Search

Robotic task instructions often involve a referred object that the robot must locate (ground) within the environment. While task intent understanding is an essential part of natural language understanding, less effort is made to resolve ambiguity that may arise while grounding the task. Existing works use vision-based task grounding and ambiguity detection, suitable for a fixed view and a static robot. However, the problem magnifies for a mobile robot, where the ideal view is not known beforehand. Moreover, a single view may not be sufficient to locate all the object instances in the given area, which leads to inaccurate ambiguity detection. Human intervention is helpful only if the robot can convey the kind of ambiguity it is facing. In this article, we present DoRO (Disambiguation of Referred Object), a system that can help an embodied agent to disambiguate the referred object by raising a suitable query whenever required. Given an area where the intended object is, DoRO finds all the instances of the object by aggregating observations from multiple views while exploring & scanning the area. It then raises a suitable query using the information from the grounded object instances. Experiments conducted with the AI2Thor simulator show that DoRO not only detects the ambiguity more accurately but also raises verbose queries with more accurate information from the visual-language grounding., Accepted in IEEE Robotics & Automation Letters (RA-L)

Helicobacter pyloriis closely connected to upper gastrointestinal tract diseases including gastric cancer. Transgenic plants are found to be successful in expressing the bacterial antigens, which could elicit an immune response when consumed. The Cytotoxicity-associated immunodominant antigen protein (cagA) ofH. pyloriis kindred with pathogenicity and cancer risk. We expressed thecagAtransgenically in the brinjal. We amplified thecagAgene fromH. pyloristrain 26695 chromosomal DNA and transformed it into brinjal callus derived from leaf explants using the pBI121 expression vector. The stable expression and accumulation of the recombinantcagAgene were confirmed by using quantitative real-time PCR, western blot analysis and ELISA. The RT-PCR, western blot and ELISA showed stable expression ofcagAgene in the transgenic lines B3, B5, B11, B17 and B21. Among them, B11 and B17 samples showed higher expression of thecagAcompared to the other samples. Besides, the immunohistochemistry assay showed the abundant expression ofcagAprotein in the parenchymal regions of the transgenic plants. Out of the 52 plants, a set five plants were found to be positive forcagAexpression. Our experimental outcomes can be used further to design the vaccines againstH. pylorifrom the transgenic brinjal plants.

The arrestin domain containing proteins (ARRDCs) are crucial adaptor proteins assist in signal transduction and regulation of sensory physiology. The molecular localization of the ARRDC gene has been confined mainly to the mammalian system while in invertebrates the expression pattern was not addressed significantly. The present study reports the identification, tissue specific expression and functional characterization of an ARRDC transcript in earthworm, Eudrilus eugeniae.The coding region of earthworm ARRDC transcript was 1146 bp in length and encoded a protein of 381 amino acid residues. The worm ARRDC protein consists of conserved N-terminal and C-terminal regions and showed significant homology with the ARRDC3 sequence of other species. The tissue specific expression analysis through whole mount in-situ hybridization denoted the expression of ARRDC transcript in the central nervous system of the worm which includes cerebral ganglion and ventral nerve cord. Besides, the expression of ARRDC gene was observed in the epidermal region of earthworm skin. The functional characterization of ARRDC gene was assessed through siRNA silencing and the gene was found to play key role in the light sensing ability and photophobic movement of the worm.The neuronal and dermal expression patterns of ARRDC gene and its functional characterization hypothesized the role of the gene in assisting the photosensory cells to regulate the process of photoreception and phototransduction in the worm.

BackgroundHypertrophic cardiomyopathy (HCM) is a genetic heart muscle disease with preserved or increased ejection fraction in the absence of secondary causes. Mutations in the sarcomeric protein-encoding genes predominantly cause HCM. However, relatively little is known about the genetic impact of signalling proteins on HCM.Methods and resultsHere, using exome and targeted sequencing methods, we analysed two independent cohorts comprising 401 Indian patients with HCM and 3521 Indian controls. We identified novel variants in ribosomal protein S6 kinase beta-1 (RPS6KB1 or S6K1) gene in two unrelated Indian families as a potential candidate gene for HCM. The two unrelated HCM families had the same heterozygous missense S6K1 variant (p.G47W). In a replication association study, we identified two S6K1 heterozygotes variants (p.Q49K and p.Y62H) in the UK Biobank cardiomyopathy cohort (n=190) compared with matched controls (n=16 479). These variants are neither detected in region-specific controls nor in the human population genome data. Additionally, we observed an S6K1 variant (p.P445S) in an Arab patient with HCM. Functional consequences were evaluated using representative S6K1 mutated proteins compared with wild type in cellular models. The mutated proteins activated the S6K1 and hyperphosphorylated the rpS6 and ERK1/2 signalling cascades, suggesting a gain-of-function effect.ConclusionsOur study demonstrates for the first time that the variants in the S6K1 gene are associated with HCM, and early detection of the S6K1 variant carriers can help to identify family members at risk and subsequent preventive measures. Further screening in patients with HCM with different ethnic populations will establish the specificity and frequency of S6K1 gene variants.

Dinitrogen fixation through the Nitrogen Reduction Reaction (NRR) under mild conditions without the use of sacrificial agents has its share of formidable hurdles. It has been shown recently that Ru-doped Au nanoclusters can reduce N2 molecule to NH3 only in the presence of UV-Vis light in aqueous medium. Herein, using theoretical techniques we shed light on the mechanistic avenues traversed for achieving this prodigious chemical feat. Our findings suggest that the bimetallic Au22Ru6 cluster successfully accomplishes the NRR process under ambient pressure and temperature conditions by the very virtue of its bifunctional nature. Contrary to the existing views, we find that NRR propagates through an unconventional associative pathway, where the Ru dopant assists in N2 adsorption while the Au-H bonds formed from Au assisted water splitting is implicated for facilitating NRR.

Background: Plant biotechnology revolutionized the branch of plant sciences contributing to improving crop production. Helicobacter pylori was predominantly seen among all the sectors of the human population, closely stuck to stomach ulcers and cancer. Even though traditional vaccines are effective in preventing H. pylori, edible and non-edible parts of special transgenic plants were also being generated to express its antigens which could elicit an immune response after consuming. The induce by contact with epithelium (iceA1) protein of H. pylori is associated with virulence and stated as predisposing factor to stomach cancer. Objectives: This study intends to study the expression levels of iceA1 gene in the brinjal plant. Materials and Methods: The present study, magnified the iceA1 gene from H. pylori strain 26695 and transformed it into callus of brinjal (from leaf explants) through Agrobacterium tumefacians (EHA105). pBI121 vector was used to construct the plant expression vector, and the transgenic plants generated were further validated through gene amplification and protein expression studies. Results: Out of the 46 plants obtained from this study, five of them were found to be positive for the iceA1 expression as seen on validation assays like gene amplification and protein expression studies. Conclusion: The study could beneficially produce a vaccine candidate against H. pylori from transgenic brinjal. In Addition, it could provide, valid scientific data which can further be used by researchers.

Amid the surge of computational studies of gold thiolate clusters in the recent past, we present a comparison of popular density functionals (DFAs) and three-part corrected methods (3c-methods) on their performance by taking a dataset consisting 18 isomers of Aun(SCH3)m (m ≤ n =1-3) stoichiometry. We have compared the efficiency and accuracy of the DFAs and 3c-methods in geometry optimization with RI-SCS-MP2 and energies with DLPNO-CCSD(T) as reference methods. The lowest energy structure out of the largest stoichiometry from our dataset i.e., Au3(SCH3)3 is considered to evaluate the computational time for SCF and gradient. Alongside, the number of optimization steps to locate the most stable minima of Au3(SCH3)3 are compared to assess the efficiency of the methods. A comparison of relevant bond lengths with the reference geometry was made to estimate the accuracy in geometry optimization. Some methods such as LC-BLYP, ⍵B97M-D3BJ, M06-2X, and PBEh-3c are unable to locate many of the minima that are found by most of the other methods; thus, the versatility in locating various minima is also an important criterion in choosing a method for the given project. We have compared the relative energies among the isomers along every stoichiometric series and the interaction energy of the gold core with the ligands to estimate the accuracy of the methods. The dependence of basis set size and relativistic effects on energies are also compared. Some of the highlights are the following. TPSS shows accuracy, whereas mPWPW is fast with comparable accuracy. The range separated hybrid DFAs are the best choice for the relative energies of the clusters. CAM-B3LYP excels, whereas B3LYP shows poor performance. Overall, LC-BLYP is a balanced performer considering both the geometry and relative stability of the structures, but it lacks diversity. The 3c-methods, although fast, are less impressive in relative stability.

Overmodulation techniques of asymmetrical six-phase machine achieve higher dc-bus utilization by applying voltage in the nonenergy transfer plane. This results into unwanted current and associated copper loss. Existing overmodulation technique minimizes this voltage from space-vector perspective with predefined set of four active vectors. To find the best technique, one needs to perform the above minimization problem with all possible sets of active vectors with which higher voltage gain can be attained. Therefore, this requires evaluation of large number of cases. This article formulates the above minimization problem in terms of average voltage vectors of two three-phase inverters, where active vectors need not to be specified beforehand and, thus, the analysis is more general. Sixteen possible techniques with different set of active vectors are derived following the above analysis, which attain minimum voltage injection in the nonenergy transfer plane. This article also identifies one of these 16 techniques, which can be implemented without involving complex six-dimensional transformation. The above technique is validated through experiments on six-phase induction motor and simulations in MATLAB at 3.5-kW power level.

Overmodulation (OVM) techniques of asymmetrical six-phase induction machine (ASIM) achieve higher dc-bus utilization by applying nonzero average voltage in nonenergy transfer plane. This results into unwanted current and associated copper loss. Existing OVM techniques reduce this loss with pulsewidth modulation (PWM) techniques from six-dimensional space vector perspective, which is both conceptually difficult and computationally challenging. The computational complexity of space vector based techniques is reduced by few existing PWM techniques in linear region by splitting the six-phase inverter as two three-phase inverters and modulate these inverters with linear PWM techniques in 30 $^\circ$ phase shifted. This is referred as three-phase inverter based technique in the title. But, three-phase inverter based OVM technique does not exist in the literature due to lack of knowledge of the relationship between six-dimensional space vectors and space vectors of two three-phase inverters. This article first establishes this relation. Based on this relation, an OVM technique is proposed where the reference voltage vectors of two inverters are phase shifted by 30 $^\circ$ but of different magnitudes. The proposed technique achieves THD and WTHD performances similar to space vector based best technique of ASIM with reduced computational complexity, as shown in details. The proposed strategy is validated through experiments and simulations on six-phase induction machine at 4.2 kW.

Systemic sclerosis (SSc) is a fibrotic disease that initiates in the skin and progresses to internal organs, leading to a poor prognosis. Unraveling the etiology of a chronic, multifactorial disease such as SSc has been aided by various animal models that recapitulate certain aspects of the human pathology. We found that the transcription factor Snail is overexpressed in the epidermis of SSc patients and a transgenic mouse recapitulating this expression pattern is sufficient to induce many clinical features of the human disease. Using this mouse model as a discovery platform, we have uncovered a critical role for the matricellular protein Mindin (Spondin-2) in fibrogenesis. Mindin is produced by Snail transgenic skin keratinocytes and aids fibrogenesis by inducing early inflammatory cytokine production and collagen secretion in resident dermal fibroblasts. Given the dispensability of Mindin in normal tissue physiology, targeting this protein holds promise as an effective therapy for fibrosis.

Bin packing using a robotic arm is an important problem in the context of Industry 4.0. In this work, we present a reliable and efficient bin packing system, called Jampacker . We propose a new offline 3D bin packing algorithm, called Jampack that achieves higher packing efficiency in comparison to the state-of-the-art algorithms. Jampack computes placement points, called internal corner points that tries to maximize the utilization of free spaces in-between objects, which are generally ignored by existing algorithms. Additionally, we introduce a fault recovery module (FRM) for the robotic manipulator that helps to achieve a more reliable and efficient packing in a physical container. The FRM module monitors the object placement by the robotic arm, calculates a fault score for the placement, adjusts the placement if required, and also learns & adjusts the offset for the placement procedure on-the-go. We show that this system achieves faster completion of the overall packing process.

We present a performance study on popular density functionals (DFAs) and three-part corrected methods (3c-methods) for their efficiency and accuracy in the geometry and relative stability of gold-thiolate nanoclusters taking Au 3(SCH3)3 isomers. Normalized mean absolute error (NMAE) is analysed to compare the results with the reference methods DLPNO-CCSD(T) and RI-SCS-MP2. The dependence of basis set size and relativistic effects on energies are also compared. TPSS shows accuracy, whereas PBE is fast for geometry optimization. On the other hand, range separation in hybrid DFAs stands out as the proper choice for the relative energies of the clusters. LC-BLYP excels, but 3c-methods are less impressive in relative stability comparison. Counterpoise corrected thiolate interaction energy and bonding analyses delineate the higher stability of bridging sulfur coordination (RS-Au-SR; R = − methyl) than singly-bonded and capping sulfur bonds in Au3(SCH3)3 . With the selected DFAs, we have analyzed the gold-sulfur interaction in Au3(SCH3)3 , and a comparison is made with AuSCH3 . The bonding analysis has revealed a partial covalency between gold and sul- fur atoms. On going from AuSCH3 to Au3 (SCH3)3 , a substantial flow of charge from gold atoms to thiolate ligands stems from the increase in gold s-d hybridization. As the s-d mixing in Au increases, the main character of Au-S interaction shifts from covalent to ionic. Hence, a covalent-charge-transfer interaction dominates in gold-sulfur bonding and gives rise to a charge-shift bonding.

Cancer is a complex disease affecting millions of people around the world. Despite advances in surgical and radiation therapy, chemotherapy continues to be an important therapeutic option for the treatment of cancer. The current treatment is expensive and has several side effects. Also, over time, cancer cells develop resistance to chemotherapy, due to which there is a demand for new drugs. Drug repurposing is a novel approach that focuses on finding new applications for the old clinically approved drugs. Current advances in the high-dimensional multiomics landscape, especially proteomics, genomics, and computational omics-data analysis, have facilitated drug repurposing. The drug repurposing approach provides cheaper, effective, and safe drugs with fewer side effects and fastens the process of drug development. The review further delineates each repurposed drug's original indication and mechanism of action in cancer. Along with this, the article also provides insight upon artificial intelligence and its application in drug repurposing. Clinical trials are vital for determining medication safety and effectiveness, and hence the clinical studies for each repurposed medicine in cancer, including their stages, status, and National Clinical Trial (NCT) identification, are reported in this review article. Various emerging evidences imply that repurposing drugs is critical for the faster and more affordable discovery of anti-cancerous drugs, and the advent of artificial intelligence-based computational tools can accelerate the translational cancer-targeting pipeline.

The oligochaete earthworm, Eudrilus eugeniae is capable of regenerating both anterior and posterior segments. The present study focuses on the transcriptome analysis of earthworm E. eugeniae to identify and functionally annotate the key genes supporting the anterior blastema formation and regulating the anterior regeneration of the worm. The Illumina sequencing generated a total of 91,593,182 raw reads which were assembled into 105,193 contigs using CLC genomics workbench. In total, 40,946 contigs were annotated against the NCBI nr and SwissProt database and among them, 15,702 contigs were assigned to 14,575 GO terms. Besides a total of 9389 contigs were mapped to 416 KEGG biological pathways. The RNA-Seq comparison study identified 10,868 differentially expressed genes (DEGs) and of them, 3986 genes were significantly upregulated in the anterior regenerated blastema tissue samples of the worm. The GO enrichment analysis showed angiogenesis and unfolded protein binding as the top enriched functions and the pathway enrichment analysis denoted TCA cycle as the most significantly enriched pathway associated with the upregulated gene dataset of the worm. The identified DEGs and their function and pathway information can be effectively utilized further to interpret the key cellular, genetic and molecular events associated with the regeneration of the worm.

Fibrosis is a result of chronically activated fibroblasts leading to the overproduction of extracellular matrix (ECM), causing tissue hardening and loss of organ function. Systemic sclerosis (SSc) is a fibrotic skin disease marked by inflammation, autoimmunity and vasculopathy along with progressive fibrosis of the skin and internal organs. A major bottleneck in understanding the etiology of SSc has been the lack of a holistic animal model that can mimic the human SSc disease. We found that the transcription factor Snail is overexpressed in the epidermis of SSc patients and a transgenic mouse recapitulating this expression pattern is sufficient to induce hallmark clinical features of the human disease. Using this mouse model as a discovery platform, we have uncovered a critical role for the matricellular protein Mindin in fibrogenesis. Mindin is produced by Snail transgenic skin keratinocytes and aids fibrogenesis by inducing inflammatory cytokine and collagen production in resident dermal fibroblasts. Given the dispensability of Mindin in normal tissue physiology, targeting this protein holds promise as an effective therapy for fibrosis.

We present a benchmark study on popular density functionals for their efficiency and accuracy in the geometry and relative stability of gold-thiolate nanoclusters taking Au3(SMe)3 isomers. We have used normalized mean absolute error (NMAE) analysis as a parameter to compare the results with the reference methods - DLPNO-CCSD(T) and RI-SCS-MP2. We have also compared the performance on the thiolate interaction energy of the stable geometries using the results from our benchmark study. One of the promising functional is PBE that shows robust performance for geometry optimization. On the other hand, M06-2X stands out as the proper choice for the relative energies of the clusters. With the selected methods, we have analyzed the gold-sulfur interaction in Au3(SMe)3 and a comparison is made with AuSMe. The bonding analysis has revealed a partial covalency between gold and sulfur atoms in general. On going from AuSMe to Au3(SMe)3, a substantial flow of charge from gold atoms to thiolate ligands as a result of the increase in gold s-d hybridization. As the s-d mixing in Au increases, the main character of Au-S interaction shifts from covalent to ionic. Hence, a covalent-charge-transfer interaction dominates in gold-sulfur bonding and gives rise to a charge-shift bonding.

Supplemental material, sj-pdf-1-pim-10.1177_14750902221078426 for Safety analysis of a high-pressure fuel gas supply system for LNG fuelled vessels by Konstantinos Milioulis, Victor Bolbot, Gerasimos Theotokatos, Evangelos Boulougouris, Paul Sayan, Kelvin Wen Yong Chio and Wei Siang Lim in Proceedings of the Institution of Mechanical Engineers, Part M: Journal of Engineering for the Maritime Environment

Supplemental material, sj-pdf-1-pim-10.1177_14750902221078426 for Safety analysis of a high-pressure fuel gas supply system for LNG fuelled vessels by Konstantinos Milioulis, Victor Bolbot, Gerasimos Theotokatos, Evangelos Boulougouris, Paul Sayan, Kelvin Wen Yong Chio and Wei Siang Lim in Proceedings of the Institution of Mechanical Engineers, Part M: Journal of Engineering for the Maritime Environment

Asymmetrical six-phase machine (ASPM) with six balanced phases and two isolated neutral points can be analyzed in two orthogonal two-dimensional subspaces where one of them is associated with electromechanical energy transfer. Excitation of the non-energy transferring plane causes unwanted copper loss. Therefore, linear modulation techniques (LMTs) of inverter fed ASPM synthesize the desired reference voltage vector in the energy transferring plane and zero average voltage in the non-energy transferring plane. Existing space-vector PWM (SVPWM) based LMTs show good ripple-current performances but few of them suffer from the disadvantages like, higher implementation complexity, multiple switching of a leg, and simultaneous switching of multiple legs over one carrier-cycle. A novel SVPWM based LMT is proposed in this paper where the above disadvantages are avoided and, therefore, can be implemented in a computationally efficient carrier based method. The proposed strategy achieves maximum possible voltage gain of LMTs and shows current-ripple performance better or close to carrier-comparison based best known existing techniques. The proposed technique is validated through simulation and experiments performed up to 3.5 kW with a laboratory-scale hardware prototype.

Linear modulation techniques (LMTs) of an asymmetrical six-phase machine (ASPM) with two isolated neutral points synthesize the desired voltage vectors by applying at least five switching states. Different choices of applied voltage vectors, sequences in which they are used, distribution of dwell times among the redundant switching states give rise to a large number of possible LMTs. It is desirable that these LMTs avoid more than two transitions of a particular inverter leg within a carrier period. Only a subset of existing LMTs of ASPM follows this rule. Through an innovative approach, this paper finds a way to account for all possible infinitely many LMTs that follow the rule of at most two transitions per leg. Another important criterion for the selection of an LMT is its current-ripple performance. Therefore, through numerical optimization, the paper finds optimal LMTs among the above infinite possible LMTs for all reference voltage vectors in the linear range and for the whole feasible range of a machine parameter. This parameter is related to the leakage inductance of the machine and impacts the current ripple performance of ASPM. An optimal hybrid strategy is proposed with these optimal techniques, which outperforms all existing techniques in terms of the current ripple. The theoretical analysis is validated through simulation in Matlab and experiments performed up to 3.5 kW on a hardware prototype.

Among the annelids, earthworms are renowned for their phenomenal ability to regenerate the lost segments. The adult earthworm Eudrilus eugeniae contains 120 segments and the body segments of the earthworm are divided into pre-clitellar, clitellar and post-clitellar segments. The present study denoted that clitellum plays vital role in the successful regeneration of the species. We have performed histological studies to identify among the three skin layers of the earthworm, which cellular layer supports the blastema formation and regeneration of the species. The histological evidences denoted that the proliferation of the longitudinal cell layer at the amputation site is crucial for the successful regeneration of the earthworm and it takes place only in the presence of an intact clitellum. Besides we have performed clitellar transcriptome analysis of the earthworm Eudrilus eugeniae to monitor the key differentially expressed genes and their associated functions and pathways controlling the clitellar tissue changes during both anterior and posterior regeneration of the earthworm. A total of 4707 differentially expressed genes (DEGs) were identified between the control clitellum and clitellum of anterior regenerated earthworms and 4343 DEGs were detected between the control clitellum and clitellum of posterior regenerated earthworms. The functional enrichment analysis confirmed the genes regulating the muscle mass shape and structure were significantly downregulated and the genes associated with response to starvation and anterior-posterior axis specification were significantly upregulated in the clitellar tissue during both anterior and posterior regeneration of the earthworm. The RNA sequencing data of clitellum and the comparative transcriptomic analysis were helpful to understand the complex regeneration process of the earthworm.

WNT/β-catenin signaling orchestrates various physiological processes, including embryonic development, growth, tissue homeostasis, and regeneration. Abnormal WNT/β-catenin signaling is associated with various cancers and its inhibition has shown effective antitumor responses. In this review, we discuss the pathway, potential targets for the development of WNT/β-catenin inhibitors, available inhibitors, and their specific molecular interactions with the target proteins. We also discuss inhibitors that are in clinical trials and describe potential new avenues for therapeutically targeting the WNT/β-catenin pathway. Furthermore, we introduce emerging strategies, including artificial intelligence (AI)-assisted tools and technology-based actionable approaches, to translate WNT/β-catenin inhibitors to the clinic for cancer therapy.

In this study, pot-culture experiments were conducted to investigate the single effect of Cd, PCBs, and the combined effect of Cd-PCBs with Tagetes patula L. The study highlights that the minimum concentration of PCBs (100 µg kg−1) could enable the growth of the plant with an increase in biomass by 27.76% when compared with the control. In all the experiments performed, the Cd concentrations over the surface parts were found to be above 100 mg kg−1. Significant positive correlations were observed between the Cd and PCBs concentrations accumulated in tissues of the soil and plants (p

This paper proposes a novel carrier-based implementation strategy of a standard space-vector pulse-width modulation (SVPWM) technique of three-phase (3ϕ) three-level inverter (TLI). To synthesize the reference voltage vector, the selected SVPWM technique uses nearest three voltage space-vectors in order to reduce output voltage THD and partially balance the neutral point voltage. The implementation complexity of this SVPWM technique is reduced by introducing the concept of common-mode signal in duty-ratio calculation of 3ϕ-TLI. Following the modulation strategy of the selected SVPWM technique, general expression of common-mode signal has been derived in terms of maximum, middle and minimum values of input 3ϕ modulation signals. It is shown in the paper that six duty ratios of 3ϕ-TLI can be directly calculated from the input 3ϕ modulation signals and the derived common-mode signal. Thus, calculation-intensive steps of SVPWM technique, like, identification of reference voltage vector location, calculation of dwell-times of individual vectors, are avoided. The proposed algorithm is validated through simulation in MATLAB and experiment on 1.5 kW hardware prototype.

Asymmetrical six-phase induction machine (ASIM) with six balanced phases and two isolated neutral points require modulation in two orthogonal two-dimensional subspaces where one of them is associated with electromechanical energy transfer. Excitation of non-energy transferring subspace causes copper loss. Therefore, this paper proposes a novel space-vector based PWM strategy (SVPWM) of matrix converter (MC) fed ASIM where excitation in non-energy transferring plane is kept as zero and energy transferring plane is excited so as to generate ripple- free torque. Eighteen switching states of 3ϕ - 6ϕ MC are used for this purpose which have zero common-mode voltage. Theoretical analysis shows that the input power-factor for this technique is same as the load power-factor. Finally, a new PWM strategy is proposed to operate the MC at unity power-factor at input. The proposed techniques are verified through simulations in Matlab and experiments on 3 kW hardware prototype.

Purpose Verminephrobacter is a genus of symbiotic bacteria that live in the nephridia of earthworms. The bacteria are recruited during the embryonic stage of the worm and transferred from generation to generation in the same manner. The worm provides shelter and food for the bacteria. The bacteria deliver micronutrients to the worm. The present study reports the genome sequence assembly and annotation of a new strain of Verminephrobacter called Verminephrobacter eiseniae msu. Methods We separated the sequences of a new Verminephrobacter strain from the whole genome of Eisenia fetida using the sequence of V. eiseniae EF01-2, and the bacterial genome was assembled using the CLC Workbench. The de novo-assembled genome was annotated and analyzed for the protein domains, functions, and metabolic pathways. Besides, the multigenome comparison was performed to interpret the phylogenomic relationship of the strain with other proteobacteria. Result The FastqSifter sifted a total of 593,130 Verminephrobacter genomic reads. The de novo assembly of the reads generated 1832 contigs with a total genome size of 4.4 Mb. The Average Nucleotide Identity denoted the bacterium belongs to the species V. eiseniae, and the 16S rRNA analysis confirmed it as a new strain of V. eiseniae. The AUGUSTUS genome annotation predicted a total of 3809 protein-coding genes; of them, 3805 genes were identified from the homology search. Conclusion The bioinformatics analysis confirmed the bacterium is an isolate of V. eiseniae, and it was named Verminephrobacter eiseniae msu. The whole genome of the bacteria can be utilized as a useful resource to explore the area of symbiosis further.

The lumbricid earthworm Dendrobaena octaedra , widely distributed in the northern hemisphere, is a freeze tolerant worm species known for its ability to acclimate to the extreme cold condition. However, at the genome and transcriptome level, the species has not been explored to a great extent. The present study focuses on transcriptome analysis of Dendrobaena octaedra to identify and functionally annotate the potential transcripts and biological pathways associated with the freeze tolerance of the species. The Roche 454 pyrosequencing generated 181,856 reads for warm acclimated worms and 190,209 reads for cold acclimated worms which were de novo assembled to 6336 isotigs using the Newbler 2.3 assembler. In total, 2665 isotigs were annotated against the NCBI nr database and of them, 1753 isotigs were assigned to 9546 GO terms. The conserved domain analysis using InterProScan annotated 6309 isotigs into 1307 domains with EF-hand domain as the most highly represented domain. Further, the COG annotation classified 1426 isotigs into 25 functional categories and 895 isotigs were mapped to 90 KEGG pathways. Among them, 22 pathways were functionally enriched in the cold acclimated worms. The RNA seq analysis showed 96 differentially expressed genes of which 50 genes were upregulated in the cold acclimated worms. In addition, we identified 72 molecular chaperones which may have effect in regulating the cold tolerance of the species. The complete transcriptome resource of Dendrobaena octaedra can be effectively utilized further to interpret the key genetic, molecular and physiological mechanisms regulating the freeze tolerance and cold acclimation process of the species.

Face recognition is a popular subject in biometrics research which has distinct advantages because of its non-contact process. This technology has gained popularity because of its large application value and market value, like video surveillance system for real time tracking of suspicious object. In this paper we focus on the image face which has to be correctly recognized using support vector Machine (SVM) techniques with Principle Components Analysis (PCA) which extract the features and reduce dimensionality. Also we have used KNN classifier. The SVM with PCA produces more accurate result compare to other methods. This paper achieved 92% successful recognition rate for detecting different face databases.

Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats "CACAGA" and "TCTCTGCGCCTGCGCCGGCGCGGCGCGCC" and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.

Context: This research describe the characteristic volume expansion of a moving target as a function of differential margins. Aim: We aimed to ascertain the volume change after giving margin for clinical and set up uncertainties including generating internal target volume (ITV) for moving target. Materials and Methods: Settings and Design – Spheres of diameter (0.5–10 cm) with differential expansion of 1–15 mm were generated using a mathematical formula. Moving targets of radius 1–5 cm were generated, and the resultant volume envelopes with incremental motion from 1 to 20 mm were obtained. All relative volume change results were fitted with mathematical functions to obtain a generalized mathematical formula. Statistical Analysis Used: None. Results: The percentage increase in volume (%ΔVp) was much more pronounced for smaller radius target. For moving target with relatively smaller radius, %ΔVp is predominant over the absolute volume change and vice versa in case of larger radius. Mathematical formulae were obtained for %ΔVp as a function of radius and expansion and for %ΔVp in ITV volume as a function of radius and tumor movement. Conclusions: This study provides an idea of volume change for various expansions for various size targets and/or moving target for different range of movements. It establishes a correlation of these volume changes with the changing target size and range of movements. Finally, a clinically useful mathematical formulation on volume expansion has been developed for rapid understanding of the consequence of volume expansion.

Zika virus (ZIKV) is a reemerging human pathogen that causes congenital abnormalities, including microcephaly and eye disease. The cellular/molecular basis of ZIKV and host interactions inducing ocular and neuronal pathogenesis are unclear. Herein, we noted that the Hippo/Salvador-Warts-Hippo signaling pathway, which controls organ size through progenitor cell proliferation and differentiation, is dysregulated after ZIKV infection. In human fetal retinal pigment epithelial cells, there is an early induction of transcriptional coactivator, Yes-associated protein (YAP), which is later degraded with a corresponding activation of the TANK binding kinase 1/interferon regulatory factor 3 type I interferon pathway. YAP/transcriptional co-activator with a PDZ-binding domain (TAZ) silencing results in reduced ZIKV replication, indicating a direct role of Hippo pathway in regulating ZIKV infection. Using an invivo Ifnar1-/- knockout mouse model, ZIKV infection was found to reduce YAP/TAZ protein levels while increasing phosphorylated YAP Ser127 in the retina and brain. Hippo pathway is activated in major cellular components of the blood-brain barrier, including endothelial cells and astrocytes. In addition, this result suggests AMP-activated protein kinase signaling pathway's role in regulating YAP/TAZ in ZIKV-infected cells. These data demonstrate that ZIKV infection might initiate a cross talk among AMP-activated protein kinase-Hippo-TBK1 pathways, which could regulate antiviral and energy stress responses during oculoneuronal inflammation.

The Escherichia coli phage CMSTMSU was isolated from shrimp farm effluent water in Ramanathapuram, India. The phage exhibited lytic activity against both E. coli and the fish pathogen Pseudomonas aeruginosa., The Escherichia coli phage CMSTMSU was isolated from shrimp farm effluent water in Ramanathapuram, India. The phage exhibited lytic activity against both E. coli and the fish pathogen Pseudomonas aeruginosa. Here we report the draft genome sequence, assembly, and annotation of the isolated CMSTMSU phage. This genome resource can be used to utilize the phage as a crucial biocontrol agent in the fish aquaculture sector.

The steel industry being highly energy intensive in nature is one the major consumers of energy. The iron and steel industry is the largest energy consuming manufacturing sector in the world. It is therefore that the question of fuel or energy has been of the highest importance in steel making, and one can boldly claim that all other conditions remaining constant, saving or wasting of fuel can make the difference between a profit or a loss of a steel plant. Energy conservation in steel plants is very crucial to ensure the competitiveness of the steel producing industries and to minimise environmental impacts. India's leading iron and steel companies, scored averages at best in Centre for Science and environment green rating test. The Indian iron and steel sector's energy consumption of 6.6 GCal per tonne, is 50 per cent higher than the global best practice. The integrated steel plants in India have the opportunities to strengthen their operations and minimise energy losses and wastages to reduce specific energy consumption by 5-6%. To reduce the gaps between India and developed countries we have to follow the technological advancement and implementation of innovative strategies at every stage of the operation of steel plants. The specific energy consumption in the Indian steel industry is high compared to that in advanced countries. Data for four integrated steel plants in India have been analysed. World crude steel production reached 1.621 million tones (Mt) in 2015. To meet the needs of our growing population, steel use is projected to increase by 1.5 times that of present level by 2050.

The present article reports the complete draft genome annotation of earthworm Eisenia fetida, obtained from the manuscript entitled “Timing and Scope of Genomic Expansion within Annelida: Evidence from Homeoboxes in the Genome of the Earthworm E. fetida” (Zwarycz et al., 2015) and provides the data on the repetitive elements, protein coding genes and noncoding RNAs present in the genome dataset of the species. The E. fetida protein coding genes were predicted from AUGUSTUS gene prediction and subsequently annotated based on their sequence similarity, Gene Ontology (GO) functional terms, InterPro domains, Clusters of Orthologous Groups (COGs) and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways information. The genome wide comparison of orthologous clusters and phylogenomic analysis of the core genes were performed to understand the events of genome evolution and genomic diversity between E. fetida and its related metazoans. In addition, the genome dataset was screened to identify the crucial stem cell markers, regeneration specific genes and immune-related genes and their functionally enriched GO terms were predicted from Fisher׳s enrichment analysis. The E. fetida genome annotation data containing the GFF (general feature format) annotation file, predicted coding gene sequences and translated protein sequences were deposited to the figshare repository under the DOI: https://doi.org/10.6084/m9.figshare.6142322.v1.

Bacillus species 062011 msu is a harmful pathogenic strain responsible for causing abscessation in sheep and goat population studied by Mariappan et al. (2012) [1]. The organism specifically targets the female sheep and goat population and results in the reduction of milk and meat production. In the present study, we have performed the whole genome sequencing of the pathogenic isolate using the Ion Torrent sequencing platform and generated 458,944 raw reads with an average length of 198.2 bp. The genome sequence was assembled, annotated and analysed for the genetic islands, metabolic pathways, orthologous groups, virulence factors and antibiotic resistance genes associated with the pathogen. Simultaneously the 16S rRNA sequencing study and genome sequence comparison data confirmed that the strain belongs to the species Bacillus cereus and exhibits 99% sequence homo;logy with the genomes of B. cereus ATCC 10987 and B. cereus FRI-35. Hence, we have renamed the organism as Bacillus cereus 062011msu. The Whole Genome Shotgun (WGS) project has been deposited at DDBJ/ENA/GenBank under the accession NTMF00000000 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA404036(SAMN07629099)).

In annelid worms, the nerve cord serves as a crucial organ to control the sensory and behavioral physiology. The inadequate genome resource of earthworms has prioritized the comprehensive analysis of their transcriptome dataset to monitor the genes express in the nerve cord and predict their role in the neurotransmission and sensory perception of the species. The present study focuses on identifying the potential transcripts and predicting their functional features by annotating the transcriptome dataset of nerve cord tissues prepared by Gong et al., 2010 from the earthworm Eisenia fetida. Totally 9762 transcripts were successfully annotated against the NCBI nr database using the BLASTX algorithm and among them 7680 transcripts were assigned to a total of 44,354 GO terms. The conserve domain analysis indicated the over representation of P-loop NTPase domain and calcium binding EF-hand domain. The COG functional annotation classified 5860 transcript sequences into 25 functional categories. Further, 4502 contig sequences were found to map with 124 KEGG pathways. The annotated contig dataset exhibited 22 crucial neuropeptides having considerable matches to the marine annelid Platynereis dumerilii, suggesting their possible role in neurotransmission and neuromodulation. In addition, 108 human stem cell marker homologs were identified including the crucial epigenetic regulators, transcriptional repressors and cell cycle regulators, which may contribute to the neuronal and segmental regeneration. The complete functional annotation of this nerve cord transcriptome can be further utilized to interpret genetic and molecular mechanisms associated with neuronal development, nervous system regeneration and nerve cord function.

Aim: Intracranial metastases are the most common neurologic complications of systemic cancer. Stereotactic radiosurgery (SRS) is a proven modality for treating single or oligometastatic brain lesions. In this retrospective study, we have analyzed patients data treated in our hospital with SRS. Materials and Methods: The analysis included 52 patient's data treated between August 2010 and January 2018. These include the patients in the complete remission of the primary disease and have recurred in the brain with one to four metastases after a significant disease-free interval. Patient's case sheets and treatment planning system data were analyzed to collect the data for this study. Results: Median follow-up was 10 months (range, 1–37 months). There were twenty cases of Ca (cancer) lung, 13 cases of Ca breast, 5 cases of Ca rectum, 4 cases of Ca endometrium, 2 case of Ca esophagus, and 1 case each of alveolar rhabdomyosarcoma of right parotid, Ca ovary, Ca vaginal vault, Ca lacrimal gland, Ca colon, Ca urinary bladder, and Ca prostate. These patients who had a recurrent disease in the brain were treated with doses ranging from 15 to 20 Gy in single fraction, 24 Gy in 3 fractions, 27 Gy in 3 fractions, or 30 Gy in 5 fractions. Median progression-free survival was 9 months, and median overall survival (OS) was 12 months in these patients. Conclusion: Frameless SRS is an effective treatment of delivering high-dose radiation to patients who develop one to four brain metastasis with comparable median progression free and OS to the previously reported data.