Search

LIM homeodomain (LIM-HD) family genes are transcription factors that play crucial roles in a variety of functions during embryonic development. The activities of the LIM-HD proteins are regulated by the co-regulators LIM only (LMO) and LIM domain-binding (LDB). In the mouse genome, there are 13 LIM-HD genes (Lhx1–Lhx9, Isl1–2, Lmx1a–1b), 4 Lmo genes (Lmo1–4), and 2 Ldb genes (Ldb1–2). Amongst these, Lhx1 is required for the development of the müllerian duct epithelium and the timing of the primordial germ cell migration. Lhx8 is necessary for oocyte differentiation and Lhx9 for somatic cell proliferation in the genital ridges and control of testosterone production in the Leydig cells. Lmo4 is involved in Sertoli cell differentiation. Mutations in LHX1 are associated with müllerian agenesis or Mayer-Rokitansky-Kuster-Hauser (MRKH) syndrome. LHX9 gene variants are reported in cases with disorders of sex development (DSD). Mutations in LHX3 and LHX4 are reported in patients with combined pituitary hormone deficiency having absent or delayed puberty. A transcript map of the Lhx, Lmo, and Ldb genes reveal that multiple LIM-HD genes and their co-regulators are expressed in a sexually dimorphic pattern in the developing mouse gonads. Unraveling the roles of LIM-HD genes during development will aid in our understanding of the causes of DSD.

Motor neurons (MNs) control muscle movement and are essential for breathing, walking and fine motor skills. Motor Neuron and Pancreas Homeobox 1 (MNX1) has long been recognized as a key marker of the MN lineage. Deficiency of the Mnx1 gene in mice results in early postnatal lethality – likely by causing abnormal MN development and respiratory malfunction. However, the genome-wide targets and exact regulatory function of Mnx1 in MNs remains unresolved. Using an in vitro model for efficient MN induction from mouse embryonic stem cells, we identified about six thousand MNX1-bound loci, of which half are conserved enhancers co-bound by the core MN-inducing factors ISL1 and LHX3, while the other half are promoters for housekeeping-like genes. Despite its widespread binding, disruption of Mnx1 affects the activity of only a few dozen MNX1-bound loci, and causes mis-regulation of about one hundred genes, the majority of which are up-regulated pan-neuronal genes with relatively higher expression in the brain compared to MNs. Integration of genome-wide binding, transcriptomic and epigenomic data in the wild-type and Mnx1-disrupted MNs predicts that Pbx3 and Pou6f2 are two putative direct targets of MNX1, and both are homeobox transcription factors highly expressed in the central nervous system. Our results suggest that MNX1 is crucial for restraining the expression of many pan-neuronal genes in MNs, likely in an indirect fashion. Further, the rarity of direct targets in contrast to the widespread binding of MNX1 reflects a distinctive mode of transcriptional regulation by homeobox transcriptional factors.

Pituitary develops from oral ectoderm in contact with adjacent ventral hypothalamus. Impairment in this process results in congenital pituitary hypoplasia (CPH); however, there have been no human disease models for CPH thus far, prohibiting the elucidation of the underlying mechanisms. In this study, we established a disease model of CPH using patient-derived induced pluripotent stem cells (iPSCs) and 3D organoid technique, in which oral ectoderm and hypothalamus develop simultaneously. Interestingly, patient iPSCs with a heterozygous mutation in the orthodenticle homeobox 2 (OTX2) gene showed increased apoptosis in the pituitary progenitor cells, and the differentiation into pituitary hormone-producing cells was severely impaired. As an underlying mechanism, OTX2 in hypothalamus, not in oral ectoderm, was essential for progenitor cell maintenance by regulating LHX3 expression in oral ectoderm via FGF10 expression in the hypothalamus. Convincingly, the phenotype was reversed by the correction of the mutation, and the haploinsufficiency of OTX2 in control iPSCs revealed a similar phenotype, demonstrating that this mutation was responsible. Thus, we established an iPSC-based congenital pituitary disease model, which recapitulated interaction between hypothalamus and oral ectoderm and demonstrated the essential role of hypothalamic OTX2.

The ontogenesis and development of the pituitary gland is a highly complex process that depends on a cascade of transcription factors and signaling molecules. Spontaneous mutations and transgenic murine models have demonstrated a role for many of these factors, including HESX1, PROP1, PIT1, LHX3, LHX4, SOX2, SOX3, OTX2, PAX6, FGFR1, SHH, GLI2, and FGF8 in the etiology of congenital hypopituitarism. Genetic mutations in any of these factors can lead to congenital hypopituitarism, which is characterized by the deficiency in one or more pituitary hormones. The phenotype can be highly variable, consisting of isolated hypopituitarism or more complex disorders. The same phenotype can be attributed to different gene mutations; while a given gene mutation can induce different phenotypes. This review highlights the genetic variations that lead to congenital hypopituitarism and their associated defects. The overall incidence of mutations in known transcription factors in patients with hypopituitarism is low; therefore many gene mutations or even gene- epigenetic interactions have to be unraveled in the future to explain the vast majority of still unclear cases of congenital hypopituitarism.

Naked mole-rats (NMRs) live an exceptionally long life, appear not to exhibit age-related decline in physiological capacity, and are seemingly resistant to age-related diseases. However, it has been unknown whether NMRs also evade aging according to a primary hallmark of aging: epigenetic changes. To address this question, we generated DNA methylation profiles from 329 tissues from animals of known age, at loci that are highly conserved between mammalian species, using a custom Infinium array (HorvathMammalMethylChip40). We observed strong aging effects on NMR DNA methylation, from which we developed seven highly accurate age estimators (epigenetic clocks) for several tissues (pan-tissue, blood, kidney clock, liver clock, skin clock) and two dual species (human-NMR) clocks. By identifying age-related cytosine methylation that are shared between NMR and humans, but not with the mouse, we identified genes and cellular pathways that impinge on developmental and metabolic processes that are potentially involved in NMR and human longevity. The NMR epigenetic clocks revealed that breeding NMR queens age more slowly than non-breeders, a feature that is also observed in some eusocial insects. CpGs associated with queen status were located near developmental genes and those that are regulated by the LHX3 transcription factor that controls pituitary development. In summary, our study demonstrates that despite a phenotype of reduced senescence, the NMR ages epigenetically through developmental and metabolic processes, and that NMR queens age more slowly than non-breeders.

In early embryos of Ciona, an invertebrate chordate, the animal-vegetal axis is established by the combinatorial actions of maternal factors. One target of these maternal factors, Foxd, is specifically expressed in the vegetal hemisphere and stabilizes the animal-vegetal axis by activating vegetal hemisphere-specific genes and repressing animal hemisphere-specific genes. This dual functionality is essential for the embryogenesis of early ascidian embryos; however, the mechanism by which Foxd can act as both a repressor and an activator is unknown. Here, we identify a Foxd binding site upstream of Lhx3/4, which is activated by Foxd, and compare it with a repressive Foxd binding site upstream of Dmrt.a. We found that activating sites bind Foxd with low affinity while repressive sites bind Foxd with high affinity. Reporter assays confirm that this qualitative difference between activating and repressive Foxd binding sites is sufficient to change Foxd functionality. We therefore conclude that the outcome of Foxd transcriptional regulation is encoded in cis-regulatory elements.

Context The international GENHYPOPIT network collects phenotypical data and screens genetic causes of non‐acquired hypopituitarism. Aims To describe main phenotype patterns and their evolution through life. Design Patients were screened according to their phenotype for coding sequence variations in 8 genes: HESX1, LHX3, LHX4, PROP1, POU1F1, TBX19, OTX2 and PROKR2. Results Among 1213 patients (1143 index cases), the age of diagnosis of hypopituitarism was congenital (24%), in childhood (28%), at puberty (32%), in adulthood (7.2%) or not available (8.8%). Noteworthy, pituitary hormonal deficiencies kept on evolving during adulthood in 49 of patients. Growth Hormone deficiency (GHD) affected 85.8% of patients and was often the first diagnosed deficiency. AdrenoCorticoTropic Hormone deficiency rarely preceded GHD, but usually followed it by over 10 years. Pituitary Magnetic Resonance Imaging (MRI) abnormalities were common (79.7%), with 39.4% pituitary stalk interruption syndrome (PSIS). The most frequently associated extrapituitary malformations were ophthalmological abnormalities (16.1%). Prevalence of identified mutations was 7.3% of index cases (84/1143) and 29.5% in familial cases (n = 146). Genetic analysis in 449 patients without extrapituitary phenotype revealed 36 PROP1, 2 POU1F1 and 17 TBX19 mutations. Conclusion This large international cohort highlights atypical phenotypic presentation of constitutional hypopituitarism, such as post pubertal presentation or adult progression of hormonal deficiencies. These results justify long‐term follow‐up, and the need for systematic evaluation of associated abnormalities. Genetic defects were rarely identified, mainly PROP1 mutations in pure endocrine phenotypes.

Background Hedgehog signaling has various regulatory functions in tissue morphogenesis and differentiation. To investigate its involvement in anterior pituitary precursor development and the lens precursor potential for anterior pituitary precursors, we investigated Talpid mutant Japanese quail embryos, in which hedgehog signaling is defective. Results Talpid mutants develop multiple pituitary precursor-like pouches of variable sizes from the oral ectoderm (OE). The ectopic pituitary pouches initially express the pituitary-associated transcription factor (TF) LHX3 similarly to Rathke's pouch, the genuine pituitary precursor. The pouches coexpress the TFs SOX2 and PAX6, a signature of lens developmental potential. Most Talpid mutant pituitary pouches downregulate LHX3 expression and activate the lens-essential TF PROX1, leading to the development of small lens tissue expressing α-, β-, and δ-crystallins. In contrast, mutant Rathke's pouches express a lower level of LHX3, which is primarily localized in the cytoplasm, and activate the lens developmental pathway. Conclusions Hedgehog signaling in normal embryos regulates the development of Rathke's pouch in two steps. First, by confining Rathke's pouch development in a low hedgehog signaling region of the OE. Second, by sustaining LHX3 activity to promote anterior pituitary development, while inhibiting ectopic lens development.

Pituitary development is coordinated by the timely interaction of several signaling pathways and transcription factors. The expression of lhx3 precedes that of transcription factors like tbx19, prop1, gata2 or sf1 and requires earlier expression of others like pitx1 and pitx2 and pathways like sonic hedgehog. The adult pituitary contains SOX2/SOX9 positive pituitary stem cells and progenitors leading to a differentiated pituitary, and in vitro differentiation of embryonic stem cells into mature pituitary cells was shown to recapitulate anterior pituitary development. Conditional inactivation of isl-1 in thyrotrophs induces central hypothyroidism, showing that this LIM domain factor is necessary for thyrotroph function. Large scale genomic techniques identified new pathogenic gene variants in constitutional hypopituitarism, an indirect evidence of their role in pituitary development or function: a variant of GPR161 was identified by whole exome sequencing in GH deficiency; a variant of ARNT2 was associated with constitutional panhypopituitarism, diabetes insipidus and microcephaly. Allelic variations of NFKB2 were associated with pituitary deficiency (mainly ACTH deficiency) and variable immune deficiency (VID), described as DAVID syndrome. IGSF1 alterations were identified in a complex X-linked phenotype with thyrotroph deficiency, macro-orchidism, delayed puberty, transient GH or ACTH deficiency, and low prolactin levels. The first variants of the potassium channel gene KCNQ1 were reported in families with GH deficiency, gingival fibromatosis and arrhythmia. Thanks to new genome wide techniques, more causative genes have been identified over the past 6 years than over the 2 decades following the first identification of the role of pou1f1 in human hypopituitarism. Demonstrating the role of these new genes will require an appropriate cell model that may derive from novel stem cell techniques. Such approaches will help better understand pituitary development and functions.

Combined pituitary hormone deficiency (CPHD) is characterized by a malformed or underdeveloped pituitary gland resulting in an impaired pituitary hormone secretion. Several transcription factors have been described in its etiology, but defects in known genes account for only a small proportion of cases. To identify novel genetic causes for congenital hypopituitarism, we performed exome-sequencing studies on 10 patients with CPHD and their unaffected parents. Two candidate genes were sequenced in further 200 patients. Genotype data of known hypopituitary genes are reviewed. We discovered 51 likely damaging variants in 38 genes; 12 of the 51 variants represent de novo events (24%); 11 of the 38 genes (29%) were present in the E12.5/E14.5 pituitary transcriptome. Targeted sequencing of two candidate genes, SLC20A1 and SLC15A4, of the solute carrier membrane transport protein family in 200 additional patients demonstrated two further variants predicted as damaging. We also found combinations of de novo (SLC20A1/SLC15A4) and transmitted variants (GLI2/LHX3) in the same individuals, leading to the full-blown CPHD phenotype. These data expand the pituitary target genes repertoire for diagnostics and further functional studies. Exome sequencing has identified a combination of rare variants in different genes that might explain incomplete penetrance in CPHD.

Intrinsically disordered regions are highly represented among mammalian transcription factors, where they often contribute to the formation of multiprotein complexes that regulate gene expression. An example of this occurs with LIM-homeodomain (LIM-HD) proteins in the developing spinal cord. The LIM-HD protein LHX3 and the LIM-HD cofactor LDB1 form a binary complex that gives rise to interneurons, whereas in adjacent cell populations, LHX3 and LDB1 form a rearranged ternary complex with the LIM-HD protein ISL1, resulting in motor neurons. The protein–protein interactions within these complexes are mediated by ordered LIM domains in the LIM-HD proteins and intrinsically disordered LIM interaction domains (LIDs) in LDB1 and ISL1; however, little is known about how the strength or rates of binding contribute to complex assemblies. We have measured the interactions of LIM:LID complexes using FRET-based protein–protein interaction studies and EMSAs and used these data to model population distributions of complexes. The protein–protein interactions within the ternary complexes are much weaker than those in the binary complex, yet surprisingly slow LDB1:ISL1 dissociation kinetics and a substantial increase in DNA binding affinity promote formation of the ternary complex over the binary complex in motor neurons. We have used mutational and protein engineering approaches to show that allostery and modular binding by tandem LIM domains contribute to the LDB1 LID binding kinetics. The data indicate that a single intrinsically disordered region can achieve highly disparate binding kinetics, which may provide a mechanism to regulate the timing of transcriptional complex assembly.

Congenital hypopituitarism (CH), septo-optic dysplasia (SOD), and holoprosencephaly (HPE) constitute an important group of structural birth defects that cause significant morbidity and life-long consequences for quality of life and care. The genetic causes are highly overlapping. As such, these disorders can be considered as a spectrum of related disorders. Improved insight into genetic causes would be valuable for patients, families, and medical geneticists. Very few systematic genetic screens have been carried out for patients with CH. We implemented genetic screening using single-molecule molecular inversion probes sequencing to identify causative mutations in a set of 67 genes previously reported in CH patients and the spectrum encompassing SOD and HPE. We captured genomic DNA from 170 Argentinean pediatric patients with CH, and 54% of the patients in this cohort have craniofacial, ophthalmologic, and/or central nervous system defects. We found candidate pathogenic, likely pathogenic and variants uncertain significance (VUS) in 23% of the cases. In order to evaluate the functional consequences of VUS in LHX3, LHX4, and GLI2, we performed in-vitro functional assays to study the activity of the mutated proteins. To test LHX3/4 variants we co-transfected HEK293T cells with wild type (WT) or mutated LHX3/4 variant plasmids and luciferase reporter genes driven by the ɑGSU promoter or GH1 promoter and assayed for luciferase activity. For GLI2 functional analysis we used the cell line NIH/3T3-CG, stably transfected to express GFP under the presence of GLI2 activated form. Endogenous Gli2 was knocked out by CRISPR-Cas9 and clones were selected for absence of GFP expression upon activation of the sonic hedgehog pathway. We tested the ability of transfected WT or mutated GLI2 expression plasmids to restore GFP fluorescence. We concluded that variants LHX3:p.Pro187Ser LHX4:p.Arg84His, p.Gln100His and p.Trp204Leu and GLI2:p.1404Lfs impair activation of the reporter gene, while the LHX3:p.Leu220Met and GLI2:p.L761P have WT activity on their respective assays. Identification of disease-causing variants in CH is complicated by phenotypic variation, incomplete penetrance, and VUS. Functional testing of potentially pathogenic variants is critical to arrive at a definitive molecular diagnosis. A full catalogue of variant effects in known causative genes would be invaluable for clinicians in order to simplify the interpretation of novel variants and reduce the diagnostic odyssey that families often experience.

Belonging to the same LIM homeobox (LHX) family, LHX3 and LHX4 are key transcription factors in animal growth and reproduction. Insertion/deletion (indel) is a relatively simple and effective DNA marker. Therefore, four sheep breeds of various fecundity were used to explore the novel indel variants within the sheep LHX3 and LHX4 gene, as well as to evaluate their effects on growth traits. Herein, only one novel 29 bp indel (NC_019460.2:g.3107494-3107522delGGCCTGGACTGTGATGGGCACCCTCCGGG) within the sheep LHX3 gene was found, and three genotypes were detected. Interestingly, the increasing trends of II (insertion/insertion) genotype frequency and I allelic frequency were the same as the growth of the fertility character. Genotypic frequency and allelic frequency distributions were significantly different between the high-fecundity breeds (HS, STHS and LFTS) and low-fecundity breed (TS) based on a χ2 test (P

LIM-homeodomain (LIM-HD) transcription factors act as key developmental regulators, through their ability to both bind DNA through homeodomain-DNA interactions, and to form larger complexes through protein-protein interactions. Many interactions that have been characterised are formed using their LIM domains, but likely also involve other regions, which have not yet been described for many LIM-HD proteins. The LIM-HD protein Isl1 has been implicated in the development of many tissues. However, relatively little detail is known about how Isl1 functions in these systems and the pathways in which it acts. The first part of this thesis aimed to identify and characterise novel binding partners for Isl1. An earlier project isolated ~180 potential binding partners through use of yeast two-hybrid mating screens; throughout this thesis further methodology was developed to identify additional proteins in a medium throughput manner. Validation protocols were then applied to determine which interactors were likely to represent biologically relevant interaction partners for Isl1. The second part of this thesis focussed on the mechanisms by which Isl1 and Lhx3 direct cell fate determination in the developing central nervous system. These proteins, along with Ldb1, interact via LIM:LID interactions to form cell-specific transcriptional complexes that target genes different to those targeted by either LIM-HD protein alone. It was not known if the homeodomains target these different sites solely because of the LIM:LID interactions or if the homeodomains themselves bind cooperatively to DNA. The DNA-binding behaviour of various iterations of the Lhx3/Isl1/Ldb1 complex are described, and structural characterisation of the Isl1/Lhx3 DNA-binding unit has been pursued. These data provide new insights into the mechanisms by which Isl1 and Lhx3 work together in regulating gene expression.

During spinal cord development, Sonic hedgehog (Shh), secreted from the floor plate, plays an important role in the production of motor neurons by patterning the ventral neural tube, which establishes MN progenitor identity. It remains unknown, however, if Shh signaling plays a role in generating columnar diversity of MNs that connect distinct target muscles. Here, we report that Shh, expressed in MNs, is essential for the formation of lateral motor column (LMC) neurons in vertebrate spinal cord. This novel activity of Shh is mediated by its downstream effector ARHGAP36, whose expression is directly induced by the MN-specific transcription factor complex Isl1-Lhx3. Furthermore, we found that AKT stimulates the Shh activity to induce LMC MNs through the stabilization of ARHGAP36 proteins. Taken together, our data reveal that Shh, secreted from MNs, plays a crucial role in generating MN diversity via a regulatory axis of Shh-AKT-ARHGAP36 in the developing mouse spinal cord.

LHX3 and LHX4 are LIM domain transcription factors involved in the early steps of pituitary organogenesis. They are necessary for the proper differentiation of Rathke's pouch that gives rise to the anterior pituitary lobe. Mutations of these transcription factors are involved in congenital hypopituitarism: to date, nine mutations of LHX3 have been reported, responsible for variable pituitary hormone deficiencies and extrapituitary manifestations, including limited neck rotation. By contrast, only five LHX4 mutations have been reported, responsible for variable hormone deficiencies, and pituitary/intracranial abnormalities. Future investigations will aim to better understand human pituitary organogenesis and to shed light on the interspecies differences in the roles of these transcription factors.

Microarray data of non-functioning pituitary adenomas (NFPAs) were analyzed to disclose novel genes and pathways involved in NFPA tumorigenesis. Raw microarray data were downloaded from Gene Expression Omnibus. Data pre-treatment and differential analysis were conducted using packages in R. Functional and pathway enrichment analyses were performed using package GOs-tats. A protein-protein interaction (PPI) network was constructed using server STRING and Cytoscape. Known genes involved in pituitary adenomas (PAs), were obtained from the Comparative Toxicogenomics Database. A total of 604 differentially expressed genes (DEGs) were identifed between NFPAs and controls, including 177 up- and 427 down-regulated genes. Jak-STAT and p53 signaling pathways were significantly enriched by DEGs. The PPI network of DEGs was constructed, containing 99 up- and 288 down-regulated known disease genes (e.g. EGFR and ESR1) as well as 16 up- and 17 down-regulated potential novel NFPAs-related genes (e.g. COL4A5, LHX3, MSN, and GHSR). Genes like COL4A5, LHX3, MSN, and GHSR and pathways such as p53 signaling and Jak-STAT signaling, might participate in NFPA development. Although further validations are required, these findings might provide guidance for future basic and therapy researches.

Paired-liked homodomain transcription factor 2 (PITX2), an important transcription factor, was vital in cell proliferation and differentiation, organogenesis (including pituitary development) and embryonic development. Alternative splicing events of PITX2 have been detected in zebrafish, Xenopus, chicken, mouse and humans, but not in goats. Herein, by cloning and sequencing, we firstly identified two novel isoforms (namely, PITX2-V1 and PITX2-V2) except the complete transcript PITX2 in dairy goat. The length of complete PITX2 coding sequence (CDS) was 978 base pair (bp), which had three exons. The CDS of PITX2-V1 was 830 bp, which was characterized with partial deletion of internal exon 3 of PITX2 gene. The length of PITX2-V2 CDS was 202 bp, which retained partial 5′ region of exon 1 and 3′ region of exon 3. The quantitative real − time polymerase chain reaction (qRT-PCR) analysis demonstrated that these three transcripts were widely and differently expressed among tissues. The relative expression levels of the three variants in brain, pancreas and testis were higher than other tissues. Different expression analysis suggested that the expression level of PITX2-V2 was significantly higher than PITX2 and PITX2-V1 in liver, lung, kidney, pancreas, adipose, and testis, but not in brain. These differences indicated that the expression of three variants were tissue-specific. This was the first finding on the splice variants of goat PITX2 gene and their mRNA expression patterns, which might provide a novel insight for further study on the function of PITX2 gene.

Retinal bipolar cells (BCs) connect with photoreceptors and relay visual information to retinal ganglion cells (RGCs). Retina-specific deletion of Lhx4 in mice results in a visual defect resembling human congenital stationary night blindness. This visual dysfunction results from the absence of rod bipolar cells (RBCs) and the loss of selective rod-connecting cone bipolar cell (CBC) subtypes and AII amacrine cells (ACs). Inactivation of Lhx4 causes the apoptosis of BCs and cell fate switch from some BCs to ACs, whereas Lhx4 overexpression promotes BC genesis. Moreover, Lhx4 positively regulates Lhx3 expression to drive the fate choice of type 2 BCs over the GABAergic ACs. Lhx4 inactivation ablates Bhlhe23 expression, whereas overexpression of Bhlhe23 partially rescues RBC development in the absence of Lhx4. Thus, by acting upstream of Bhlhe23, Prdm8, Fezf2, Lhx3, and other BC genes, Lhx4, together with Isl1, could play essential roles in regulating the subtype-specific development of RBCs and CBCs.

Understanding the molecular mechanisms underlying variation in lifespan is central to ensure long life. Lim3 encoding a homolog of the vertebrate Lhx3/4 transcription factors plays a key role in Drosophila neuron development. Here, we demonstrated that Lim3 knockdown early in life decreased survival of adult flies. To study the mechanisms underlying this effect, we identified embryonic Lim3 targets using combined RNA-seq and RT-qPCR analyses complemented by in silico analysis of Lim3 binding sites. Though genes with neuronal functions were revealed as Lim3 targets, the characteristics of neurons were not affected by Lim3 depletion. Many of the direct and indirect Lim3 target genes were associated with mitochondrial function, ATP-related activity, redox processes and antioxidant defense. Consistent with the observed changes in the embryonic transcription of these genes, ROS levels were increased in embryos, which could cause changes in the transcription of indirect Lim3 targets known to affect lifespan. We hypothesize that altered mitochondrial activity is crucial for the decrease of adult lifespan caused by Lim3 knockdown early in life. In adults that encountered Lim3 depletion early in life, the transcription of several genes remained altered, and mitochondrial membrane potential, ATP level and locomotion were increased, confirming the existence of carry-over effects.

Sonic hedgehog (SHH) is an essential morphogenetic signal dictating cell fate decisions in several developing organs in mammals. In vitro data suggest that SHH is required to specify LHX3+/LHX4+ Rathke's pouch (RP) progenitor identity. However, in vivo studies have failed to reveal such a function, supporting instead, a critical role for SHH in promoting proliferation of these RP progenitors and for differentiation of pituitary cell types. Here, we have used a genetic approach to demonstrate that activation of the SHH pathway is necessary to induce LHX3+/LHX4+ RP identity in mouse embryos. First, we show that conditional deletion of Shh in the anterior hypothalamus results in a fully penetrant phenotype characterised by a complete arrest of RP development, with lack of Lhx3/Lhx4 expression in RP epithelium at 9.0 dpc (days post coitum) and total loss of pituitary tissue by 12.5 dpc. Conversely, over-activation of the SHH pathway by conditional deletion of Ptch1 in RP progenitors leads to severe hyperplasia and enlargement of the Sox2+ve stem cell compartment by the end of gestation.

During spinal cord development, the LIM domains of the LIM homeodomain factor Lhx3 bind to either the LIM cofactor nuclear LIM interactor (NLI) or another LIM homeodomain factor, Isl1, assembling the tetrameric V2 interneuron-specifying Lhx3 complex (2NLI:2Lhx3) or the hexameric motor neuron-specifying Isl1-Lhx3 complex (2NLI:2Isl1:2Lhx3). However, the detailed molecular basis by which the Lhx3-LIM domains contribute to motor neuron specification still remains poorly understood. Here, we show that the Lhx3-LIM domains are essential for recruiting transcriptional coactivators to the Isl1-Lhx3 complex. Using a yeast genetic screening system, we identify Lhx3 point mutants that bind to NLI but not Isl1. Accordingly, these mutants fail to assemble the Isl1-Lhx3 complex. However, their interaction with coactivators is relatively intact, and they are fully functional in the Lhx3 complex and V2 interneuron specification. Interestingly, when these Lhx3 mutants are directly fused to Isl1, their transcriptional activity in the Isl1-Lhx3 complex is restored. We further show that this restoration reflects an unexpected role of the Lhx3-LIM domains, likely together with Isl1, to form an interaction interface for coactivators. Our results suggest that the Lhx3-LIM domains play critical roles in transactivation of the Isl1-Lhx3 complex by not only directing the assembly of the Isl1-Lhx3 complex but also recruiting coactivators to the complex.

Defects in the Lhx4, Lhx3, and Pitx2 genes can cause combined pituitary hormone deficiency and pituitary hypoplasia in both humans and mice. Not much is known about the mechanism underlying hypoplasia in these mutants beyond generally increased cell death and poorly maintained proliferation. We identified both common and unique abnormalities in developmental regulation of key cell cycle regulator gene expression in each of these three mutants. All three mutants exhibit reduced expression of the proliferative marker Ki67 and the transitional marker p57. We discovered that expression of the cyclin-dependent kinase inhibitor 1a (Cdkn1a or p21) is expanded dorsally in the pituitary primordium of both Lhx3 and Lhx4 mutants. Uniquely, Lhx4 mutants exhibit reduced cyclin D1 expression and have auxiliary pouch-like structures. We show evidence for indirect and direct effects of LHX4 on p21 expression in αT3-1 pituitary cells. In summary, Lhx4 is necessary for efficient pituitary progenitor cell proliferation and restriction of p21 expression.

SummaryBackground Mutations in PROP1, HESX1 and LHX3 are associated with combined pituitary hormone deficiency (CPHD) and orthotopic posterior pituitary lobe (OPP). Objective To identify mutations in PROP1, HESX1 and LHX3 in a large cohort of patients with CPHD and OPP (35 Brazilian, two Argentinian). Design and Methods We studied 23 index patients with CPHD and OPP (six familial and 17 sporadic) as well as 14 relatives. PROP1 was sequenced by the Sanger method in all except one sporadic case studied using a candidate gene panel. Multiplex ligation-dependent probe amplification (MLPA) was applied to one familial case in whom PROP1 failed to amplify by PCR. In the 13 patients without PROP1 mutations, HESX1 and LHX3 were sequenced by the Sanger method. Results We identified PROP1 mutations in 10 index cases. Three mutations were novel: one affecting the initiation codon (c.1A>G) and two affecting splicing sites, c.109+1G>A and c.342+1G>C. The known mutations, c.150delA (p.Arg53Aspfs*112), c.218G>A (p.Arg73His), c.263T>C (p.Phe88Ser) and c.301_302delAG (p.Leu102Cysfs*8), were also detected. MLPA confirmed complete PROP1 deletion in one family. We did not identify HESX1 and LHX3 mutations by Sanger. Conclusion PROP1 mutations are a prevalent cause of congenital CPHD with OPP, and therefore, PROP1 sequencing must be the first step of molecular investigation in patients with CPHD and OPP, especially in populations with a high frequency of PROP1 mutations. In the absence of mutations, massively parallel sequencing is a promising approach. The high prevalence and diversity of PROP1 mutations is associated with the ethnic background of this cohort.

Non-small cell lung cancer (NSCLC) is the most common type of lung cancer. We previously identified LHX3 as a new preferentially expressed gene in NSCLC. In the present study, we sought to determine its expression, the clinical relevance and the functional roles in NSCLC. LHX3 expression is sharply increased in carcinoma tissues compared to non-carcinoma tissues. Relational analysis reveals a significant association between LHX3 expression and clinical stage (n=172, p=0.032) or radiotherapy (n=167, p=0.022) of patients. LHX3 expression is much higher in the patients at advanced stages (stage III-IV) than in the patients at early stages (stage I-II, p=0.0304), and LHX3 expression is remarkably increased in the patients with radiotherapy treatment (p=0.0002). Survival analyses indicate that LHX3 is associated with unfavorable survival (n=180, p=0.002) and represents an independent prognostic factor [hazard ratio (HR)=1.834, p=0.004] of the NSCLC patients. Furthermore, LHX3 is associated with unfavorable overall survival (n=866, p=0.004) and represents an independent prognostic factor (HR=2.36, p=0.000) in lung adenocarcinoma (ADC) patients, but is not associated with overall survival of squamous cell carcinoma (SCC) patients (n=524, p=0.27). Further analyses found that LHX3 is an early-stage (n=94, p=0.003) and radiosensitivity (n=45, p=0.002) prognostic factor in ADC patients. The patients without radiotherapy have a significantly prolonged survival compared to those with radiotherapy (p=0.0069). Further functional studies show that forced expression of LHX3 in lung cancer cells obviously promotes cell proliferation and invasion, whereas inhibits cell apoptosis. In summary, LHX3 is an early-stage and radiosensitivity prognostic biomarker, and a novel potential oncogene in ADC.

LIM domains are zinc fingers that coordinate two zinc ions and that mediate protein–protein interactions. They are found in arrays of 1–5 LIM domains in a wide variety of proteins inside the cell, and may be accompanied by one or more other types of protein–protein interaction domains and catalytic domains. LIM proteins tend to function by regulating transcriptional events through recruitment of transcription factors (or in the case of LIM-homeodomain proteins by binding directly to DNA through the homeodomain) and/or are involved in remodeling of the cytoskeleton. Many LIM domain proteins have both of these activities and appear to shuttle in and out of the nucleus in response to stimuli, mediating communication between the major compartments of the cell.

A central problem in development is how fates of closely related cells are segregated. Lineally related motoneurons (MNs) and interneurons (INs) express many genes in common yet acquire distinct fates. For example, in mouse and chick Lhx3 plays a pivotal role in the development of both cell classes. Here, we utilize the ability to recognize individual zebrafish neurons to examine the roles of Lhx3 and its paralog Lhx4 in the development of MNs and ventral INs. We show that Lhx3 and Lhx4 are expressed by post-mitotic axial MNs derived from the MN progenitor (pMN) domain, p2 domain progenitors and by several types of INs derived from pMN and p2 domains. In the absence of Lhx3 and Lhx4, early-developing primary MNs (PMNs) adopt a hybrid fate, with morphological and molecular features of both PMNs and pMN-derived Kolmer–Agduhr′ (KA′) INs. In addition, we show that Lhx3 and Lhx4 distinguish the fates of two pMN-derived INs. Finally, we demonstrate that Lhx3 and Lhx4 are necessary for the formation of late-developing V2a and V2b INs. In conjunction with our previous work, these data reveal that distinct transcription factor families are deployed in post-mitotic MNs to unequivocally assign MN fate and suppress the development of alternative pMN-derived IN fates.

Background Pituitary dwarfism in German Shepherd Dogs is associated with autosomal recessive inheritance and a mutation in LHX3, resulting in combined pituitary hormone deficiency. Congenital dwarfism also is encountered in breeds related to German Shepherd Dogs, such as Saarloos and Czechoslovakian wolfdogs. Objectives To investigate whether Saarloos and Czechoslovakian wolfdog dwarfs have the same LHX3 mutation as do Germans Shepherd Dog dwarfs. A specific aim was to determine the carrier frequency among Saarloos and Czechoslovakian wolfdogs used for breeding. Animals Two client-owned Saarloos wolfdogs and 4 client-owned Czechoslovakian wolfdogs with pituitary dwarfism, 239 clinically healthy client-owned Saarloos wolfdogs, and 200 client-owned clinically healthy Czechoslovakian wolfdogs. Methods Genomic DNA was amplified using polymerase chain reaction (PCR). In the Saarloos and Czechoslovakian wolfdog dwarfs, PCR products were analyzed by sequencing. DNA fragment length analysis was performed on the samples from the clinically healthy dogs. Results Saarloos and Czechoslovakian wolfdog dwarfs have the same 7 bp deletion in intron 5 of LHX3 as do German Shepherd Dog dwarfs. The frequency of carriers of this mutation among clinically healthy Saarloos and Czechoslovakian wolfdogs used for breeding was 31% and 21%, respectively. Conclusions and Clinical Importance An LHX3 mutation is associated with pituitary dwarfism in Saarloos and Czechoslovakian wolfdogs. The rather high frequency of carriers of the mutated gene in the 2 breeds emphasizes the need for screening before breeding. If all breeding animals were genetically tested for the presence of the LHX3 mutation and a correct breeding policy would be implemented, this disease could be eradicated completely.

The LIM class of homeodomain protein 3 (LHX3) transcription factor is essential for pituitary gland and nervous system development in mammals. In humans, mutations in the LHX3 gene underlie complex pediatric syndromes featuring deficits in anterior pituitary hormones and defects in the nervous system. The mechanisms that control temporal and spatial expression of the LHX3 gene are poorly understood. The proximal promoters of the human LHX3 gene are insufficient to guide expression in vivo and downstream elements including a conserved enhancer region appear to play a role in tissue-specific expression in the pituitary and nervous system. Here we characterized the activity of this downstream enhancer region in regulating gene expression at the cellular level during development. Human LHX3 enhancer-driven Cre reporter transgenic mice were generated to facilitate studies of enhancer actions. The downstream LHX3 enhancer primarily guides gene transcription in α-glycoprotein subunit -expressing cells secreting the TSHβ, LHβ, or FSHβ hormones and expressing the GATA2 and steroidogenic factor 1 transcription factors. In the developing nervous system, the enhancer serves as a targeting module active in V2a interneurons. These results demonstrate that the downstream LHX3 enhancer is important in specific endocrine and neural cell types but also indicate that additional regulatory elements are likely involved in LHX3 gene expression. Furthermore, these studies revealed significant gonadotrope cell heterogeneity during pituitary development, providing insights into the cellular physiology of this key reproductive regulatory cell. The human LHX3 enhancer-driven Cre reporter transgenic mice also provide a valuable tool for further developmental studies of cell determination and differentiation in the pituitary and nervous system.

Motor behaviors result from the interplay between the brain and the spinal cord. Reticulospinal neurons, situated between the supraspinal structures that initiate motor movements and the spinal cord that executes them, play key integrative roles in these behaviors. However, the molecular identities of mammalian reticular formation neurons that mediate motor behaviors have not yet been determined, thus limiting their study in health and disease. In the medullary reticular formation of the mouse, we identified neurons that express the transcription factors Lhx3 and/or Chx10, and demonstrate that these neurons form a significant component of glutamatergic reticulospinal pathways. Lhx3-positive medullary reticular formation neurons express Fos following a locomotor task in the adult, indicating that they are active during walking. Furthermore, they receive functional inputs from the mesencephalic locomotor region and have electrophysiological properties to support tonic repetitive firing, both of which are necessary for neurons that mediate the descending command for locomotion. Together, these results suggest that Lhx3/Chx10 medullary reticular formation neurons are involved in locomotion.

Islet 1 (Isl1) is a transcription factor of the LIM-homeodomain (LIM-HD) protein family and is essential for many developmental processes. LIM-HD proteins all contain two protein-interacting LIM domains, a DNA-binding homeodomain (HD), and a C-terminal region. In Isl1, the C-terminal region also contains the LIM homeobox 3 (Lhx3)-binding domain (LBD), which interacts with the LIM domains of Lhx3. The LIM domains of Isl1 have been implicated in inhibition of DNA binding potentially through an intramolecular interaction with or close to the HD. Here we investigate the LBD as a candidate intramolecular interaction domain. Competitive yeast-two hybrid experiments indicate that the LIM domains and LBD from Isl1 can interact with apparently low affinity, consistent with no detection of an intermolecular interaction in the same system. Nuclear magnetic resonance studies show that the interaction is specific, whereas substitution of the LBD with peptides of the same amino acid composition but different sequence is not specific. We solved the crystal structure of a similar but higher affinity complex between the LIM domains of Isl1 and the LIM interaction domain from the LIM-HD cofactor protein LIM domain-binding protein 1 (Ldb1) and used these coordinates to generate a homology model of the intramolecular interaction that indicates poorer complementarity for the weak intramolecular interaction. The intramolecular interaction in Isl1 may provide protection against aggregation, minimize unproductive DNA binding, and facilitate cofactor exchange within the cell.

Combined pituitary hormone deficiency (CPHD) diseases result in severe outcomes for patients including short stature, developmental delays, and reproductive deficiencies. Little is known about their etiology, especially the developmental profiles and the influences of genetic background on disease progression. Animal models for CPHD provide valuable tools to investigate disease mechanisms and inform diagnostic and treatment protocols. Here we examined hormone production during pituitary development and the influence of genetic background on phenotypic severity in the Lhx3W227ter/W227ter mouse model. Lhx3W227ter/W227ter embryos have deficiencies of ACTH, α-glycoprotein subunit, GH, PRL, TSHβ, and LHβ during prenatal development. Furthermore, mutant mice have significant reduction in the critical pituitary transcriptional activator-1 (PIT1). Through breeding, the Lhx3W227ter/W227ter genotype was placed onto the 129/Sv and C57BL/6 backgrounds. Intriguingly, the genetic background significantly affected viability: whereas Lhx3W227ter/W227ter animals were found in the expected frequencies in C57BL/6, homozygous animals were not viable in the 129/Sv genetic environment. The hormone marker and PIT1 reductions observed in Lhx3W227ter/W227ter mice on a mixed background were also seen in the separate strains but in some cases were more severe in 129/Sv. To further characterize the molecular changes in diseased mice, we conducted a quantitative proteomic analysis of pituitary proteins. This showed significantly lower levels of PRL, pro-opiomelanocortin (ACTH), and α-glycoprotein subunit proteins in Lhx3W227ter/W227ter mice. Together, these data show that hormone deficiency disease is apparent in early prenatal stages in this CPHD model system. Furthermore, as is noted in human disease, genetic background significantly impacts the phenotypic outcome of these monogenic endocrine diseases.

GATA2 transcription factor and LIM homeodomain proteins Islet1 (ISL1) and LIM homeobox 3 (LHX3) are suspected to be involved in gonadotrope cell fate and maintenance. The GnRH receptor gene (Gnrhr), crucial for gonadotrope function, is expressed in the pituitary gland from embryonic day 13.5 onward, well before LH and FSH β-subunits. This expression pattern together with the presence of WGATAR and TAAT motifs in Gnrhr promoter sequences suggests the involvement of early transcription factors in promoter activation. In this study, using a well-characterized transgenic mouse model, GATA2 was found colocalized with Gnrhr promoter activity in the pituitary. Transient transfection of Gnrhr promoter luciferase fusion constructs together with either GATA2 expression vectors or small interfering RNA in gonadotrope cell lines indicated that GATA2, which typically acts as a trans-activator, unexpectedly repressed Gnrhr promoter activity. Using DNA chromatography affinity and EMSA, we demonstrated that GATA2 operates via a response element containing a peculiar palindromic GATA motif that overlaps a critical TAAT motif involved in LHX3/ISL1 trans-activation. Indeed, despite the inhibitory action of GATA2, this element displayed a clear-cut enhancer activity in gonadotrope cells. Chromatin immunoprecipitation assays indicated that GATA2, LHX3, and ISL1 interact with a Gnrhr promoter fragment encompassing this element. The trans-repressive action of GATA2 on Gnrhr promoter activity is likely balanced or even hindered by trans-activating effects of LIM homeodomain proteins via this novel bifunctional LIM/GATA response element. Such a hierarchical interplay may contribute to finely adjust Gnrhr gene expression in gonadotrope cell lineage during pituitary development as well as in the adult animal.

The pituitary gland produces hormones that play important roles in both the development and homeostasis of the body. Ontogeny of the anterior and posterior pituitary is orchestrated by inputs from neighboring tissues, cellular signaling molecules and transcription factors. Disruption of expression or function of these factors has been implicated in the etiology of combined pituitary hormone deficiency (CPHD). These include the transcription factors HESX1, PROP1, POU1F1, LHX3, LHX4, OTX2, SOX2, SOX3 and GLI2. This review focuses on summarizing most recent mutations in LHX4 and OTX2 responsible for pituitary hormone deficiency. In both genetic defects of LHX4 and OTX2, there is high variability in clinical manifestations even in the same family. In addition, there is no clear phenotype-genotype correlation. These findings indicate that the other genetic and/or environmental factors influence the phenotype. In addition, the variability might reflect a plasticity during pituitary development and maintenance. Over the past two decades, a genetic basis for pituitary hormone deficiency and the mechanism of pituitary development have been clarified. It should be kept in mind that this review is not comprehensive, and defects of other transcriptional factors have been described in patients with CPHD. Furthermore, the causes in many patients with CPHD have not yet been determined. Therefore, continuing efforts for the clarification of the etiology are necessary.

SummaryObjective Combined pituitary hormone deficiency (CPHD) is characterized by deficiencies of two or more anterior pituitary hormones. Its genetic cause is unknown in the majority of cases. The Hedgehog (Hh) signalling pathway has been implicated in disorders associated with pituitary development. Mutations in Sonic Hedgehog (SHH) have been described in patients with holoprosencephaly (with or without pituitary involvement). Hedgehog interacting protein (HHIP) has been associated with variations in adult height in genome wide association studies. We investigated whether mutations in these two genes of the Hh pathway, SHH and HHIP, could result in ′idiopathic′ CPHD. Design/Patients We directly sequenced the coding regions and exon – intron boundaries of SHH and HHIP in 93 CPHD patients of the Dutch HYPOPIT study in whom mutations in the classical CPHD genes PROP1, POU1F1, HESX1, LHX3 and LHX4 had been ruled out. We compared the expression of Hh genes in Hep3B transfected cells between wild-type proteins and mutants. Results We identified three single-nucleotide variants (p.Ala226Thr, c.1078C>T and c.*8G>T) in SHH. The function of the latter was severely affected in our in vitro assay. In HHIP, we detected a new activating variant c.-1G>C, which increases HHIP's inhibiting function on the Hh pathway. Conclusions Our results suggest involvement of the Hedgehog pathway in CPHD. We suggest that both SHH and HHIP are investigated as a second screening in CPHD, after mutations in the classical CPHD genes have been ruled out.

LIM domains are zinc-binding motifs that mediate protein–protein interactions and are found in a wide variety of cytoplasmic and nuclear proteins. The nuclear LIM domain family members have a number of different functions including transcription factors, gene regulation, cell fate determination, organization of the cytoskeleton and tumour formation exerting their function through various LIM domain interacting protein partners/cofactors. Nuclear LIM domain interacting proteins/factors have not been reported in any protozoan parasites including Leishmania. Here, we report for the first time cloning, characterization and subcellular localization of nuclear LIM interactor-interacting factor (NLI) like protein from Leishmania donovani, the causative agent of Indian Kala-azar. Primary sequence analysis of LdNLI revealed presence of characteristic features of nuclear LIM interactor-interacting factor. However, leishmanial NLI represents a distinct kinetoplastid group, clustered in a separate branch of the phylogenic tree. The sub-cellular distribution of LdNLI revealed the discreet localization in nucleus and kinetoplast only, suggesting that the gene may have a role in parasite gene expression.

Pituitary stalk interruption syndrome (PSIS) is a rare congenital defect manifesting with varying degrees of pituitary hormone deficiency. The signs and symptoms of PSIS during the neonatal period and infancy are often overlooked and therefore diagnosis is delayed. The typical manifestations of PSIS can be detected by magnetic resonance imaging. Several genes in the Wnt, Notch and Shh signalling pathways related to hypothalamic-pituitary development, such as PIT1, PROP1, LHX3/LHX4, PROKR2, OTX2, TGIF and HESX1, have been found to be associated with PSIS. Nevertheless, the aetiology in the majority of cases still remains unknown. In the present review, we provide an overview of clinical features of PSIS and summarise our current understanding of the underlying pathogenic mechanisms for this rare syndrome. Furthermore, we propose future research directions that may help our understanding of the aetiology of PSIS.

SummaryDuring development, two cell types born from closely related progenitor pools often express identical transcriptional regulators despite their completely distinct characteristics. This phenomenon implies the need for a mechanism that operates to segregate the identities of the two cell types throughout differentiation after initial fate commitment. To understand this mechanism, we investigated the fate specification of spinal V2a interneurons, which share important developmental genes with motor neurons (MNs). We demonstrate that the paired homeodomain factor Chx10 functions as a critical determinant for V2a fate and is required to consolidate V2a identity in postmitotic neurons. Chx10 actively promotes V2a fate, downstream of the LIM-homeodomain factor Lhx3, while concomitantly suppressing the MN developmental program by preventing the MN-specific transcription complex from binding and activating MN genes. This dual activity enables Chx10 to effectively separate the V2a and MN pathways. Our study uncovers a widely applicable gene regulatory principle for segregating related cell fates.

LIM homeodomain factors regulate the development of many cell types. However, transcriptional coactivators that mediate their developmental function remain poorly defined. To address these, we examined how two related NLI-dependent LIM complexes, which govern the development of spinal motor neurons and V2a interneurons, activate the transcription in the embryonic spinal cord. We found that single-stranded DNA-binding proteins are recruited to these LIM complexes via NLI, and enhance their transcriptional activation potential. Ssdp1 and Ssdp2 (Ssdp1/2) are highly expressed in the neural tube and promote motor neuron differentiation in the embryonic spinal cord and P19 stem cells. Inhibition of Ssdp1/2 activity in mouse and chick embryos suppresses the generation of motor neurons and V2a interneurons. Furthermore, Ssdp1/2 recruit histone-modifying enzymes to the motor neuron-specifying LIM complex and trigger acetylation and lysine 4 trimethylation of histone H3, which are well-established chromatin marks for active transcription. Our results suggest that Ssdp1/2 function as crucial transcriptional coactivators for LIM complexes to specify spinal neuronal identities during development.

During spinal cord development, motor neuron (MN) axons exit the spinal cord ventrally, although the molecular basis for this process remains poorly understood. STAM1 and Hrs form a complex involved with endosomal targeting of cargo proteins, including the chemokine receptor CXCR4. Interestingly, the absence of CXCR4 signaling in spinal MNs is known to enforce improper extension of the axons into the dorsal side of the spinal cord. Here we report that the MN-specific Isl1-Lhx3 complex directly transactivates the Stam1 gene and STAM1 functions in determining the ventral spinal MN axonal projections. STAM1 is co-expressed with Hrs in embryonic spinal MNs, and knock-down of STAM1 in the developing chick spinal cord results in down-regulation of the expression of CXCR4, accompanied by dorsally projecting motor axons. Interestingly, overexpression of STAM1 or CXCR4 also results in dorsal projection of motor axons, suggesting that proper CXCR4 protein level is critical for the ventral motor axon trajectory. Our results reveal a critical regulatory axis for the ventral axonal trajectory of developing spinal MNs, consisting of the Isl1-Lhx3 complex, STAM1 and CXCR4.

Anterior pituitary aplasia (APA) is a very rare cause of congenital-onset multiple pituitary hormone deficiency (CO-MPHD). We report on molecular analysis and clinical follow-up of three previously reported cases of APA [Scommegna et al., 2004], who share a characteristic physical and neuropsychological profile. Mutation analysis of genes encoding transcription factors involved in pituitary development (PROP1, POUF1, HESX1, LHX3, and LHX4) did not demonstrate a any mutation. In order to identify the genetic cause underlying the phenotypes we performed an array-based comparative genomic hybridization (array-CGH), which showed a cryptic interstitial deletion of 9p (200 kb), including the TEK and MOBKL2B, in one patient. Although an apparently identical deletion was carried by the clinically normal father, we assumed that the patient's phenotype might be due to a recessive mutation in the other allele. However, sequence analysis of exons and splice junctions of these genes did not detect pathogenic or predisposing variants in the three patients. We suggest that the constellation of clinical signs in these patients constitutes a previously undescribed syndrome, whose genetic cause has yet to be identified.

Although δ-crystallin (δ-crys), also known as lens protein, is transiently expressed in Rathke's pouch (RP) of the chick embryo, detailed temporal and spatial expression patterns have been obscure. In this study, to understand the relationship between the δ-crys mRNA-expressing region and RP formation, we examined the embryonic expression pattern of δ-crys mRNA in the primordium of the adenohypophysis. δ-crys mRNA expression was initially found at stage 15 anterior to the foregut and posterior to the invaginated oral ectoderm. After RP formation, the δ-crys mRNA was expressed in the post-ventral region of RP and the anterior region of RP. δ-crys mRNA expression was then restricted to the cephalic lobe of the pituitary gland. From stage 20, the δ-crys and alpha-glycoprotein subunit (αGSU) mRNA-expressing regions were almost completely overlapping. The αGSU mRNA-expressing region is thought to be the primordium of the pars tuberalis, and these regions were overlapped with the Lhx3 mRNA-expressing region. The intensity of δ-crys mRNA expression gradually decreased with development and completely disappeared by stage 34. These results suggest that the embryonic chick pituitary gland consists of two different regions labeled with δ-crys and Lhx3.

Combinatorial transcription codes generate the myriad of cell types during development and thus likely provide crucial insights into directed differentiation of stem cells to a specific cell type. The LIM complex composed of Isl1 and Lhx3 directs the specification of spinal motor neurons (MNs) in embryos. Here, we report that Isl1–Lhx3, a LIM-complex mimicking fusion, induces a signature of MN transcriptome and concomitantly suppresses interneuron differentiation programs, thereby serving as a potent and specific inducer of MNs in stem cells. We show that an equimolar ratio of Isl1 and Lhx3 and the LIM domain of Lhx3 are crucial for generating MNs without up-regulating interneuron genes. These led us to design Isl1–Lhx3, which maintains the desirable 1:1 ratio of Isl1 and Lhx3 and the LIM domain of Lhx3. Isl1–Lhx3 drives MN differentiation with high specificity and efficiency in the spinal cord and embryonic stem cells, bypassing the need for sonic hedgehog (Shh). RNA-seq analysis revealed that Isl1–Lhx3 induces the expression of a battery of MN genes that control various functional aspects of MNs, while suppressing key interneuron genes. Our studies uncover a highly efficient method for directed MN generation and MN gene networks. Our results also demonstrate a general strategy of using embryonic transcription complexes for producing specific cell types from stem cells.

Actin-related proteins (Arps) are a highly conserved family of proteins that have extensive sequence and structural similarity to actin. All characterized Arps are components of large multimeric complexes associated with chromatin or the cytoskeleton. In addition, the human genome encodes five conserved but largely uncharacterized "orphan" Arps, which appear to be mostly testis-specific. Here we show that Arp7A, which has 43% sequence identity with β-actin, forms a complex with the cytoskeletal proteins Tes and Mena in the subacrosomal layer of round spermatids. The N-terminal 65-residue extension to the actin-like fold of Arp7A interacts directly with Tes. The crystal structure of the 1-65(Arp7A)·LIM2-3(Tes)·EVH1(Mena) complex reveals that residues 28-49 of Arp7A contact the LIM2-3 domains of Tes. Two alanine residues from Arp7A that occupy equivalent apolar pockets in both LIM domains as well as an intervening GPAK linker that binds the LIM2-3 junction are critical for the Arp7A-Tes interaction. Equivalent occupied apolar pockets are also seen in the tandem LIM domain structures of LMO4 and Lhx3 bound to unrelated ligands. Our results indicate that apolar pocket interactions are a common feature of tandem LIM domain interactions, but ligand specificity is principally determined by the linker sequence.

Lhx3 genes are members of one of the six subfamilies of the LIM class homeobox genes. In ascidians, Lhx3 is known to play a critical role in endoderm differentiation, while in vertebrates Lhx3 is involved in the development of pituitary and subsets of motor neurons. It has been shown recently, using RT-PCR analysis, that two transcriptional isoforms a and b are differentially expressed during the larval development of Ciona intestinalis ( Christiaen et al., 2009 ). The present study provides an in-depth description of Lhx3 gene expression during the development of the two remote ascidian species, C. intestinalis and Halocynthia roretzi ; for this, 5′RACE and whole-mount in situ hybridization (WISH) were employed. In both species, maternal expression of Lhx3a , but not Lhx3b , is evident. In H. roretzi , the maternal Lhx3a transcripts have been detected by WISH in the animal half of early cleavage stage embryos. In both species, transcriptional isoform a is also zygotically expressed in the sensory vesicle and the visceral ganglion lineages from the neurula stage onward. By contrast, Lhx3b transcripts are expressed only zygotically and localized in the endoderm, notochord and mesenchyme lineages during cleavage stage. Lhx3a , but not Lhx3b , transcripts are subjected to trans -splicing. Additionally, in C. intestinalis , other variations in the 5′ region have been identified among Lhx3a transcripts. Although some differences are present, over-all developmental expression of Lhx3 is rather well conserved between the two ascidian species, which is quite different from that of vertebrate counterparts.

Background/Aims: Mutation frequencies of genes involved in combined pituitary hormone deficiency (CPHD) vary substantially between populations. The HYPOPIT study aims to obtain an overall picture of known and new genetic defects and variations in a nationwide cohort of Dutch (mostly) sporadic CPHD patients. Methods: We screened 79 CPHD patients from 78 families (regardless of MRI and hormonal phenotype) for mutations and deletions in PROP1, HESX1, POU1F1, LHX3 and LHX4, as well as the P89L and IVS3+1/+2 mutations in GH1, recently described to cause pituitary hormone impairment in addition to GH deficiency. Results: We did not find any mutation or deletion in PROP1, HESX1, LHX3 or LHX4, nor GH1 P89L and GH1 IVS3+1/+2 mutations. Among 12 patients with a typical ‘POU1F1 phenotype’, 1 patient was formerly known to have a POU1F1 mutation. This results in a POU1F1 mutation frequency in these patients of 8.3%. Conclusion: Thorough screening for mutations and deletions in PROP1, HESX1, POU1F1, LHX3, LHX4, as well as screening for GH1 P89L or GH1 IVS3+1/+2 mutations, did not reveal any genetic defect in our cohort of CPHD patients except for one formerly known POU1F1 mutation in 1 patient. Future research should focus on alternative explanations for CPHD, like other genes or environmental factors.

The anterior pituitary gland is a central regulator of growth, reproduction and homeostasis. The development of the pituitary gland depends on the sequential temporal and spatial expression of transcription factors and signalling molecules. Naturally occurring and transgenic murine models have demonstrated a role for many of these molecules in the aetiology of congenital hypopituitarism. These include the transcription factors HESX1, PROP1, POU1F1, LHX3, LHX4, PITX1, PITX2, OTX2, SOX2 and SOX3. Mutations in any of the genes involved in pituitary development may result in congenital hypopituitarism, which manifests as the deficiency in one or more pituitary hormones. The phenotype can be highly variable and may consist of isolated hypopituitarism, or more complex disorders such as septo-optic dysplasia (SOD) and holoprosencephaly. Neonates with congenital hypopituitarism may present with non-specific symptoms, with or without associated developmental defects such as ocular, midline and genital abnormalities. Alternatively, they may be initially asymptomatic but at risk of developing pituitary hormone deficiencies over time. The overall incidence of mutations in known transcription factors in patients with hypopituitarism is low, indicating that many genes remain to be identified. Their characterization will further elucidate the pathogenesis of this complex condition and will shed light on normal pituitary development.

Summary Axial muscles are innervated by motor neurons of the median motor column (MMC). In contrast to the segmentally restricted motor columns that innervate limb, body wall, and neuronal targets, MMC neurons are generated along the entire length of the spinal cord. We show that the specification of MMC fate involves a dorsoventral signaling program mediated by three Wnt proteins (Wnt4, Wnt5a, and Wnt5b) expressed in and around the floor plate. These Wnts appear to establish a ventralhigh to dorsallow signaling gradient and promote MMC identity and connectivity by maintaining expression of the LIM homeodomain proteins Lhx3/4 in spinal motor neurons. Elevation of Wnt4/5 activity generates additional MMC neurons at the expense of other motor neuron columnar subtypes, whereas depletion of Wnt4/5 activity inhibits the production of MMC neurons. Thus, two dorsoventral signaling pathways, mediated by Shh and Wnt4/5, are required to establish an early binary divergence in motor neuron columnar identity.

The LIM domain only protein 7 (LMO7), a member of the PDZ and LIM domain-containing protein family is a candidate gene with possible roles in embryonic development and breast cancer progression. LMO7 has been linked to actin cytoskeleton organization through nectin/afadin and to cell–cell adhesion by means of E-cadherin/catenin. In addition, LMO7 has been shown to regulate transcription of the nuclear membrane protein Emerin and other muscle relevant genes. In this study, we used in situ hybridization to investigate LMO7 expression during embryonic development in three widely used vertebrate model species: the zebrafish, the chicken and the mouse. Our temporal and spatial gene expression analysis revealed both common and distinct patterns between these species. In mouse and chicken embryos we found expression in the outflow tract, the inflow tract, the pro-epicardial organ and the second heart field, structures highly important in the developing heart. Furthermore, gene knockdown experiments in zebrafish embryos resulted in severe defects in heart development with effects on the conduction system and on heart localization. In summary, we present here the first developmental study of LMO7. We reveal the temporal and spatial expression patterns of this important gene during mouse, chicken and fish development and our findings suggest essential functions for LMO7 during vertebrate heart development. Developmental Dynamics 237:3940–3952, 2008. © 2008 Wiley-Liss, Inc.

The LHX3 gene encodes LIM homeodomain class transcription factors that have important roles to play in pituitary and nervous system development. On the one hand, mutations of LHX3 are associated with deficiencies of growth hormone (GH), prolactin (PRL), luteotrophic hormone (LH), follicle-stimulating hormone (FSH) and thyroidstimulating hormone (TSH); on the other hand, mutations of LHX3 are also associated with combined pituitary hormone deficiency (CPHD) diseases in human and animal models. To date, few polymorphisms of the bovine LHX3 gene have been reported. In this study, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and DNA sequencing methods were employed to screen the genetic variations within the bovine LHX3 gene in 802 Chinese indigenous cattle. The results revealed three novel single-nucleotide polymorphisms (SNPs): AY923832: g.7553G>A, 7631C>T and 7668C>G. Among them, a synonymous mutation of exon II was identified: GAG (Glu) >GAA (Glu) at position 72 aa (AY923832:g.7553G>A) of LHX3 (403aa) in the four Chinese bovine breeds. Significant statistical differences in genotypic frequencies for exon II and its flanking region of the LHX3 gene implied that the polymorphic locus was significantly associated with cattle breeds by the χ 2-test (χ 2 = 68.975, df = 6, P