Search

Drilling operation of fiber reinforced polymeric (FRP) composites is significantly dissimilar from conventional drilling operation of metals; hence, identification of optimum drilling process param...

This work presents the feasibility study of utilizing neat plastic oil TiO $$_2$$ nanoparticle is added as additive in the proportion of 100, 150, and 200 ppm fuelled in a stationary single cylinder diesel engine to asses the performance, emission and combustion characteristics. From the local municipality, the waste plastic bottles are collected and it it fed into the pyrolysis reactor to convert into pyrolysis oil. The results from performance analysis revealed that the enrichment of neat plastic with TiO $$_2$$ nanoparticle enhanced the brake thermal efficiency than without any additives in the raw oil (plastic oil). Similarly, the results of emission revealed that smoke, and hydrocarbon are considerably reduced with increased proportion of nano additive. Results also revealed that the formation of NOx is higher with POAL200 than plastic oil and other concentration of TiO $$_2$$ nanoparticle and diesel fuel. This is due to the higher availability of oxygen content in the fuel, higher quality of fuel and reduced ignition delay.

The demand for precision machining process and sophisticated fabrication methods is increased due to the wide application of glass fiber reinforced polymer (GFRP) composites in various industries such as aerospace, defense, automobile, construction and railways etc. Identification of optimum drilling process parameters for GFRP composites has become mandatory because drilling operation of GFRP composites is significantly dissimilar from conventional drilling operation of metals. In this present work, three drilling parameters such as drill bit point angle, feed rate, and spindle speed were optimized using teaching learning based optimization (TLBO) algorithm for GFRP composite with 30% fiber volume fraction. The optimization study was carried out based on four output responses namely, thrust force, torque, delamination factor, and surface roughness of drilled surface and reported in this article. TLBO results were validated with experimental results.

Alkali treatment of natural fibers will improve the mechanical, chemical, and thermal characteristics of natural fiber reinforced epoxy composites. The influence of alkali treatment on the improvem...

COVID-19 is an epidemic that has been multiplying rapidly across the globe To order to regulate its growth, several nations have implemented home-stay or lockout policies Prolonged domestic residency, though, can cause worse effects such as economic instability, homelessness, food shortages and individuals' mental health issues This article presents an intelligent consumer electronics solution for secure & gradual launch after residence restrictions have been lifted Completely automatic hand sanitizer supplier to prevent quickly spreading novel corona virus It is implemented to restrict the development of new positive cases through auto touch tracking and by promoting critical social distancing

This paper presents a pioneer study of identifying the wind turbine blade condition based on its vibration pattern. The study used variational mode decomposition (VMD) for signal pre-processing. VMD is an adaptive signal decomposition technique, which can non-recursively decompose a multi-component signal into a number of quasi-orthogonal intrinsic mode functions. This new tool is based on a solid mathematical foundation and can obtain a well-defined time–frequency representation. The main advantage of VMD is, there is no residual noise in the modes and it can avoid redundant modes. Thus, VMD provides a noise-free fault signal for classification. Initially, the obtained vibration data are pre-processed using VMD and then the descriptive statistical features like mean, standard deviation, sample variance, and kurtosis were extracted. After the feature extraction, the dominant features were selected using the C4.5 decision tree algorithm. In this study, multilayer perceptron (MLP) was used for fault classification (blade bend, blade crack, erosion, hub-blade loose connection, and pitch angle twist). Then a comparative study was made with MLP without VMD and MLP with VMD to suggest a better model. From the results, the maximum classification accuracy of 87% was obtained for MLP with VMD when compared to MLP without VMD (76.83%).

Increased rate of use of fossil fuels have greatly polluted the earth through harmful by-products. Biodiesel is an attractive substitute to fossil fuel in compression ignition engine applications. In this research work, vegetable oil namely Arachis Hypogaea Oil (AHO) is used along with ethanol for biodiesel production. Since the amount of free fatty acid of AHO is 4.85%, two step transesterification process was adopted for biodiesel production. In the first step, 6:1 ethanol to oil ratio, 1% w/w concentrated H2SO4 with 60 °C process temperature and one hour process time were followed for esterification and the FFA value was found to be 0.86% after esterification. As ethanol is very rarely used for biodiesel production, optimization of transesterification process has been carried out using orthogonal array based experimental design. The four most influencing parameters, molar ratio of ethanol to oil, catalyst amount, process temperature and process time were considered for optimization. Ethanol to oil molar ratio of 9:1, 1% (w/w) concentration of catalyst, 90 min of process time and 70ºC temperature of reaction were found to be the optimal values of parameters for maximizing the yield of Arachis Hypogaea Ethyl Ester (AHEE) and the corresponding maximum yield was 95.49%. The biodiesel produced with optimum values of transesterification process parameters has been characterized and found to meet the biodiesel requirements of EN 14214 standards. Keywords: Arachis hypogaea, Transesterification, Optimization, Design of experiments, Orthogonal array, Biodiesel

Energy modeling in Smart Buildings (SB) and planning and operating the generation of power based on the information extracted are key components of the Smart Grid’s (SG’s) energy management system. In the world, buildings use a significant amount of energy that contributes to energy efficiency programs. Additionally, excessive utilization power generation appliance also including air conditioners and heater, breathing, and climate control (HVAC) units, improper microclimate control, and inappropriate start-up and ordering of power equipment waste a lot of heat pumps. The utility can mitigate energy generation costs when it anticipates electrical loads and schedules generation resources in accordance with the demand. To estimate electricity usage at varying tiers of utility grid systems, a range of techniques have already been used. The goal of this study will be to create a hybrid deep learning model can predict resource utilization in infrastructures. Model building and data cleaning are the two stages of the proposed framework. Data cleaning involves pre-processing techniques and adding additional lag values to raw data. This hybrid deep learning (DL) approach is made up of a series of completely connected layered and linear Long Short-Term Memory (LSTM) sections layered over bi-directional Long Short-Term Memory (LSTM) components and is based also on collected information. You could incorporate the dependence structure of electricity usage on regressors and increase computation efficiency, training time, as well as computational complexity by using the results obtained.

A micromechanically motivated uniaxial model with least number of state variables is presented in this paper to capture nonlinear hysteresis behavior of polycrystalline magnetostrictive materials, in particular Galfenol, with rate effects. This model is formulated based on the classical thermodynamic framework and relies on the domain rotation phenomenon occurring at the microscopic level. The macroscopically averaged domain rotation events are considered as the material state variables. The driving force required for the transformation of one state variable into another is extracted from the derived dissipation inequality equations. A special case, wherein two transformation systems activated simultaneously, is also taken into consideration in the model development. Back fields, accounting in a way the averaged inter-domain and inter-grain effects, are introduced in the proposed model. Rate-dependent effects are also set into the model in a straightforward way without compromising the core idea of this model development, i.e., a simplified approach, yet capturing most of the material responses. Finally, the proposed model, despite the reduced number of state variables, demonstrates its ability to collaborate well with many complex experimental observations of Galfenol reported in the literature.

It is indispensable to enhance the performance of a conventional solar still in order to increase its productivity. It has been effectively done by adding fins and thermal energy storage media to it. In the present work, the performance of a conventional single slope solar still is compared with an identical solar still with square pipes as fins attached to its basin liner. A thin layer of paraffin wax was stored beneath the basin liner as well as in the hollow space present in the square pipe fins as energy storage media. Experiments have been conducted on the conventional still for three different water depths, i.e. for 2, 3 and 4 cms. The masses for the corresponding water depths are 10 kg, 15 kg and 20 kg, respectively. The same water masses were maintained in the modified still, and experiments were conducted for the following cases: with mere fins and with fins cum energy storage media. The percentage increase in the efficiencies of the modified still with mere fins and with fins cum energy storage are observed as 64% and 95%, respectively.

The work analyzes the performance of a solar tunnel dryer for drying four different products (mango slice, citrus, beef, fish) under forced convection by using a DC blower run by a photovoltaic panel (200 w). An experimental setup of solar tunnel dryer has been designed and fabricated. Experiments have been performed during summer season. The system is operated between 30 and 69 °C. The dryer is simple in construction, at a low cost, with locally available materials. The performance of the designed drier is evaluated by carrying drying experiments at Nagercoil, Tamil Nadu, India (8.1700 °N, 77.4300 °E). RSM software was used to investigate estimation of capacity optimization and acceptability using desirability for four different products. The independent variables or responses were time, air temperature, and solar radiation. These researches are applicable to various process industries to analyze the probable utilization in various forms.

The decline in the availability of fossil fuel, increase in cost and the stringent emission norms are the main concerns identified in the automotive sector during the recent years. Biodiesel is one of the hopeful alternate resources for the mineral diesel to address the above-listed problems. In the present investigation, waste chicken fat biodiesel has been prepared and used to investigate the performance features of single cylinder naturally aspired direct injection diesel engine. The waste chicken fat biodiesel is prepared using transesterification process, and the yield is found to be 94.8%. The physicochemical characteristics of the waste chicken fat methyl ester have been tested and found in line with ASTM standards. The blends of waste chicken fat biodiesel with mineral diesel have been prepared and experimented in a single cylinder standard compression ignition diesel engine without any modifications. The combustion, performance and emission characteristics have been studied, and it is found that the blend B20 resulted in higher performance and lesser emissions among the other test fuels.

This investigation deals with an innovative method to improve the efficiency by reducing the fuel consumption and improving the combustion using nano particles and lime steam distilled oil. Lime steam distilled oil is obtained from the peel of Citrus aurantifolia. The characteristics of diesel engine using diesel as a fuel is taken as a benchmark reading and the nanoparticle cerium oxide mix with diesel along with lime steam distilled oil and performance will be compared with varying injection pressures. Grey relational Analysis mainly deals with the objective to "optimize a response which is influenced by several independent variables." Homogeneous combustion catalysts are those additives which are dissolved into diesel fuels homogeneously to play a catalytic role during the combustion process of the engine. Taguchi method is used for the selection of orthogonal array and number of experiments. GRA coefficient is being used to calculate rank and is calculated on the basis of the value of GRA grade. Analysis for variance is used to calculate the percentage of contribution for grey relational analysis

As the fossil fuels reserves are reducing at a faster rate as a result of the population growth and the ensuing energy utilization, in recent years, an urgent need to find renewable alternative fuels has emerged. The danger of global warming and the stringent government regulations have attracted the engine manufacturers and the consumers in improving combustion of fuels and following safer emission norms to save the environment from pollutions and also save fossil fuels for coming population. These limitations have led researchers towards finding alternative sources of energy and ways to improve their combustion for producing energy.in this investigation the experiment was carried out using camelina biodiesel (5%,10%,20%,25%,30%) with addition of silicon oxide as a nano catalyst. camelina biodiesel prepared by transesterification process. Addition of additives lowered the harmful emissions significantly with a trivial increase in NOx emissions to the sample 1 compare with other samples blends.

In-vitro dose response curves were built with 6 MV X-ray for a dose range of 0.1–6 Gy, at a dose rate of 300 cGy/min, using Linear Accelerator (LINAC, SIMENS PRIMUS) for Cytokinesis-Block Micronucleus (CBMN) and Dicentric Chromosome Aberration assay (DCA). The dose response curves constructed up to 6 Gy and also up to 4 Gy using the manual method were compared to those curves obtained with the software program such as CABAS (V.2) and Dose Estimate software (V.5.2). The alpha and beta coefficients for MN and CA obtained for the curves constructed up to 6 Gy showed variation compared to those obtained in dose response curve constructed up to 4 Gy. However, the doses estimated based on these coefficients did not show much variation. The results are discussed in this paper.

This research article highlights the results of analyses conducted to examine the combustion, performance and exhaust emission characteristics of an unmodified diesel engine fueled with a new third generation biodiesel derived from Manilkara zapota seed oil (MZO) and its blends with fossil diesel. Biodiesel was produced by the alkaline catalyst transesterification process using methanol along with KOH as catalyst. Five different test fuels were prepared and tested in a single cylinder direct injection compression ignition engine at a rated speed of 1500 rpm. Test fuel B50 (50% biodiesel + 50% diesel) produced 17% higher brake thermal efficiency and 14.34% reduced brake specific fuel consumption along with a reduction of 34.21% and 4.32% in CO and unburnt hydrocarbon emission respectively as compared to fossil diesel. Although B50 produced 38.91% higher CO2 emission than that of diesel, equivalent amount of CO2 would have been sequestered during the growth of biodiesel plants, keeping the environment balance of CO2 level.

Web query classification, the task of inferring topical categories from a web search query is a non-trivial problem in Information Retrieval domain. The topic categories inferred by a Web query classification system may provide a rich set of features for improving query expansion and web advertising. Conventional methods for Web query classification derive corpus statistics from the web and employ machine-learning techniques to infer Open Directory Project categories. But they suffer from two major drawbacks, the computational overhead to derive corpus statistics and inferring topic categories that are too abstract for semantic discrimination due to polysemy. Concepts too shallow or too deep in the semantic gradient are produced due to the wrong senses of the query terms coalescing with the correct senses. This paper proposes and demonstrates a succinct solution to these problems through a method based on the Tree cut model and Wordnet Thesarus to infer fine-grained topic categories for Web query classification, and also suggests an enhancement to the Tree Cut Model to resolve sense ambiguities.

The people in our society are highly depended on petroleum for their activities. The petroleum is a finite source and it produce several problems such as rising carbon dioxide level in the atmosphere. Around 75% of fuel produced is used for as an energy source for transportation, heat and electricity generation. This study was carried out to understand the effect of fuel injection pressure on the CRDI engine for the performance, combustion and emissions. This work has been done out on a four stroke, single cylinder diesel engine. The fuel injection pressure was varied from 400 bar, 500 bar and 600 bar by having the fuel injection angle as 20°bTDC. The collected data were analysed for various parameters such as brake specific fuel consumption (BSFC), brake thermal efficiency (BTE), CO, CO2, HC, NOxand Smoke emissions for diesel fuel. CO, HC and smoke emissions were reduced by increasing the fuel injection pressure. NO and CO2emissions were increasing by increasing the fuel injection pressure. This is due to injected fuel droplets find smaller as the injection pressure increase, which leads to improve atomization of the fuel. The BTE and SFC were not much varying.

Low productivity is a major issue to be addressed in solar still which is considered to be an economical and viable gadget used to convert brackish water into potable water in remote and rural regions of developing countries. In the present work, an attempt has been made to improve the productivity of solar still by incorporating fins and energy storage materials. Two identical single slope single basin solar stills were fabricated with an effective basin area of 0.5 m2 (1000 mm x 500 mm) and glazing inclination of 120 with the horizontal. Experiments were conducted to compare the performance of conventional solar still with finned solar still attached with paraffin wax as phase change material (PCM). Two different materials; Galvanized iron and Aluminium were used to fabricate the basin and tubular fins. The experimental results showed that the productivity and the daily efficiency of the solar still with fins and energy storage were higher compared to solar still with mere fins and solar still with mere energy storage. Further, solar still with Aluminium fins exhibited superior performance compared to the solar still with galvanized iron fins.

Solar still is a cheap and portable solar distillation system that can purify brackish water into potable water and is ideal for domestics use. Low productivity is a major issue that needs to be addressed in solar stills. In the present work, the efficiency of the fabricated single slope single basin solar still was enhanced by the incorporation of plate fins over the basin liner of the still. The daily productivity was further increased by attaching a latent heat energy storage unit to the still. Paraffin wax was used as phase change material (PCM) in the energy storage unit. Experiments were conducted on modified solar still for the following two cases (i) with mere plate fins and (ii) with plate fins and PCM. A 40.6% increase in productivity was observed for the solar still with mere fins and the productivity is increased by 94.51% for the solar still incorporated with both fins and PCM when compared with that of conventional still.

In this current work, we examine the Hyers-Ulam(H-U) stability results for a finite variable additive functional equation (Ref.[6]) in Intuitionistic Fuzzy Normed space(IFN-space) is discussed by means of direct and fixed point methods.

Now a days, extensive research on the 5G technology is on the rise. With the commercialization of the fifth generation (5G) mobile communication, high data rate communication and intelligent wireless services is approaching. In this project a wide band eight element MIMO (Multiple Input Multiple Output) array with high element isolation enrichment for 5G metal frame smart phones is presented. We built a rectangular patch antenna with 56 radiation and 2×4 elements. The MIMO microstrip antenna with 112 radiation using the microstrip feedline is designed for 5G wireless communication. The 2×4 MIMO microstrip antenna provides excellent results with a bandwidth impedance of 0.7GHZ and access to recovering 32dB loss to 7GHZ. The designed MIMO antenna array comprises of T shaped and inverted T shaped slots. To improve the bandwidth, the required resonances can be obtained by adjusting the E shaped slots. Furthermore, to improve the element isolation between two antennas, L and T shaped slot is introduced between each antenna element.

In this research work, it was attempted to give value addition to the waste decayed Manilkara Zapota fruit by producing bioethanol from it. Manilkara Zapota fruit wastes were taken as a substrate for the microorganism (Saccharomyces cerevisiae) to grow under a controlled environment in order to facilitate the fermentation process. The temperature of fermentation process was maintained at 37°C with the help of biological oxygen demand incubator for 72 hrs. Once the fermentation process was over the bio-ethanol was extracted by distillation process at the temperature of 72°C. The purity of the produced ethanol was identified using infrared spectroscopy and gas chromatography mass spectrometry. The physicochemical properties such as density, pH, molecular weight, octane number, flash point, freezing point and autoignition temperature were measured. The yield of bio-ethanol from decayed Manilkara Zapota fruits was found to be 10.45% (w/v). The GC-MS results infer that the purity of ethanol obtained in the sample is 99.09%.

Carbon dioxide is one of the greenhouse gases majorly contributing to the global warming and greenhouse effects. Combustion of fossil fuels such as coal, petroleum products and natural gas for power production, transportation and industrial applications produce maximum amount of carbon dioxide. Hence, reduction of CO2 emission is mandated to avoid additional add on to the atmosphere and control global warming. A new low cost carbon trapper using modified charcoals has been designed and tested in a stationary diesel engine for the reduction of carbon dioxide emission and results were reported in this article. Normal wooden charcoal was produced and impregnated with NaOH and KOH. These two modified charcoals, Normal wooden charcoal and commercially purchased activated charcoal were testes individually and compared with each other. Also the effect of amount of different charcoals at 100 grams, 200 grams and 300 grams on carbon dioxide reduction were also tested. The potassium hydroxide (KOH) impregnated wooden charcoal with 300 grams mass shows the best result of 63.92% CO2 reduction at 75% engine load and sodium hydroxide (NaOH) impregnated charcoal shows 62.89% reduction in CO2 at the same engine load due to increased adsorption along with absorption and high porosity.

In this paper, a new model for estimating the remaining electrical life of the AC contactor is proposed. The model involves an equation that use the rated and operational parameters, material properties and geometries to estimate electrical health of contactor. The variation in the contact resistance as a function of time is found varying in accordance with the remaining electrical life of the contactor. This characteristic parameter along with the data regarding the quantity of material lost at the contact surface has been fed as the sample data for the machine learning model. The sample data is carefully chosen from the contactors operating at different environmental conditions and utilization categories to include wide range of data. Using the collected data from contactors operating in varied environments and utilization categories a Stochastic Gradient Descent Classifier model is generated and used to estimate the remaining electrical life.

In this present work, a novel blend of biodiesel is used to investigate the performance and emission characteristics of an unmodified diesel engine. Pongamia Pinnata is used to extract oil and transesterification process is done to reduce its viscosity. Different fuel blends were prepared using biodiesel which includes D20 blend with diesel, K20 blend with Kerosene and M20 blend with Methanol, the fuel prepared were used in the engine to analyse the performance and emission characteristics of the engine. The results were compared with the standard fuel mineral diesel. A considerable increase in brake thermal efficiency is observed for D20 blend. The blend K20 shows considerable improvement in the performance as well as reduction in the emission when compared to all other fuels.

Nickel oxide nanoparticles have been synthesized via simple hydrothermal method. The structural, morphological, optical and magnetic properties of the as-synthesized products were examined by X-ray diffraction (XRD), scanning electron microscope, UV–Vis spectroscopy, photoluminescence (PL) and vibrating sample magnetometer (VSM). XRD patterns of pure cubic structured NiO nanoparticles were revealed with average grain size of 13 nm. The optical band gap was found to (3.69, 3.66 and 3.64 eV) decreases with increasing molar concentration of the precursor. PL spectra at room temperature showed a strong blue emission band and thereby confirm the above results. VSM results demonstrate that the NiO samples exhibit perfect room temperature ferromagnetism.

The increasing incidence of accumulation of microorganisms on polymeric membrane surfaces has motivated the present study to develop novel biofouling resistant membranes. Hydrophilic and quorum sensing inhibition properties of vanillin (4-hydroxy-3-methoxybenzaldehyde) have propelled the current investigation of employing it as a modifier for the fabrication of fouling resistant polyethersulfone (PES) membrane. The concentration of vanillin varied from 0.5 to 2 wt. % and N -methyl-2-pyrrolidone (NMP) was used as solvent. ATR-FTIR and thermogravimetry analysis showed that vanillin had a good compatibility with the PES membrane. The contact angle value of the neat PES membrane was 74.3° and it decreased up to 61.5° for 2 wt. % vanillin incorporated PES membrane. Moreover, the water flux also significantly improved up to 27.41 × 10 −6 L/m 2 s kPa. Antifouling propensity of the prepared membranes was evaluated by protein static adsorption and filtration of alginic acid solution. Among the membranes, PES (98 wt. %)/vanillin (2 wt. %) membrane exhibited the lowest flux reduction ratio of 26%. In addition, antibiofouling property of the membranes was assessed by disk diffusion assay technique and it showed that PES (98 wt. %)/vanillin (2 wt. %) membrane displayed the higher inhibition zone value of 3.10 ± 0.21 mm and 2.60 ± 0.18 mm for E. coli and P. aeruginosa respectively.

An attempt was made to optimize the key parameters of acid catalyst esterification and base catalyst transesterification processes for higher biodiesel yield from mahua oil with butanol using traditional optimization procedure. In esterification stage quantity of acid catalyst and molar ratio of butanol to mahua oil were considered for optimization of lowest value of free fatty acid (FFA). In transesterification stage molar ratio of butanol to mahua oil, quantity of alkaline catalyst, process temperature, process time and stirring speed were considered for maximum yield of mahua oil butyl ester. From the results, 6:1 molar ratio of butanol to mahua oil, 2% (w/w) concentrated sulphuric acid (H2SO4) were identified as optimized values with 1.1% FFA value which was reduced from 19.8%. In the second stage results, 6:1 molar ratio of butanol to oil, 1.5% (w/w) potassium hydroxide (KOH), 80 °C process temperature, 90 min process time and 500 rpm stirring speed were recorded as optimized values with 94.8% yield of mahua oil butyl ester. The butyl ester produced with optimum values of transesterification process parameters has been characterized and ensured the satisfaction of EN14214 biodiesel standards requirements.

The major rise in the demand for processed eggs in the food industry gives the opportunity to turn eggs finally into valuable food ingredients. Eggs are consumed not only for commercial uses like pastries, households hotels etc., and it is also used widely by the egg products manufacturing industries by giving the desired egg products in the form of powder and liquid according to the customer's requirements. Our project deals with the Continuous achievement of Total Solid percentage by using an automated system. Total Solid can be defined as the amount of solid content present in a litre of yolk or whole egg liquid. For example if a litre of yolk or whole egg liquid with certain measured Total Solid percentage is taken and dried we will get the exact quantity of dry powder as same as measured total solid percentage. Earlier it was a manually operated system which was carried out after the two storage tanks has filled to its full capacity. In the automated process two pumps has been set up permanently between the yolk and whole egg liquid storage tanks and the Total Solid is continuously monitored and measured above a certain level by using the advanced Total Solid meter and transfer of yolk, whole egg liquids is done between the two tanks according to the required Total Solid percentage of yolk and whole egg liquids respectively. Therefore by transferring the yolk to whole egg or whole egg to yolk we can able to achieve the required Total Solid percentage. After the achievement of required Total Solid percentage the yolk and whole egg liquids are sent for the further processing as described in materials and methods. The automated process is continued without any break by controlling and maintaining the Total Solid percentage of both yolk and the whole egg liquids with the use of advanced Total Solid meter.

Coconut palm (Cocos nucifera L.), a versatile tree crop with multifarious uses, is important for the livelihood security of millions of people in India. Root (wilt) disease (RWD) is a major production constraint causing an estimated yield loss of 968 million nuts in southern India. Affected palms show bending of leaflets (flaccidity), foliar yellowing, and marginal necrosis. Phytoplasmas have been observed to be associated with this disease by electron microscopy (EM) and transmission (3) but not characterized. Attempts made in the past decade to detect a phytoplasma associated with RWD through PCR using universal primers had inconsistent results so we designed two primer sets (1F7 [AGTGCTTAACACTGTCCTGCTA]/7R3 [TTGTAGCCCAGATCATAAGGGGCA], 3Fwd [ACCTGCCTTTAAGACGAGGA]/3Rev [AAAGGAGGTGATCCATCCCCACCT]) and seminested primer pair 1F7/7R2 (GACAAGGGTTGCGCTCGTTTT), 3Fwd/5Rev (ACCCCGAGAACGTATTCACCGCGA) from sequencing of a 1.8-kb fragment (GenBank No. FJ794816) amplified by primers P1/P7 from a diseased sample. These new primer pairs were used for the detection of phytoplasma from five symptomatic and five asymptomatic palms from Kasaragod (where disease is not endemic), 14 symptomatic palms from Kayamkulam (endemic area), and 10 palms from disease-free areas (Kidu, Karnataka) using PCR. DNA was extracted from 3 g of spindle leaf (two to three leaflets) midrib tissues using a modified phytoplasma enrichment protocol in which an addition of 5% polyvinylpolypyrrolidone (MW of 40,000) during tissue grinding was essential. PCR was performed for 35 cycles with an annealing temperature of 63°C to avoid nonspecific amplification. A 1.3-kb amplicon was seen in two of the five samples and the positive control sample (sugarcane grassy shoot DNA) using the seminested primer pair 3Fwd/3Rev–3Fwd/5Rev. The amplicons were cloned and sequenced and a representative sequence was deposited in GenBank (GQ850122). With the 1F7/7R3-1F7/7R2 seminested primers, a 493-bp product was obtained from 13 of 14 palms from Kayamkulam and all five diseased palms from Kasaragod. No amplification was seen from healthy palms. A BLAST search showed that the RWD phytoplasma 16S rRNA gene sequence has >96% nt identity with 16SrXI and 16SrXIV group phytoplasmas and 99% identity with sugarcane white leaf phytoplasma (AB052874), On the basis of the identity of the 16Sr RNA gene 3Fwd/5Rev region, RWD phytoplasma belongs to the 16SrXI group. A phylogenetic tree (neighbor-joining method) also revealed clustering of the coconut phytoplasma with the 16SrXI group phytoplasmas and virtual restriction fragment length polymorphism analysis (4) also placed it into group 16SrXI. Other phytoplasmas infecting coconut are found in groups 16SrIV (1) and 16SrXIV (2). Our RWD phytoplasma sequence does not match an earlier reported Kerala (wilt) coconut phytoplasma sequence (AY158660) and the latter sequence does not have similarity with any known phytoplasma sequences in the database. To our knowledge, this is first report of the association of 16SrXI group phytoplasma with the root wilt disease of coconut in India. These findings could be used for the early detection of root wilt disease phytoplasma in breeding materials and to develop a DNA-based diagnostic kit. References: (1) N. A. Harrison et al. Ann. Appl. Biol. 153:85, 2008. (2) N. Nejat et al. Am. J. Appl. Sci. 6:1331, 2009. (3) M. Sasikala et al. Eur. J. Plant Pathol. 94:191, 2005. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2007.

This research work is mainly focused on the extraction of biofuel from Martynia annua seed through a slow pyrolysis process and its utilization as an alternative fuel for the diesel engine. The various properties of biofuel were investigated and the suitability of blending with diesel was also investigated. The pyrolysis process was carried out using a fixed bed batch type reactor unit with an electrical heater after the sample has undergone a pre-treatment process. The pyrolysis process was carried out at 650 °C with a particle size of 250 μm and 3 h of reaction time. The physicochemical properties of pyrolysis oil produced were determined and reported. The produced pyrolysis oil was tested in a diesel engine at different proportions with diesel. From the experimental work, it was found that blend MAPO20 recorded the lowest BSEC at all loads among other blends and diesel. Blend MAPO20 produced the highest BTE of 30.77% which is 2.92% higher than diesel and blend MAPO40 produced BTE at par with diesel. Martynia annua seed pyrolysis oil can replace the petrodiesel up to 40% in an unmodified diesel engine without any major variation in performance and emissions.

Edge detection is an image processing method used for discover the limitations of objects within the image. It works by sensing incoherence in illumination. Edge detection is used for image segmentation and data extraction in areas such as image processing, computer vision and machine vision. In these four techniques such as Sobel Operator, Robert Operator, Prewitt Operator, and Canny Operator are used for detection of edge detection in which the canny operator is the most effective manner of finding the edge detection using X-rays. The key aim of this task is to sense human minor leg bone fracture from X-Ray imageries. The suggested structure has two steps namely pre-processing segmentation and fracture detection. Canny method produces very effective image. This paper compares the various edge detection techniques for detecting the bone fracture of lower leg bone and finds effective. The performance of the four segmentation techniques are compared based on the execution time and accuracy. The execution speed of Canny operator is 32.5 seconds and accuracy is 88.7%.

The economic development of any country is appreciably affected by the extensive use of rapidly depleting fossil resources. Identifying new, renewable based energy resource is of vital importance and is a global requirement too. This study focusses attention on the introduction of a new biodiesel resource Manilkara zapota seed oil, production and characterization of biodiesel from M. zapota seed oil. The raw oil is extracted from the seed by a mechanical expeller. The composition of fatty acids and physicochemical properties of the raw oil have been estimated. The suitability of M. zapota seed oil for biodiesel production was studied based on its chemical structure and physicochemical properties. Methyl ester was produced from the raw M. zapota seed oil using transesterification process using an alkaline catalyst. The composition of fatty acids and physicochemical properties of the biodiesel derived have been estimated and compared with EN14214 biodiesel standards. The new biodiesel M. zapota methyl ester meets the EN14214 biodiesel standards and could be a reliable substitute to diesel in diesel engine applications.

This article considers an experimental study of Taguchi’s parameters design to maximize the corrosion resistance of electroless Ni-P-nano-TiO2 on low carbon steel substrate. The experiments were carried out based on Taguchi’s L9 orthogonal array considering four coating parameters of three levels each namely, Bath Temperature, pH of bath, Bath Loading, and concentration of TiO2. Scanning Electron Microscope (SEM) equipped with Energy Dispersive X-ray Spectroscopy (EDS) facilitated the study of the surface morphology and the chemical composition of the coatings. Corrosion performance of the deposits was evaluated by Tafel polarization technique in 3.5 wt. % of NaCl solution. The observation shows that pH level has more significant influence on the corrosion behavior of the composite deposit. The experimental study revealed that the optimum conditions are A3B3C2D1 (Temperature of 88° C, pH of 6, bath loading of 0.5 dm2/l, and TiO2 concentration of 2 g/l).

In this study, xanthan gum (XA) was used as a hydrophilic biopolymer additive for the modification of polyethersulfone (PES) membrane to removal of humic acid (HA). The membranes are prepared using phase inversion technique and the concentration of XA was varied from 0.5 to 1.5 wt%. The prepared membranes are characterized as a function of hydrophilicity, equilibrium water content (EWC), porosity studies and functional group analysis. Membrane surface and cross-sectional morphology was studied using scanning electron microscope. The lower contact angle value 64.2° was exhibited, when 1.5 wt% of XA incorporated in PES membrane and this ensures that increase of hydrophilicity in pristine PES membrane. Further, higher water permeability (PWP) of 68.9 −9 m/s kPa was observed for 1.5 wt% of XA/PES membrane. The effect of pH on HA removal was studied for neat PES and XA/PES membranes. The rejection performance of XA incorporated in PES membranes were compared with commercial available PES membrane.

Biofouling is a severe problem in membrane systems which hampers their broad applications because it requires regular chemical cleaning, reduces membrane life, and also decreases product quality. In this study, nanocurcumin (CCM) was prepared by sonication-assisted wet-milling technique and then incorporated in polyethersulfone (PES) membrane to enhance the anti-biofouling property. TEM analysis of the curcumin showed that nanomaterials are spherical. FTIR studies confirmed that the presence of CCM nanomaterial in PES membrane. Zone inhibition studies revealed that PES/CCM nanocomposite membranes exhibited the better anti-biofouling propensity against Escherichia coli and Pseudomonas aeruginosa. Static adhesion studies also showed that PES/CCM nanocomposite membranes prevented the attachment and proliferation of E. coli cells. Also, PES/2 wt% CCM nanocomposite membrane had a high thermal degradation temperature of 575.62 °C and tensile strength of 1.87 MPa. Moreover, addition of CCM nanomaterial in casting solution altered the membrane morphology and hydrophilicity. Further, pure water flux was increased up to 64.48 L·m−2·h−1 for PES/2 wt% CCM nanocomposite membrane. Filtration of raw sewage treatment plant effluent was also carried out. The incorporation of curcumin in membranes was effectively improved the antifouling tendency without compromised affecting the chemical oxygen demand reduction. This study highlights the anti-biofouling potential of CCM incorporated PES nanocomposite membranes, which could be utilized for various filtration applications.