Lachnospiraceae and Rikenellaceae. These selected OTUs explained 24% of the CH4y phenotypic variance, whereas the host genome contribution was ~14%. In summary, we identified rumen microbial biomarkers associated with the methane production of dairy cows; these biomarkers could be used for targeted methane‐reduction selection programmes in the dairy cattle industry provided they are heritable., Y. Ramayo‐Caldas was funded by the European Union H2020 Research and Innovation programme under Marie Skłodowska‐Curie grant (P‐Sphere) agreement no 6655919. L. Zingareti is recipient of a FPI grant to achieve the PhD research from Ministry of Economy and Science (MINECO, Spain), associated with the “Centro de Excelencia Severo Ochoa 2016–2019” award SEV‐2015‐0533 to CRAG. The authors warmly thank all technical staff at the INRA Méjusseaume farm for providing high‐quality measurements. This work was funded by APIS‐GENE and used production data obtained in the Deffilait project cofounded by APIS‐GENE and the Agence Nationale de la Recherche (ANR‐15‐CE20‐0014).

Supplemental Digital Content is available in the text, Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each

Metataxonomic analysis represents a fast and cost-effective approach for acquiring informative insight into the composition of the microbiome of samples with variable diversity, such as wine samples. Nevertheless, it comprises a vast amount of laboratory procedures and bioinformatic frameworks each one associated with an inherent variability of protocols and algorithms, respectively. As a solution to the bioinformatic maze, QIIME bioinformatic framework has incorporated benchmarked, and balanced parameters as default parameters. In the current study, metataxonomic analysis of two types of mock community standards with the same microbial composition has been performed for evaluating the effectivess of QIIME balanced default parameters on a variety of aspects related to different laboratory and bioinformatic workflows. These aspects concern NGS platforms, PCR protocols, bioinformatic pipelines, and taxonomic classification algorithms. Several qualitative performance expectations have been the outcome of the analysis, rendering the mock community a useful evaluation tool.

To compare bacteria recovered by standard cultures and metataxonomics, particularly with regard to ventilator-associated pneumonia (VAP) pathogens, and to determine if the presence of particular bacteria or microbiota in tracheal and oropharyngeal secretions during the course of intubation was associated with the development of VAP. In this case–control study, oropharyngeal secretions and endotracheal aspirate were collected daily in mechanically ventilated patients. Culture and metataxonomics (16S rRNA gene-based taxonomic profiling of bacterial communities) were performed on serial upper respiratory samples from patients with late-onset definite VAP and their respective controls. Metataxonomic analyses showed that a low relative abundance of Bacilli at the time of intubation in the oropharyngeal secretions was strongly associated with the subsequent development of VAP. On the day of VAP, the quantity of human and bacterial DNA in both tracheal and oropharyngeal secretions was significantly higher in patients with VAP than in matched controls with similar ventilation times. Molecular techniques identified the pathogen(s) of VAP found by culture, but also many more bacteria, classically difficult to culture, such as Mycoplasma spp. and anaerobes. Molecular analyses of respiratory specimens identified markers associated with the development of VAP, as well as important differences in the taxa abundance between VAP and controls. Further prospective trials are needed to test the predictive value of these markers, as well as the relevance of uncultured bacteria in the pathogenesis of VAP.

Whilst the interplay between host genetics and the environment plays a pivotal role in the aetiopathogenesis of cancer, there are other key contributors of importance as well. One such factor of central and growing interest is the contribution of the microbiota to cancer. Even though the field is only a few years old, investigation of the ‘cancer microbiome’ has already led to major advances in knowledge of the basic biology of cancer risk and progression, opened novel avenues for biomarkers and diagnostics, and given a better understanding of mechanisms underlying response to therapy. Recent developments in microbial DNA sequencing techniques (and the bioinformatics required for analysis of these datasets) have allowed much more in-depth profiling of the structure of microbial communities than was previously possible. However, for more complete assessment of the functional implications of microbial changes, there is a growing recognition of the importance of the integration of microbial profiling with other omics modalities, with metabonomics (metabolite profiling) and proteomics (protein profiling) both gaining particular recent attention. In this review, we give an overview of some of the key scientific techniques being used to unravel the role of the cancer microbiome. We have aimed to highlight practical aspects related to sample collection and preparation, choice of the modality of analysis, and examples of where different omics technologies have been complementary to each other to highlight the significance of the cancer microbiome.

Soil microbial communities’ assembly is strongly tied to changes in temperature and moisture. Although microbial functional redundancy seems to overcome taxonomical composition changes, the sensitivity and resilience of soil microbial communities from subtropical regions in response to seasonal variations are still poorly understood. Thus, the development of new strategies for biodiversity conservation and sustainable management require a complete understanding of the soil abiotic process involved in the selection of microbial taxa and functions. In this work, we used state of the art molecular methodologies (Next Generation Sequencing) to compare the taxonomic (metataxonomics) and functional (metatranscriptomics) profiles among soil samples from two subtropical natural grasslands located in the Pampa biome, Brazil, in response to short-term seasonal variations. Our data suggest that grasslands maintained a stable microbial community membership along the year with oscillation in abundance. Apparently soil microbial taxa are more susceptible to natural climatic disturbances while functions are more stable and change with less intensity along the year. Finally, our data allow us to conclude that the most abundant microbial groups and functions were shared between seasons and locations reflecting the existence of a stable taxonomical and functional core microbiota.

Fermented sausages have a long tradition originating from Europe and they constitute a significant part of the Mediterranean diet. This kind of products has a specific microbiota that is typical of the region or area where they are produced. Therefore, in order to protect the traditional aspect of these products, it is essential to understand the microbial ecology during fermentation by studying the dynamic changes that occur and to select autochthonous starter cultures that can be used in the production. In this paper we summarize the state of the art concerning the selection and use of starter cultures and ecology aspects of naturally fermented sausages. We pay particular attention to the application of bacteriocinogenic strains as they could provide an additional tool in the prevention of foodborne pathogens as well as enhancing the competitiveness of the starter organisms. Microbial ecology of fermented sausages has been determined by traditional microbiological methods, but the introduction in food microbiology of new molecular techniques complements the studies carried out so far and allows scientists to overcome the limitations of traditional methods. Next Generation Sequencing (NGS) techniques represent a change in the way microbiologists address ecology and diversity in foods. Indeed the application of metataxonomics and metagenomics will permit a detailed understanding of microbial ecology. A thorough knowledge of the mechanisms behind the biological processes will enhance meat fermentation control and modulation to obtain products with desired organoleptic properties.

Recent advances in Next-Generation Sequencing (NGS) make comparative analyses of the composition and diversity of whole microbial communities possible at a far greater depth than ever before. This brings new challenges, such as an increased dependence on computation to process these huge datasets. The demand on system resources usually requires migrating from Windows to Linux-based operating systems and prior familiarity with command-line interfaces. To overcome this barrier, we developed a fully automated and easy-to-install package as well as a complete, easy-to-follow pipeline for microbial metataxonomic analysis operating in the Windows Subsystem for Linux (WSL)—Bioinformatics Through Windows (BTW). BTW combines several open-access tools for processing marker gene data, including 16S rRNA, bringing the user from raw sequencing reads to diversity-related conclusions. It includes data quality filtering, clustering, taxonomic assignment and further statistical analyses, directly in WSL, avoiding the prior need of migrating from Windows to Linux. BTW is expected to boost the use of NGS amplicon data by facilitating rapid access to a set of bioinformatics tools for Windows users. Moreover, several Linux command line tools became more reachable, which will enhance bioinformatics accessibility to a wider range of researchers and practitioners in the life sciences and medicine. BTW is available in GitHub (https://github.com/vpylro/BTW). The package is freely available for noncommercial users.

Background: Variation in induced models of autoimmunity has been attributed to the housing environment and its effect on the gut microbiota. In Graves' disease (GD), autoantibodies to the thyrotropin receptor (TSHR) cause autoimmune hyperthyroidism. Many GD patients develop Graves' orbitopathy or ophthalmopathy (GO) characterized by orbital tissue remodeling including adipogenesis. Murine models of GD/GO would help delineate pathogenetic mechanisms, and although several have been reported, most lack reproducibility. A model comprising immunization of female BALBc mice with a TSHR expression plasmid using in vivo electroporation was reproduced in two independent laboratories. Similar orbital disease was induced in both centers, but differences were apparent (e.g., hyperthyroidism in Center 1 but not Center 2). We hypothesized a role for the gut microbiota influencing the outcome and reproducibility of induced GO.Results: We combined metataxonomics (16S rRNA gene sequencing) and traditional microbial culture of the intestinal contents from the GO murine model, to analyze the gut microbiota in the two centers. We observed significant differences in alpha and beta diversity and in the taxonomic profiles, e.g., operational taxonomic units (OTUs) from the genus Lactobacillus were more abundant in Center 2, and Bacteroides and Bifidobacterium counts were more abundant in Center 1 where we also observed a negative correlation between the OTUs of the genus Intestinimonas and TSHR autoantibodies. Traditional microbiology largely confirmed the metataxonomics data and indicated significantly higher yeast counts in Center 1 TSHR-immunized mice. We also compared the gut microbiota between immunization groups within Center 2, comprising the TSHR- or βgal control-immunized mice and naïve untreated mice. We observed a shift of the TSHR-immunized mice bacterial communities described by the beta diversity weighted Unifrac. Furthermore, we observed a significant positive correlation between the presence of Firmicutes and orbital-adipogenesis specifically in TSHR-immunized mice.Conclusions: The significant differences observed in microbiota composition from BALBc mice undergoing the same immunization protocol in comparable specific-pathogen-free (SPF) units in different centers support a role for the gut microbiota in modulating the induced response. The gut microbiota might also contribute to the heterogeneity of induced response since we report potential disease-associated microbial taxonomies and correlation with ocular disease.

International audience; Background: New generations of sequencing platforms coupled to numerous bioinformatics tools have led to rapid technological progress in metagenomics and metatranscriptomics to investigate complex microorganism communities. Nevertheless, a combination of different bioinformatic tools remains necessary to draw conclusions out of microbiota studies. Modular and user-friendly tools would greatly improve such studies. Findings: We therefore developed ASaiM, an Open-Source Galaxy-based framework dedicated to microbiota data analyses. ASaiM provides an extensive collection of tools to assemble, extract, explore, and visualize microbiota information from raw metataxonomic, metagenomic, or metatranscriptomic sequences. To guide the analyses, several customizable workflows are included and are supported by tutorials and Galaxy interactive tours, which guide users through the analyses step by step. ASaiM is implemented as a Galaxy Docker flavour. It is scalable to thousands of datasets but also can be used on a normal PC. The associated source code is available under Apache 2 license at https://github.com/ASaiM/framework and documentation can be found online (http://asaim.readthedocs.io). Conclusions: Based on the Galaxy framework, ASaiM offers a sophisticated environment with a variety of tools, workflows, documentation, and training to scientists working on complex microorganism communities. It makes analysis and exploration analyses of microbiota data easy, quick, transparent, reproducible, and shareable.

High-throughput sequencing (HTS) is becoming the state-of-the-art technology for typing of microbial isolates, especially in clinical samples. Yet, its application is still in its infancy for monitoring and outbreak investigations of foods. Here we review the published literature, covering not only bacterial but also viral and Eukaryote food pathogens, to assess the status and potential of HTS implementation to inform stakeholders, improve food safety and reduce outbreak impacts. The developments in sequencing technology and bioinformatics have outpaced the capacity to analyze and interpret the sequence data. The influence of sample processing, nucleic acid extraction and purification, harmonized protocols for generation and interpretation of data, and properly annotated and curated reference databases including non-pathogenic “natural” strains are other major obstacles to the realization of the full potential of HTS in analytical food surveillance, epidemiological and outbreak investigations, and in complementing preventive approaches for the control and management of foodborne pathogens. Despite significant obstacles, the achieved progress in capacity and broadening of the application range over the last decade is impressive and unprecedented, as illustrated with the chosen examples from the literature. Large consortia, often with broad international participation, are making coordinated efforts to cope with many of the mentioned obstacles. Further rapid progress can therefore be prospected for the next decade.

Background Variation in induced models of autoimmunity has been attributed to the housing environment and its effect on the gut microbiota. In Graves’ disease (GD), autoantibodies to the thyrotropin receptor (TSHR) cause autoimmune hyperthyroidism. Many GD patients develop Graves’ orbitopathy or ophthalmopathy (GO) characterized by orbital tissue remodeling including adipogenesis. Murine models of GD/GO would help delineate pathogenetic mechanisms, and although several have been reported, most lack reproducibility. A model comprising immunization of female BALBc mice with a TSHR expression plasmid using in vivo electroporation was reproduced in two independent laboratories. Similar orbital disease was induced in both centers, but differences were apparent (e.g., hyperthyroidism in Center 1 but not Center 2). We hypothesized a role for the gut microbiota influencing the outcome and reproducibility of induced GO. Results We combined metataxonomics (16S rRNA gene sequencing) and traditional microbial culture of the intestinal contents from the GO murine model, to analyze the gut microbiota in the two centers. We observed significant differences in alpha and beta diversity and in the taxonomic profiles, e.g., operational taxonomic units (OTUs) from the genus Lactobacillus were more abundant in Center 2, and Bacteroides and Bifidobacterium counts were more abundant in Center 1 where we also observed a negative correlation between the OTUs of the genus Intestinimonas and TSHR autoantibodies. Traditional microbiology largely confirmed the metataxonomics data and indicated significantly higher yeast counts in Center 1 TSHR-immunized mice. We also compared the gut microbiota between immunization groups within Center 2, comprising the TSHR- or βgal control-immunized mice and naïve untreated mice. We observed a shift of the TSHR-immunized mice bacterial communities described by the beta diversity weighted Unifrac. Furthermore, we observed a significant positive correlation between the presence of Firmicutes and orbital-adipogenesis specifically in TSHR-immunized mice. Conclusions The significant differences observed in microbiota composition from BALBc mice undergoing the same immunization protocol in comparable specific-pathogen-free (SPF) units in different centers support a role for the gut microbiota in modulating the induced response. The gut microbiota might also contribute to the heterogeneity of induced response since we report potential disease-associated microbial taxonomies and correlation with ocular disease. Electronic supplementary material The online version of this article (10.1186/s40168-018-0478-4) contains supplementary material, which is available to authorized users.

The composition and changes of the fungal population and of the metabolites present in grapes and in ferments of Vitis vinifera L. cv. Corvina, one of the major components of the Amarone musts, were dissected aiming at the identification of constant characteristics possibly influenced by the productive process. The fungal populations and metabolomic profiles were analyzed in three different vintages. 454-pyrosequencing on the ribosomal ITS1 region has been used to identify the fungal population present in Corvina grapes and fresh must. Samples were also subjected to metabolomics analysis measuring both free volatile compounds and glycosylated aroma precursors through an untargeted approach with comprehensive two-dimensional gas chromatography time-of-flight mass spectrometry. Albeit strongly dependent on the climate, both the mycobiota and metabolome of Corvina grapes and fresh musts show some characteristics recursive in different vintages. Such persistent characteristics are likely determined by the method adopted to produce Amarone or other dry wines made from partially dried grapes. In particular, the harsh conditions imposed by the prolonged withering appear to contribute to the shaping of the fungal populations. The fungal genera and metabolites present in different vintages in V. vinifera L. cv. Corvina grapes and fresh musts represent core components of the peculiar technique of production of Amarone. Their identification allows the in-depth understanding and improved control of the process of production of this economically and culturally relevant wine.