Search

Studies of dynamic frequencies are an important stage in designing multistage vane pumps. This research aimed to confirm the rigidity and vibrational reliability of the pump rotor. Based on the recommendations of J.F. Gülich, the nominal rotational speed of the rotor shaft should differ from the cutoff speed by no less than 25 %. The Lomakin effect supposes taking into consideration the hydrodynamic forces acting in the gap seals and having a damping effect on the pump rotor. This research solved the problem of developing and verifying a numerical method of calculating hydrodynamic forces, which arise in seals of vane pumps at critical speeds. The studies were conducted on a ‘dry’ model of the rotor using ANSYS Mechanical software package. During computational modeling of bearings and seals, the COMBIT214 ele¬ment was used where the stiffness coefficient values were set. These values were determined by calculating the flow parameters in the gap seal using ANSYS CFX. The proposed method was verified using the experimental data obtained. The seal rigidity was calculated for different operating modes of the pump. It was shown that the hydrodynamic forces which arose in the gap seals had a significant influence on the rotor’s critical speed. Accounting for these forces increased the main own frequency of the rotor by approximately 44 %. This fact had a significant qualitative and quantitative impact on the vibrational characteristics of the pump. This study showed that the value of the hydrodynamic force was influenced by several factors: shaft deflection, differential pressure and geometry of the gap seal. The proposed method is recommended for use for multistage centrifugal pumps.

This paper introduces a bulk-flow model for prediction of the static and dynamic force coefficients of angled injection Lomakin bearings. The analysis accounts for the flow interaction between the injection orifices, the supply circumferential groove, and the thin film lands. A one control-volume model in the groove is coupled to a bulk-flow model within the film lands of the bearing. Bernoulli-type relationships provide closure at the flow interfaces. Flow turbulence is accounted for with shear stress parameters and Moody’s friction factors. The flow equations are solved numerically using a robust computational method. Comparisons between predictions and experimental results for a tangential-against-rotation injection water Lomakin bearing show that novel model well predicts the leakage and direct stiffness and damping coefficients. Computed cross-coupled stiffness coefficients follow the experimental trends for increasing rotor speeds and supply pressures, but quantitative agreement remains poor. A parameter investigation shows evidence of the effects of the groove and land geometries on the Lomakin bearing flowrate and force coefficients. The orifice injection angle does not influence the bearing static performance, although it largely affects its stability characteristics through the evolution of the cross-coupled stiffnesses. The predictions confirm the promising stabilizing effect of the tangential-against-rotation injection configuration. Two design parameters, comprised of the feed orifices area and groove geometry, define the static and dynamic performance of Lomakin bearing. The analysis also shows that the film land clearance and length have a larger impact on the Lomakin bearing rotordynamic behavior than its groove depth and length.

The paper deals with the static stability of annular gas seals under choked flow conditions. For a centered straight annular seal, choking can occur only in the exit section because the gas is constantly accelerated by friction forces. From the mathematical standpoint, the flow choking corresponds to a singularity that was never dealt with numerically. The present work introduces an original numerical treatment of this singularity that is validated by comparisons to the analytical solution for planar channel flow. An interesting observation stemming from these results is that the usual hypothesis of considering the flow as being isothermal is not correct anymore for a gas accelerated by a pressure gradient; the characteristics of the flow are the same but the quantitative results are different. The analysis of eccentric annular seals then shows that choked flow conditions produce a change in the static stiffness. For a subsonic exit section, the Lomakin effect is represented by a centering radial force opposed to the rotor displacement. For a choked exit section, the radial force stemming from an eccentricity perturbation has the same direction as the rotor displacement. The annular seal becomes then statically unstable. From the physical standpoint, this behavior is explained by the modification of the Lomakin effect, which changes sign. The pressure and Mach number variations along the seal depict the influence of high compressible flow regimes on the Lomakin effect. This characteristic has never been depicted before.

This work presents a thin film flow model for analyzing the static and dynamic characteristics of centered, eccentric or misaligned tangential-against-rotation injection Lomakin bearings. The Lomakin bearing is a recent device intended for use in modern turbomachinery and having characteristics similar to hybrid bearings. It can be described as an ensemble of two opposing straight annular seals separated by a circumferential feeding groove. The fluid is supplied to the groove via orifice restrictors. Their tangential inclination generates an against-rotation circumferential flow in the groove that further penetrates into the thin film. This effect, known from annular seals as the prerotation speed, improves the dynamic characteristics of the bearing. A good description of the flow in the circumferential groove and the thin film is obtained from a full Navier–Stokes calculation of the centered bearing. The zero and first order analyses are then carried out by recognizing the crucial importance of taking into account the interaction between the flow in the thin film lands, the circumferential groove and the supply orifices. Due to the high Reynolds number regime, the land flow is governed by the two-dimensional thin film inertia equations (the “bulk flow” model). A one-dimensional circumferential flow dominated by inertia forces is assumed to take place in the groove and is described by an appropriate bulk flow equation. The flows in the supply orifices, the groove and the thin film lands are linked together by the same mass flow rate balance algorithm as used for hydrostatic and hybrid bearings analysis. The algorithm is extended to Lomakin bearings by considering the groove areas surrounding each orifice as a row of intercommunicating feeding pockets. This approach enables the analysis of centered, eccentric or misaligned Lomakin bearings. Comparisons with water-lubricated test results are used to validate the present model. For the zero eccentricity case a good agreement is obtained for the cross-coupled stiffness and for the whirl frequency ratio. A parametric study shows the variation of the bearing characteristics with increasing static eccentricity or misalignment.

The paper introduces a bulk-flow model for prediction of the static and dynamic force coefficients of angled injection Lomakin bearings. The analysis accounts for the flow interaction between the injection orifices, the supply circumferential groove, and the thin film lands. A one control-volume model in the groove is coupled to a bulk-flow model within the film lands of the bearing. Bernoulli-type relationships provide closure at the flow interfaces. Flow turbulence is accounted for with shear stress parameters and Moody’s friction factors. The flow equations are solved numerically using a robust computational method. Comparisons between predictions and experimental results for a tangential-against-rotation injection water Lomakin bearing show the novel model predicts well the leakage and direct stiffness and damping coefficients. Computed cross-coupled stiffness coefficients follow the experimental trends for increasing rotor speeds and supply pressures, but quantitative agreement remains poor. A parameter investigation evidences the effects of the groove and land geometries on the Lomakin bearing flowrate and force coefficients. The orifice injection angle does not influence the bearing static performance, although it largely affects its stability characteristics through the evolution of the cross-coupled stiffnesses. The predictions confirm the promising stabilizing effect of the tangential-against-rotation injection configuration. Two design parameters, comprising the feed orifices area and groove geometry, define the static and dynamic performance of Lomakin bearing. The analysis also shows that the film land clearance and length have a larger impact on the Lomakin bearing rotordynamic behavior than its groove depth and length.Copyright © 2002 by ASME

Ultrashort microscale high-speed gas bearings exhibit a whirl instability limit and dynamic behavior much different from conventional hydrostatic gas bearings. In particular, the design space for a stable high-speed operation is confined to a narrow region and involves a singular behavior. The previously developed ultrashort gas bearing theory (Liu et al. (2005, “Hydrostatic Gas Journal Bearings for Micro-Turbomachinery,” ASME J. Vibr. Acoust., 127(2), pp. 157–164)) assumed fully developed flow in the journal bearing gap. There is experimental evidence that this assumption might not be fully applicable for the relatively short flow-through times in such bearings. This has an impact on the estimation of whirl instability onset, bearing operability and power requirements. In this paper, unsteady flow effects in the bearing gap are investigated with the goal to quantify their impact on the bearing dynamic behavior. It is shown that although three-dimensional flow calculations in the ultrashort journal bearing are necessary to quantify the onset of whirl instability, the underlying mechanisms can be qualitatively described by the impulsive starting of a Couette flow. Using this description, two time scales are identified that govern the journal bearing dynamic behavior: the viscous diffusion time and the axial flow-through time. Based on this, a reduced frequency parameter is introduced that determines the development of the flow field in the journal bearing and, together with bearing force models, yields a criterion for whirl instability onset. Detailed three-dimensional computational fluid dynamics calculations of the journal bearing flow have been conducted to assess the criterion. A singular behavior in whirl ratio as a function of the reduced frequency parameter is observed, verifying the refined stability criterion. Using high-fidelity flow calculations, the effects of unsteady journal bearing flow on whirl instability limit and bearing power loss are quantified, and design guidelines and implications on gas bearing modeling are discussed. The stability criterion is experimentally validated demonstrating repeatable, stable high-speed operation of a novel microbearing test device at whirl ratios of 35.

Pemphigus vulgaris is a severe, socially significant autoimmune disease associated with autoantibodies to the desmoglein 3 antigen. The disease affects all age groups, beginning at 18 years of age; the mortality rate of pemphigus can reach as high as 50%, depending on a patients age and a number of other factors. There is no highly selective or personalized therapy for pemphigus vulgaris at the moment. One of the well-known therapeutic approaches to the disease is to use rituximab, an anti-CD20 antibody that can help achieve B cell depletion in peripheral blood. To solve the problem of nonspecific elimination of B cells in patients with pemphigus vulgaris, it is reasonable to use specific immunoligands, their choice being based on an assessment of the level of autoantibodies specific to each of the fragments of desmoglein. In this work, the proportion of autoreactive B cells in patients diagnosed with pemphigus vulgaris is found to be 0.090.16%; a positive correlation was revealed between the antibody level and the number of autoreactive B cells to various fragments of desmoglein.

In oil producing wells with high gas content, an increase in the efficiency of centrifugal pumps is achieved by equipping them with centrifugal gas separators, in which, before entering the pump intake, most of the free gas is taken from the pumped fluid and discharged into the annulus of the well. The efficiency of a centrifugal gas separator significantly depends on the size of the dispersity of the gas-liquid structure of the pumped fluid, on the diameters of gas bubbles, the water cut of the formation fluid, the presence of surfactants, and the pressure at the inlet and outlet of the pump. In the article, based on the analysis of the structural diagrams of the power part of gas separators of various manufacturers, the analysis of the gas-liquid mixture flow features in the separation chamber and the outlet device, recommendations are made for optimizing the separation chamber length and the gas separator head outlet design. Recommendations are proposed for changing the flow path to increase the efficiency of gas separation and reliability of operation. Explanations of the expediency of new design solutions based on empirical formulas and numerical simulations are proposed. It is shown what the information is most important and how it can be obtained in bench tests.

A radical reduction in power consumption is becoming an important task in the development of supercomputers. Artificial neural networks (ANNs) based on superconducting elements of spintronics seem to be the most promising solution. A superconducting ANN needs to develop two basic elements - a nonlinear (neuron) and a linear connecting element (synapse). The theoretical and experimental results of this complex and interdisciplinary problem are presented in this paper. The results of our theoretical and experimental study of the proximity effect in a stacked superconductor/ferromagnet (S/F) superlattice with Co-ferromagnetic layers of various thicknesses and coercive fields and Nb-superconducting layers of constant thickness equal to the coherence length of niobium and some studies using computer simulation of the formation of such multilayer nanostructures and their magnetic properties are presented in this article.

Theoretical foundations for the development of environmental protection measures in Russia and the world, the issues of investing in environmental protection are studied. The scientific novelty lies in the fact that based on the use of a variational series of the studied parameters, a machine learning model “Decision Tree” was developed, with the help of which a predictive value of the amount of investment in environmental protection measures was formed. The relevance lies in the fact that to determine the volume of investment in environmental measures in the country, an artificial intelligence system was used – machine learning “Decision tree” (ML “Decision tree”), which made it possible to successfully solve a complex problem due to the influence of many factors on the parameter under study. The use of the proposed approach is especially relevant in the light of the May Decrees of the President of the Russian Federation. In 2018, in the Decrees of the President, strategic principles for the development of the country were formulated, aimed at the formation of a “digital economy”, designed to ensure further movement in accordance with the “Strategy for Scientific and Technical Development of Russia” in the main direction, according to which, as a foundation for the implementation of innovative changes in the state will use digital technologies. With the help of the artificial intelligence system, a forecast was formed for such a parameter as the volume of investment in the country in environmental measures for the next year, namely 6.2221 million rubles.

Relevance. The guided bone regeneration (GBR) technique during dental implant treatment, if alveolar bone/part of the jaws is lost, stands out for its effective potential, the main factor of which is the possibility of the necessary bone volume restoration having morphofunctional signs of organotypicity. The prognosis effectiveness of such reconstruction outcome directly depends on the wound process characteristics. The variability of the latter, subject to an unbiased quantitative assessment, can be essential for predictive analysis and prognosis.Aim. The study aimed to develop a technique for quantitative assessment of surgical wound healing (exemplified with an extracted tooth socket), described in the first part of the publication.Materials and methods. The clinical study involved 20 patients of both sexes diagnosed with the condition after dental implantation and reconstruction of the alveolar bone volume using the GBR technique modified by the formation of a situational vicryl framework (SVF). We determined the following parameters: independent and dependent variables, with their indirect mutually dependent influence on a favourable, compromised or unfavourable treatment outcome, based on the wound healing process follow-up and assessment of immediate results in the early, middle and late postoperative period − up to 1 month, and the analysis of delayed – from 1 month to 1 year, and long-term – over one year. These variables are characterized as quantitative indicators – biomarkers, processed by the correlation and regression analysis using the Gretl statistical package.Results. The study revealed a direct correlation regarding all parameters as independent (factor) and dependent (effect) variables necessary for quantifying the wound healing process variability. The created linear regression model confirmed the empirically observed and theoretically substantiated idea of the reciprocal influence of normal and pathological variations of wound healing process on an outcome of dental implantation in the reconstruction of the alveolar bone defect. The correlation and regression analysis for an unbiased quantitative assessment of surgical wound healing demonstrated the statistically explicable behaviour of dependent variables at a 95% le vel.Conclusion. The correlation and regression analysis performed using the presented data indicates a direct correlation between the parameters of a favourable, compromised and unfavourable outcome of dental implantation during the reconstruction of the alveolar bone volume using the GBR technique modified by the formation of SVF and variables expressed by biomarkers, such as the initial complexity of clinical conditions, duration of surgery, mechanical load of the wound, bio-reactive properties of the additional materials required in the w ound.

Acne vulgaris is a chronic disfiguring skin disease affecting ∼1 billion people worldwide, often having persistent negative effects on physical and mental health. The Gram-positive anaerobe, Cutibacterium acnes is implicated in acne pathogenesis and is, therefore, a main target for antibiotic-based acne therapy. We determined a 2.8-Å resolution structure of the 70S ribosome of Cutibacterium acnes by cryogenic electron microscopy and discovered that sarecycline, a narrow-spectrum antibiotic against Cutibacterium acnes, may inhibit two active sites of this bacterium's ribosome in contrast to the one site detected previously on the model ribosome of Thermus thermophilus. Apart from the canonical binding site at the mRNA decoding center, the second binding site for sarecycline exists at the nascent peptide exit tunnel, reminiscent of the macrolides class of antibiotics. The structure also revealed Cutibacterium acnes-specific features of the ribosomal RNA and proteins. Unlike the ribosome of the Gram-negative bacterium Escherichia coli, Cutibacterium acnes ribosome has two additional proteins, bS22 and bL37, which are also present in the ribosomes of Mycobacterium smegmatis and Mycobacterium tuberculosis. We show that bS22 and bL37 have antimicrobial properties and may be involved in maintaining the healthy homeostasis of the human skin microbiome.

The article considers the theoretical foundations for assessing and forecasting the sustainability of the development of the Russian economy using artificial intelligence systems. The relevance of the study lies in the fact that in modern conditions the question of the formation of methodological approaches for a balanced sustainable development of the economy is particularly acute. The novelty of the study lies in the fact that an approach is proposed that involves the use of a certain system of macroeconomic indicators that reflect the dynamics of development of both the real sector of the economy and the parameters of the development of the fi nancial sector to predict the GDP of the Russian Federation using the "Perceptron" AI system. An analysis was made of both the dynamics of macroeconomic indicators of the real sector of the economy and the parameters of the development of the fi nancial sector of the Russian Federation. The authors considered the advantages of using the VaR model indicator as a measure of risk to assess the fi nancial risk of reducing the GDP of the Russian Federation. The "Perceptron" program was developed using the Deductor platform to predict the dynamics of the RF GDP. A wide range of fi nancial mathematics tools proposed by individual authors for assessing and minimizing fi nancial risk, including quantile hedging, defi cit hedging with minimal risk, and optimal quadratic hedging, are considered. The architecture of the neural network, in addition to the input layer, has two hidden layers, and an output layer with one parameter. The neural network "Perceptron" shows a high accuracy of the forecast.

the article presents the results of studies on approbation of a test system for the indication and identification of microscopic fungi Aspergillus flavus by the polymerase chain reaction method with real-time detection. Using software Multiple Sequence Alignment Viewer 1.22.1 and UGENA 44.0. The test system for A. flavus includes specific primers: forward primer (f) 5’-3’ GGGCCCGCAGCAAGAATAC, reverse primer (r) 3’-5’ ACGAGTTGTCACCTTCCCGAGA; fluorescent dye: HEX, probe - CGGTTCGCTTTGGTCATCGT, quencher BHQ2. Reaction protocol: preliminary denaturation - 95 0C - 5 minutes (1 cycle); denaturation - 95 0C - 5 sec, annealing - 60 0C - 15 sec (50 cycles). Probe: AGCATAGGCTGATGCTCGTAGGC, fluorescent dye - ROX, quencher - BHQ-2. The sensitivity of the test system is 1000 cells. The optimal concentration of primers was set equal to 9 pM of each primer per reaction. The optimal probe concentration is 0.4 pM. The results obtained indicate that the use of dichotomous keys does not allow the most accurate differentiation of phytopathogenic fungi A. flavus. A new approach to the identification of isolates confirmed the belonging of 15 isolated strains to the species A. flavus out of 20 isolated from corn samples with signs that manifest themselves as root rot and wilting, and initially typed as Aspergillus based on the study of cultural and morphological properties. The study was carried out according to the thematic plan-task of the Ministry of agriculture of the Russian Federation, the registration number of the INIS RTD 122030200367-8.

Introduction. Cross-laminated timber (CLT) has started to win a market in Russia. Humidity plays an important role in ensuring the operational reliability of buildings based on timber structures. The lack of comprehensive studies on the influence of varying temperature and humidity actions, including atmospheric ones, hinders the development of CLT.Aim. In this work, the influence of atmospheric actions on various types of CLT building structures was determined in order to amend the requirements in SP 64.13330.2017 for the design and protection of CLT structures.Materials and methods. Samples of CLT wall panels and floor slabs manufactured as per the current regulatory documents were used as an object of research. Field tests were developed in order to determine the influence of atmospheric actions on the strength and elastic characteristics of CLT panels.Results. Atmospheric actions have an adverse effect on the strength and elastic characteristics of CLT panels. The decrease in the strength and elastic characteristics varies for the samples of floor slabs and wall panels.Conclusion. It is proposed that several recommendations given based on the experimental results on the resistance CLT to atmospheric actions are to be included in SP 64.13330.2017 for the design, manufacture, and construction of buildings using CLT structures.

The regulatory functions of the B-cell compartment play an important role in the development and suppression of the immune response. Disruption of their anti-inflammatory functions may lead to the acceleration of immunopathological processes, and to autoimmune diseases, in particular. Unfortunately, the exact mechanism underlying the functioning and development of regulatory B cells (Breg) has not yet been fully elucidated. Almost nothing is known about their specificity and the structure of their B-cell receptors (BCRs). In this research, we analyzed the BCR repertoire of the transitional Breg (tBreg) subpopulation with the CD19+CD24highCD38high phenotype in patients with multiple sclerosis (MS), using next-generation sequencing (NGS). We show, for the first time, that the immunoglobulin germline distribution in the tBreg subpopulation is different between MS patients and healthy donors. The registered variation was more significant in patients with a more severe form of the disease, highly active MS (HAMS), compared to those with benign MS (BMS). Our data suggest that during MS development, deviations in the immunoglobulin Breg repertoire occur already at the early stage of B-cell maturation, namely at the stage of tBregs: between immature B cells in the bone marrow and mature peripheral B cells.

BACKGROUND: Noise at production site or at any other place where technical equipment operates is a huge issue. It has a strong negative effect on human nervous system, reduces average lifespan and causes a number of severe diseases. That is why reduction of noise, produced by pumps, is one of the current priorities of hydraulic engineering. AIMS: In this study, the experimental research of sound transmission through an operating pump and a non-operating pump was carried out. The aim of the research is to find out, whether the last stage of a multistage pump is the main source of hydrodynamic noise (HDN) in pressure line (or the first stage in suction line), or all stages somehow contribute to HDN. METHODS: The experiment was carried out on the TsN-2 two-stage impeller pump. In order to generate a sinusoidal signal, an imbedded generator, a vibration test rig and a power amplifier were used. Data acquisition for measurement of HDN and vibrations was performed with use of a conditioning amplifier, a hydrophone and an accelerometer. A 4-channel spectrum analyzer served as a device for processing the studied signal. In addition, a theoretical calculation, considering some physical assumptions, was carried out in order to obtain a more general and accurate concept. RESULTS: After completing the experiment, hydrodynamic noise levels and differences for three cases were obtained. These cases are for the switched-on pump, the switched-off pump and for the pump with the removed stage. The data obtained with hydrophones (hydrodynamic noise levels) was correlated with the data obtained with accelerometers (vibration levels). As the correlated data analysis result, the sound insolation distribution over the spectrum was obtained. CONCLUSIONS: According to the study results, it can be concluded that the absence of one of two stages ambiguously affected on the sound-insolation properties of the pump. Moreover, no firm conclusions can be drawn about the pump operation influence on the change in its sound-insolation properties.

As a key regional player, Germany can make a significant contribution to the defense of NATO and the EU. By employing militarily and politically the essential ground forces, which can form the basis when organizing the defense of other members of the Alliance, in the context of the application of Article 5 of the North Atlantic Treaty, Germany’s policy on Bundeswehr reform and the costs of this reform deserve special attention. Whereas in the second track, the vector of work as well as the amount of military aid is very clear, in the case of the armed forces reform there are certain peculiarities. After a long period of stagnation and underfunding of the German Army, the trend is reversed. Today, the German politico-military leadership is striving to achieve more sovereignty and autonomy in the military sphere. As of 2022, the Bundeswehr is an active participant in NATO’s international missions and operations. It forms the backbone of the Alliance’s rapid reaction force in Eastern Europe, cooperating with other Eastern European states on the intergovernmental level. There is also an active partnership through Permanent Structured Cooperation (PESCO) in the context of the Common Security and Defense Policy within the European Union. The prospect of implementing the set of reforms opens a window of opportunity for Germany to increase its national politico-military capabilities in Europe, which could be realized in the field of consolidating the country as one of the regional hegemons. Besides, within the framework of the new NATO Concept, there is a provision of building up the rapid reaction force on the eastern border of the Alliance, which is actively supported by the Bundeswehr. This could lead to an even greater escalation of the conflict between NATO and the Russian Federation.

The natural history of cancers can be understood through the lens of evolution given that the driving forces of cancer development are mutation and selection of fitter clones. Cancer growth and progression are spatial processes that involve the breakdown of normal tissue organization, invasion and metastasis. For these reasons, spatial patterns are an integral part of histological tumour grading and staging as they measure the progression from normal to malignant disease. Furthermore, tumour cells are part of an ecosystem of tumour cells and their surrounding tumour microenvironment. A range of new spatial genomic, transcriptomic and proteomic technologies offers new avenues for the study of cancer evolution with great molecular and spatial detail. These methods enable precise characterizations of the tumour microenvironment, cellular interactions therein and micro-anatomical structures. In conjunction with spatial genomics, it emerges that tumours and microenvironments co-evolve, which helps explain observable patterns of heterogeneity and offers new routes for therapeutic interventions.

Increase in the service life and noise reduction in pumps is an important area in modern pump engineering. An attempt was made to introduce conjugate calculations in verifying correct operation of the mathematical model as the first step and identifying the main oscillation frequencies of the pump housing subsequently. The FSI interface was used in conjugate calculations at the boundary between liquid and solid media. The obtained oscillation signals were analyzed using the Fourier analysis to identify the main parasitic frequencies in the pump. It was expected that the main parasitic frequency would be the blade frequency. As a result of calculations, it became possible to verify correct operation of the mathematical model by applying it to the simplest model of a glass, which behavior could be easily explained. The mathematical model was tested on cantilever and multistage pumps, demonstrated good results and made it possible to establish that blade frequency was the main oscillation frequency.

The COVID-19 mortality is associated with an increase in interleukin-6 (IL-6) levels. Levilimab is an anti–IL-6 receptor antibody with proven clinical efficacy in patients with severe COVID-19.The aim of the study was to assess the association of COVID-19 severity and levilimab effectiveness with IL-6 levels and to explore the potential for using levilimab in other conditions accompanied by cytokine release syndrome.Materials and methods: the subgroup analysis was based on the data of COVID patients with known baseline IL-6 levels from the CORONA clinical study. Subgroups were formed according to baseline IL-6 levels: ≤5 pg/mL (normal) and >5 pg/mL (elevated). The subgroup analysis included descriptive statistics of the patients and time courses of their clinical and laboratory findings (at screening, on the day of investigational product administration, and further until day 14). In order to compare the percentages of patients who had required rescue therapy, the authors used Fisher's exact test.Results: the subgroup analysis included 91 patients (47 from the levilimab group and 44 from the placebo group). At baseline, the authors observed elevated levels of IL-6 in 31/47 (66%) subjects in the levilimab group and 29/44 (48.4%) subjects in the placebo group. The subjects with elevated IL-6 demonstrated more pronounced clinical signs of pneumonia and abnormalities in inflammatory markers. Elevated baseline IL-6 levels were associated with the need for rescue therapy (OR=3.714; 95% CI: 1.317–9.747; p=0.0183); this association was stronger in the placebo group (OR=8.889; 95% CI: 2.098–33.31; p=0.0036). Also, the placebo group showed long-term abnormalities in the clinical and laboratory findings.Conclusions: IL-6 is one of the key elements in the pathogenesis of cytokine release syndrome related to COVID-19 and other conditions. Elevated IL-6 levels are associated with the severity of COVID-19. Inhibition of IL-6 receptors by levilimab leads to clinical improvement in patients with severe COVID-19, suggesting the effectiveness of levilimab in pathogenesis-oriented therapy for cytokine release syndrome of other aetiologies.

Genome sequencing of cancers often reveals mosaics of different subclones present in the same tumour1–3. Although these are believed to arise according to the principles of somatic evolution, the exact spatial growth patterns and underlying mechanisms remain elusive4,5. Here, to address this need, we developed a workflow that generates detailed quantitative maps of genetic subclone composition across whole-tumour sections. These provide the basis for studying clonal growth patterns, and the histological characteristics, microanatomy and microenvironmental composition of each clone. The approach rests on whole-genome sequencing, followed by highly multiplexed base-specific in situ sequencing, single-cell resolved transcriptomics and dedicated algorithms to link these layers. Applying the base-specific in situ sequencing workflow to eight tissue sections from two multifocal primary breast cancers revealed intricate subclonal growth patterns that were validated by microdissection. In a case of ductal carcinoma in situ, polyclonal neoplastic expansions occurred at the macroscopic scale but segregated within microanatomical structures. Across the stages of ductal carcinoma in situ, invasive cancer and lymph node metastasis, subclone territories are shown to exhibit distinct transcriptional and histological features and cellular microenvironments. These results provide examples of the benefits afforded by spatial genomics for deciphering the mechanisms underlying cancer evolution and microenvironmental ecology.

BACKGROUND: The study of factors affecting the vibroacoustic characteristics of pumps is one of the main areas of development in the current pump industry. Improvement of these characteristics allows to extend the service life of pumps by means of vibration levels reduction as well as to decrease the noise level. AIMS: In this study, the attempt to optimize the flow part of a multi-stage pump was made in order to obtain acceptable noise, vibration and harshness (NVH) characteristics in two operation modes that are different front the optimal one. METHODS: As the result of the study, it was found that changing these parameters in favour of NVH has a negative impact on the pump efficiency and vice versa. Thereby the optimal balance between these parameters should be found. The optimization was performed with the method of research of the parameter space with use of LP-tau sequences. The following elements were chosen as the optimization parameters: the area at the entrance to downstream, the angle of guide vanes at the entrance to the downstream, the width of rotor at the outlet, the angle of rotor vanes at the inlet and the outlet, the wrap angle of rotor vane. Decrease of the area of the graph of pressure pulsation spectrum was chosen as the optimization criteria. The mathematical model was verified with two designs of the flow part produced and tested earlier. The first sample has an overstated rate of the NVH spectrum in the area of high frequencies, the second sample has an overstated rate of the NVH spectrum in the area of low frequencies. RESULTS: The compiled mathematical model proved its good quality, showing the same results, which allows to speak about the admissibility of its use for optimization of the flow parts of pumps. CONCLUSIONS: This study will be useful for specialists in the field of vane hydraulic machines design.

The article analyzes the flow gas-liquid mixture features inthe flow part of the impellers of multiphase stages pumping gas-liquid mixtures. By analogy with the coefficient specific speed of a pump for a single-phase liquid and the cavitation specific speed, a specific speed for multiphase pump stages is proposed. It is shown that the operation of blade pumps on multiphase media depends on the characteristics of the flow of the working fluid in all parts of the flow path, including the conditions at the inlet to the impeller, the flow in the blade cascade of the impeller, the guide vane, the outlet elements of the pump. Design changes in traditional blade cascades are recommended, and a new type is proposed: a multi-row cascade system.

This research discusses the micromechanical modelling for thermoplastic composite material. Elastoplastic and damage model for PEEK matrix composite with the dependency of properties to stress state is presented. Plasticity initiation conditions and failure criterion are analyzed. The influence of manufacturing residual stresses is considered. All typical engineering experiments for neat PEEK under different stress state are good predicted by the model. Numerical experiment for macro-properties estimation based on micromechanical model is conducted and the results are compared with the test data.

The article considers theoretical approaches to forecasting the development of the domestic economy and the stability of the fi nancial sector. The work uses an artificial intelligence system developed by the authors. The paper puts forward and proves the hypothesis that the use of the risk assessment of the financial sector calculated using the VaR model in the neural network AI system can be used to obtain the forecast value of the country’s GDP in order to provide support for managerial decision-making under conditions of uncertainty. Of great importance is the study of the theoretical foundations for increasing the stability of the Russian economy in modern conditions. The use of neural network models in GDP forecasting is an important tool for assessing and ensuring the sustainability of the Russian economy. The novelty of the study lies in the fact that an approach is proposed to fill the gap that concerns the problem of the lack of a reliable approach in assessing the risk of financial sector stability in order to ensure the sustainable development of the domestic economy. Get a correct forecast of the gross domestic product (GDP) in the face of market uncertainty. According to the VaR model, with a 99 % probability, the absolute value of the fi nancial risk of a reduction in the profits of the banking system of the Russian Federation may amount to 108.5 billion rubles in 2022, or 4.5226 %, and the amount of profi t may reach 2.3 trillion rubles. rub. The resulting neuroforecast of the value of GDP for 2022 is 79 023.4 billion rubles. 33.3 % higher than the 59 262.95 billion rubles, declared by experts, the total forecast value of GDP for 1Q. (28410) and 2 sq. (30853). To compare the accuracy of the forecast, it remains to wait until the actual values of GDP become known. The practical significance of the study lies in the fact that in the course of the study the prerequisites for solving an important national economic problem were formed — forecasting the value of GDP and ensuring the sustainable development of the country’s economy.

Funding Information: M.J.A. and T.M. acknowledge support from the European Union Horizon 2020 research and innovation programme under Grant Agreement No. 857470 and from European Regional Development Fund via Foundation for Polish Science International Research Agenda PLUS programme Grant No. MAB PLUS/2018/8. M.J.A. acknowledges support from the Academy of Finland (Center of Excellence program, 278367 and 317464). J.K. acknowledges funding from Academy of Finland (308235) and Business Finland (211715). I.V.L. acknowledges funding from Academy of Finland (341440 and 346603). The authors acknowledge the computational resources provided by the Aalto University School of Science “Science-IT” project and the provision of facilities and technical support by Aalto University at OtaNano–Nanomicroscopy Center (Aalto-NMC). | openaire: EC/H2020/857470/EU//NOMATEN Fatigue failure of crystalline materials is a difficult problem in science and engineering, and recent results have shown that fatigue crack growth can occur in intermittent jumps that have fat-tailed distributions. As fatigue crack propagation is known to leave markings - called striations - on the fracture surface, the distances between these should also have fat-tailed distributions if the crack propagation is intermittent. Here, we combine macroscale crack tip tracking in fatigue crack growth measurements of aluminum 5005 samples with postmortem scanning electron microscopy imaging of the striation lines. We introduce two different methods for extracting the striation line spacing from the images. What we find is a similar distribution of striation spacings as jump sizes using one of our methods, but the average striation spacing does not correlate with the crack growth rate. We conclude that we observe avalanchelike crack propagation, reflected in both the macroscale crack tip tracking as well as the analysis of the fracture surfaces. Our results show that the fracture surfaces can be used to study the intermittency of fatigue crack propagation and in development of crack-resistant materials. The advantages and disadvantages of the two methods introduced are discussed.

Supplementary Tables S1-S5. Supplementary Table S1. Histological breakdown of benign controls. Supplementary Table S2. Urine biomarker levels in patients diagnosed with tuberculosis, NSCLC and controls. Supplementary Table S3. Urine biomarkers associated with smoking status, gender, and age. Supplementary Table S4. Classification accuracy of IGFBP-1, sIL-1Rα, CEACAM-1 panel in patient subgroups at 95% SP. Supplementary Table S5. Multimarker panel performance in the classification of NSCLC patients from benign controls and TB patients from healthy controls.

The early detection of lung cancer has the potential to greatly impact disease burden through the timely identification and treatment of affected individuals at a manageable stage of development. The insufficient specificity demonstrated by currently used screening and diagnostic techniques has led to intense investigation into biomarkers as diagnostic tools. Urine may represent a noninvasive alternative matrix for diagnostic biomarker development. We performed an analysis of 242 biomarkers in urines obtained from 83 patients with non–small cell lung carcinomas (NSCLC), 74 patients diagnosed with benign pulmonary conditions, and 77 healthy donors. A large number of significant alterations were observed between the NSCLC and control groups. A multivariate analysis identified a three-biomarker panel consisting of IGFBP-1, sIL-1Ra, CEACAM-1, which discriminated NSCLC from healthy controls with a sensitivity/specificity of 84/95 in an initial training set and 72/100 in an independent validation set. This panel performed well among multiple subtypes of NSCLC and early-stage disease but demonstrated only limited efficacy for the discrimination of NSCLC from benign controls and limited specificity for patients with several other cancers and tuberculosis. These findings demonstrate that urine biomarkers may provide screening and diagnostic properties which exceed those reported for serum biomarkers and approach a level necessary for further clinical development. Cancer Prev Res; 8(2); 111–9. ©2014 AACR.

A panel of biomarkers may improve predictive performance over individual markers. Although many biomarker panels have been described for ovarian cancer, few studies used prediagnostic samples to assess the potential of the panels for early detection. We conducted a multisite systematic evaluation of biomarker panels using prediagnostic serum samples from the Prostate, Lung, Colorectal, and Ovarian Cancer (PLCO) screening trial.Using a nested case–control design, levels of 28 biomarkers were measured laboratory-blinded in 118 serum samples obtained before cancer diagnosis and 951 serum samples from matched controls. Five predictive models, each containing 6 to 8 biomarkers, were evaluated according to a predetermined analysis plan. Three sequential analyses were conducted: blinded validation of previously established models (step 1); simultaneous split-sample discovery and validation of models (step 2); and exploratory discovery of new models (step 3). Sensitivity, specificity, sensitivity at 98% specificity, and AUC were computed for the models and CA125 alone among 67 cases diagnosed within one year of blood draw and 476 matched controls. In step 1, one model showed comparable performance to CA125, with sensitivity, specificity, and AUC at 69.2%, 96.6%, and 0.892, respectively. Remaining models had poorer performance than CA125 alone. In step 2, we observed a similar pattern. In step 3, a model derived from all 28 markers failed to show improvement over CA125.Thus, biomarker panels discovered in diagnostic samples may not validate in prediagnostic samples; utilizing prediagnostic samples for discovery may be helpful in developing validated early detection panels. Cancer Prev Res; 4(3); 375–83. ©2011 AACR.