Search

Aquatic photosynthetic organisms, including the green alga, Chlamydomonas reinhardtii, induce a set of genes for a carbon concentrating mechanism (CCM) through the CO2-signalling system, to acclimate to CO2-limiting stress conditions. We have described a regulatory gene, Ccm1, which was shown to regulate CCM induction in C. reinhardtii. In this review, we summarize the current understanding of the regulatory process, which controls the expression of genes for the CCM. In particular, CCM1-regulated genes and possible functions of Ccm1 in the CO2-signalling pathway are discussed, in relation to findings in other green algae and cyanobacteria.

The liverwort Marchantia polymorpha L. synthesizes various long-chain polyunsaturated fatty acids including arachidonic acid and eicosapentaenoic acid, neither of which is produced by higher plants. Here we report the effects of temperature on long-chain polyunsaturated fatty acid accumulation in the liverwort. The accumulation of ω-3 polyunsaturated fatty acids increased significantly as the growth temperature decreased. Specifically, the relative content of eicosapentaenoic acid to total fatty acids at 5 °C was approximately 3-fold higher than at 25 °C. On the other hand, the accumulation of ω-6 polyunsaturated fatty acids decreased at low temperatures. An analysis of gene expression indicated that the mRNA of the MpFAD3 gene for ER ω-3 desaturase increased significantly at 5 °C. These results indicate that in the liverwort the n-3 pathway was enhanced at low temperature, mainly via expression of the cold-induced ω-3 desaturase gene, leading to increased accumulation of eicosapentaenoic acid.

SUMMARYCtBP/BARS is a unique protein family in having quite diversified cellular functions, intercellular localizations,and developmental roles. ANGUSTIFOLIA (AN) is the sole homolog of CtBP/BARS from Arabidopsis thaliana,although it has plant AN-specific motifs and a long C-terminus. Previous studies suggested that AN wouldfunction in the nucleus as a transcriptional co-repressor, as CtBPs function in animals; however, preciseverification has been lacking. In this paper, we isolated a homologous gene (MAN)ofAN from liverwort,Marchantia polymorpha. Transformation of the Arabidopsis an-1 mutant with 35S-driven MAN completelycomplemented the an-1 phenotype, although it lacks the putative nuclear localization signal (NLS) that existsinANproteinsisolatedfromother plantspecies.WeconstructedseveralplasmidsforexpressingmodifiedANswith amino acid substitutions in known motifs. The results clearly indicated that modified AN with mutationsin the putative NLS-like domain could complement the an-1 phenotype. Therefore, we re-examinedlocalization of AN using several techniques. Our results demonstrated that AN localizes on punctuatestructures around the Golgi, partially overlapping with a trans-Golgi network resident, which highlighted anunexpected link between leaf development and membrane trafficking. We should reconsider the roles andevolutionary traits of AN based on these findings.Keywords: ANGUSTIFOLIA, CtBP/BARS, Golgi, Marchantia polymorpha, TGN.INTRODUCTIONLeaf development is divided into two processes, cell prolif-eration and cell differentiation. In the cell differentiationprocess, genetic pathways controlling leaf cell shape havebeen revealed by the characterization of two mutants ofArabidopsis thaliana (hereafter Arabidopsis): angustifolia(an) and rotundifolia3 (rot3). The an mutant was originallyisolated by Re´dei (1962) as a mutant having a narrow leafand twisted fruit. Later studies reported that an has tric-homes with two branches (Hu¨lskampet al., 1994) and its leafcells are narrower and thicker than wild-type cells (Tsukayaet al., 1994; Tsuge et al., 1996). In contrast, rot3 has short,rounded leaves resulting from reduced cell expansion alongthe leaf length direction (Tsuge et al., 1996). These axis-specific defects in cell expansion demonstrate two inde-pendent polarity-dependent cell expansion systems (Tsugeet al., 1996; Tsukaya, 2002).

High expression of transgene is one of the key requirements for the successful establishment of transgenic plants to produce a lot of proteins or metabolites. Although the cauliflower mosaic virus 35S (CaMV35S) promoter and the nopaline synthase (NOS) terminator are often used for this purpose, their efficiencies vary to plant species used. In a liverwort, Marchantia polymorpha L., the CaMV35S promoter and the NOS terminator do not show significant enhancing effect of transgene expression. To construct more efficient gene expression system of the liverwort, we employed the transient gene expression assay system. As a result, the endogenous elongation factor 1a promoter and Flowering locus T1 terminator from the liverwort led to enhance transient gene expression, approximately 75 and 3 times, respectively, compared to the CaMV35S promoter and the NOS terminator. Furthermore, we found that the endogenous 5�-UTR of the liverwort ADH-like UDP glucose dehydrogenase (MpUDP) yielded an enhancement of 15 times greater than in cases without the MpUDP 5�-UTR. These results indicate that DNA elements enhancing gene expression can be obtained efficiently by the transient gene expression assay in a short period of time, promising the application to the transgene expression system for production of proteins and metabolites in the liverwort.

The complete nucleotide sequence of chloroplast DNA (121,025 base pairs, bp) from a liverwort, Marchantia polymorpha, has made clear the entire gene organization of the chloroplast genome. Quite a few genes encoding components of photosynthesis and protein synthesis machinery have been identified by comparative computer analysis. We also determined the complete nucleotide sequence of the liverwort mitochondrial DNA and deduced 96 possible genes in the sequence of 186,608 bp. The complete chloroplast genome encodes twenty introns (19 group II and 1 group I) in 18 different genes. One of the chloroplast group II introns separates a ribosomal protein gene in a trans-position. The mitochondrial genome contains thirty-two introns (25 group II and 7 group I) in the coding regions of 17 genes. From the evolutionary point of view, we describe the origin of organellar introns and give evidence for vertical and horizontal intron transfers and their intragenomic propagation. Furthermore, we describe the gene organization of the Y chromosome in the dioecious liverwort M. polymorpha, the first detailed view of a Y chromosome in a haploid organism. On the 10 megabase (Mb) Y chromosome, 64 genes are identified, 14 of which are detected only in the male genome. These 14 genes are expressed in reproductive organs but not in vegetative thalli, suggesting their participation in male reproductive functions. These findings indicate that the Y and X chromosomes share the same ancestral autosome and support the prediction that in a haploid organism essential genes on sex chromosomes are more likely to persist than in a diploid organism.

Linseed flax (Linum usitatissimum L.) is an industrially important oil crop, which includes large amounts of alpha-linolenic acid (18:3) and lignan in its seed oil. We report here the metabolic engineering of flax plants to increase carotenoid amount in seeds. Agrobacterium-mediated transformation of flax was performed to express the phytoene synthase gene (crtB) derived from the soil bacterium Pantoea ananatis (formerly called Erwinia uredovora 20D3) under the control of the cauliflower mosaic virus (CaMV) 35S constitutive promoter or the Arabidopsis thaliana fatty acid elongase 1 gene (FAE1) seed-specific promoter. As a result, eight transgenic flax plants were generated. They formed orange seeds (embryos), in which phytoene, alpha-carotene, and beta-carotene were newly accumulated in addition to increased amounts of lutein, while untransformed flax plants formed light-yellow seeds, in which only lutein was detected. Interestingly, despite the control of the CaMV 35S promoter, the expression of crtB was not observed in the leaves but in the seeds in the transgenic flax plants. Total carotenoid amounts in these seeds were 65.4-156.3 microg/g fresh weight, which corresponded to 7.8- to 18.6-fold increase, compared with those of untransformed controls. These results suggest that the flux of phytoene synthesis from geranylgeranyl diphosphate was first promoted by the expressed crtB gene product (CrtB), and then phytoene was consecutively decomposed to the downstream metabolites alpha-carotene, beta-carotene, and lutein, as catalyzed by endogenous carotenoid biosynthetic enzymes in seeds. The transgenic flaxseeds enriched with the carotenoids could be valuable as nutritional sources for human health.

Photosynthetic acclimation to CO2-limiting stress is associated with control of genetic and physiological responses through a signal transduction pathway, followed by integrated monitoring of the environmental changes. Although several CO2-responsive genes have been previously isolated, genome-wide analysis has not been applied to the isolation of CO2-responsive genes that may function as part of a carbon-concentrating mechanism (CCM) in photosynthetic eukaryotes. By comparing expression profiles of cells grown under CO2-rich conditions with those of cells grown under CO2-limiting conditions using a cDNA membrane array containing 10,368 expressed sequence tags, 51 low-CO2 inducible genes and 32 genes repressed by low CO2 whose mRNA levels were changed more than 2.5-fold in Chlamydomonas reinhardtii Dangeard were detected. The fact that the induction of almost all low-CO2 inducible genes was impaired in the ccm1 mutant suggests that CCM1 is a master regulator of CCM through putative low-CO2 signal transduction pathways. Among low-CO2 inducible genes, two novel genes, LciA and LciB, were identified, which may be involved in inorganic carbon transport. Possible functions of low-CO2 inducible and/or CCM1-regulated genes are discussed in relation to the CCM.

The liverwort Marchantia polymorpha contains high proportions of arachidonic and eicosapentaenoic acids. In general, these C20 polyunsaturated fatty acids (PUFA) are synthesized from linoleic and alpha -linolenic acids, respectively, by a series of reactions catalyzed by Delta(6)-desaturase, an ELO-like enzyme involved in Delta(6) elongation and Delta(5)-desaturase. Here we report the isolation and characterization of the cDNAs, MpDES6, MpELO1 and MpDES5, coding for the respective enzymes from M. polymorpha. Co-expression of the MpDES6, MpELO1 and MpDES5 cDNAs resulted in the accumulation of arachidonic and eicosapentaenoic acids in the methylotrophic yeast Pichia pastoris. Interestingly, Delta(6) desaturation by the expression of the MpDES6 cDNA appears to occur both in glycerolipids and the acyl-CoA pool, although other lower-plant Delta(6)-desaturases are known to have a strong preference for glycerolipids.

We report generation of 9,301 expressed sequence tags (ESTs) derived from callus cells of Euphorbia tirucalli in search of candidate genes involved in the triterpenoid and sterol biosyntheses. After assembling 4,342 redundant ESTs into 1,252 clusters, a total of 6,211 non-redundant sequences were obtained. Database search revealed that 4,449 out of the 6,211 sequences shared significant similarities to known nucleotide or amino acid sequences, while the remaining 1,762 showed no significant matches and appear to represent novel genes in E. tirucalli. The annotations assigned to the hit database entries suggest that 48 of the unique sequences are involved in triterpenoid and sterol biosyntheses. Although functions of genes tagged by the 48 sequences are yet to be determined, the EST resource described here should contribute to identification of genes participating in the triterpenoid and sterol biosyntheses in E. tirucalli.

In lower land plants, genes controlling the transition from vegetative growth to sexual reproduction have not yet been identified. In the dioecious liverwort Marchantia polymorpha, the transition to sexual reproduction accompanied by the formation of sexual organs on the gametophytic thallus is initiated under long-day conditions. By particle bombardment-mediated mutagenesis, we generated a mutant of M. polymorpha that constitutively forms sexual organs. This mutant is fully fertile, showing that the mutation does not affect formation of male or female sexual organs per se. Genetic analysis reveals that this phenotype is caused by mutation of a single autosomal locus, suggesting that this mutation defines or controls a gene regulating the transition to sexual reproduction in M. polymorpha.

Expression of Cah1, encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii Dangeard, is activated when cells are exposed to low-CO2 conditions (0.04% [v/v]) in light. By using an arylsulfatase reporter gene, a regulatory region essential for the transcriptional activation of Cah1 was delimited to a 63-bp fragment between –293 and –231 relative to the transcription start site. Linker-scan analysis of the 63-bp region identified two enhancer elements, EE-1 (AGATTTTCACCGGTTGGAAGGAGGT) and EE-2 (CGACTTACGAA). Gel mobility shift assays indicated that nuclear extracts purified from cells grown under low-CO2 conditions in light contained DNA-binding proteins specifically interacting with EE-1 and EE-2. Gel mobility shift assays using mutant oligonucleotide probes revealed that the protein binding to EE-1 preferentially recognized a 9-bp sequence stretch (AGATTTTCA) of EE-1, containing a conserved sequence motif named EEC, GANTTNC, which is also present in EE-2. The EE-1- and EE-2-binding proteins interacted with the EECs contained in both of the two enhancer elements in vitro. Four EECs in the 5′-upstream region from –651 to –231 of Cah1 played a central role in the transcriptional activation of Cah1 under low-CO2 conditions. These EEC-binding proteins were present even in cells grown under high-CO2 conditions (5% [v/v]) or in the dark when Cah1 is not activated. On the basis of these results, the relationship between the transcriptional regulation of Cah1 and protein-binding to the enhancer elements in the 5′-upstream region of Cah1 is discussed.

We have isolated a beta-ketoacyl CoA synthase (KCS) gene, MpFAE2, from a liverwort, Marchantia polymorpha, and identified its substrate specificity using the technique of dsRNA-mediated gene silencing and overexpression. KCS catalyzes an essential reaction in the fatty acid elongation process, i.e., condensation of malonyl-CoA with acyl-CoA. By introducing a construct with a hairpin structure containing a partial MpFAE2 gene, the level of the MpFAE2 gene expression was suppressed constitutively. The transgenic plants showed a specific accumulation of fatty acid 18:0. In contrast, in transgenic M. polymorpha plants overexpressing the MpFAE2 gene, fatty acid 22:0 is accumulated. These results indicate that the MpFAE2 gene product catalyzes the elongation steps of 18:0 to 20:0 and possibly also of 20:0 to 22:0.

Fatty acid chain elongation is a crucial step in the biosynthesis of long chain fatty acids. An essential reaction in the elongation process is condensation of malonyl-CoA with acyl-CoA, which is catalyzed by beta-ketoacyl-CoA synthase (KCS) in plants. We have isolated and characterized the MpFAE3 gene, one of the KCS gene family in the liverwort Marchantia polymorpha. Transgenic M. polymorpha plants overexpressing MpFAE3 accumulate fatty acids 18:0, 20:0, and 22:0. In these plants, the amount of 16:0 is reduced to 50% of wild type. In a heterologous assay, transgenic methylotrophic yeast expressing the MpFAE3 gene accumulates fatty acid 18:0 and generates several longer fatty acids which are not detectable in the control, accompanied by a decrease of 16:0. These observations indicate that the MpFAE3 protein is preferentially involved in the elongation of 16:0 to 18:0 and also in the subsequent steps of 18:0 to 20:0 and 20:0 to 22:0 in M. polymorpha.

In the haploid dioecious liverwort, Marchantia polymorpha, the X chromosome, but not the Y, carries a cluster of ribosomal RNA genes (rDNAs). Here we show that sequences of 5S, 17S, 5.8S and 26S rDNAs are highly conserved (>99% identity) between the X chromosomal and autosomal rDNA repeat units, but the intergenic spacer sequences differ considerably. The most prominent difference is the presence of a 615-bp DNA fragment in the intergenic spacer, X615, which has accumulated predominantly in the rDNA cluster of the X chromosome. These observations suggest that the rDNA repeat unit on the X chromosome evolved independently of that on autosomes, incorporating sex chromosome-specific sequences.

Aquatic photosynthetic organisms, including the green alga Chlamydomonas reinhardtii , induce a set of genes for a carbon-concentrating mechanism (CCM) to acclimate to CO 2 -limiting conditions. This acclimation is modulated by some mechanisms in the cell to sense CO 2 availability. Previously, a high-CO 2 -requiring mutant C16 defective in an induction of the CCM was isolated from C. reinhardtii by gene tagging. By using this pleiotropic mutant, we isolated a nuclear regulatory gene, Ccm1 , encoding a 699-aa hydrophilic protein with a putative zinc-finger motif in its N-terminal region and a Gln repeat characteristic of transcriptional activators. Introduction of Ccm1 into this mutant restored an active carbon transport through the CCM, development of a pyrenoid structure in the chloroplast, and induction of a set of CCM-related genes. That a 5,128-base Ccm1 transcript and also the translation product of 76 kDa were detected in both high- and low-CO 2 conditions suggests that CCM1 might be modified posttranslationally. These data indicate that Ccm1 is essential to control the induction of CCM by sensing CO 2 availability in Chlamydomonas cells. In addition, complementation assay and identification of the mutation site of another pleiotropic mutant, cia5 , revealed that His-54 within the putative zinc-finger motif of the CCM1 is crucial to its regulatory function.

The molecular cytogenetic organization of 17S ribosomal RNA genes (17S rDNA), a part of the 45S rDNA repeat, was investigated on the chromosomes of the liverwort Marchantia polymorpha using fluorescence in-situ hybridization (FISH). The numbers of 17S rDNA loci visualized in female and male chromosomes were ten and nine, respectively. This heterogeneous localization was due to the presence of an additional 17S rDNA locus on the X chromosome and its absence on the Y chromosome. The signal on the X chromosome covered almost the entire region of its long arm. The other nine signals were observed on the same loci of respective autosomes in both sexes. Southern hybridization analysis revealed an additional band including 17S rDNA exclusively on EcoRI digested female genomic DNA supporting the existence of an additional 17S rDNA locus on the X chromosome.

In order to establish a basis for transformation technology in the petroleum plant Euphorbia tirucalli, the callus of the plant was infected with Agrobacterium, washed with distilled water, sterilized with distilled water containing 100 mg/l of carbenicillin, selected on solidified B5 medium containing 13 mg/l of G418 and 100 mg/l of carbenicillin, and then on solidified B5 medium containing 25 mg/l of G418 and 100 mg/l of carbenicillin for the transgenic calli, and then the callus lines were subcultured successively on solidified B5 medium containing 50 mg/l of G418. We performed PCR analysis of sterilized G418-resistant callus line DNA and concluded that the gene introduced was integrated into the callus genome.

Unlike higher plants, the dioecious liverwort, Marchantia polymorpha, has uniquely small sex chromosomes, with X chromosomes present only in female gametophytes and Y chromosomes only in male gametophytes. We have constructed respective genomic libraries for male and female plantlets using a P1-derived artificial chromosome (pCYPAC2). With an average insert size of approximately 90 kb, each PAC library is estimated to cover the entire genome with a probability of more than 99.9%. Male-specific PAC clones were screened for by differential hybridization using male and female genomic DNAs as separate probes. Seventy male-specific PAC clones were identified. The male specificity of one of the clones, pMM4G7, was verified by Southern hybridization and PCR analysis. This clone was indeed located on the Y chromosome as verified by fluorescence in situ hybridization (FISH). This result shows that the Y chromosome contains unique sequences that are not present either on the X chromosome or any of the autosomes. Thus, the respective male and female libraries for M. polymorpha offer an opportunity to identify key genes involved in the process of sex differentiation and this unique system of sex determination.

Thalli of the haploid liverwort Marchantial polymorpha were successfully used for direct particle bombardment with plasmid pMT, which carries a hygromycin phosphotransferase gene (hpt) controlled by the CaMV 35S promoter and the NOS polyadenylation region. Hygromycin-resistant cell masses arose from the thallus surface and developed directly into hygromycin-resistant thalli. Southern blot analyses indicated that these thalli carried at least 1-4 copies of the hpt gene, which were stably transmitted to their asexual thallus progenies via gemma propagation for three generations. This transformation and direct plant regeneration protocol is expected to be a valuable tool for the molecular analysis of this lower land plant.

We detected 5-LOX (arachidonate 5-lipoxygenase) in the homogenate of Marchantia polymorpha by spectrophotometry and mass spectrometry. LC/MS/MS analysis indicated that the liverwort 5-LOX produced 5-hydroperoxy-6,8,11,14-eicosatetraenoic acid (5-HPETE) with arachidonic acid as a substrate. The 5-LOX activity showed a Ca(2+) response, as demonstrated for human 5-LOX. These findings suggest that the liverwort utilizes an arachidonate cascade in a defense signal response.

The 5S ribosomal RNA genes (5S rDNA) are located independently from the 45S rDNA repeats containing 18S, 5.8S and 26S ribosomal RNA genes in higher eukaryotes. Southern blot and fluorescence in situ hybridization analyses demonstrated that the 5S rDNAs are encoded in the 45S rDNA repeat unit of a liverwort, Marchantia polymorpha, in contrast to higher plants. Sequencing analyses revealed that a single-repeat unit of the M. polymorpha nuclear rDNA, which is 16 103 bp in length, contained a 5S rDNA downstream of 18S, 5.8S and 26S rDNA. To our knowledge, this is the first report on co-localization of the 5S and 45S rDNAs in the rDNA repeat of land plants. Furthermore, we detected a 5S rDNA in the rDNA repeat of a moss, Funaria hygrometrica, by a homology search in a database. These findings suggest that there has been structural re-organization of the rDNAs after divergence of the bryophytes from the other plant species in the course of evolution.

We constructed an equalized cDNA library from Arabidopsis inflorescence shoot apices including inflorescence meristem, floral meristem and flower tissue collected before stage 5 of flower development. The cDNA clones were arrayed on membranes and were differentially screened using cDNA pools from vegetative and inflorescence tissues as probes. Each clone was classified by expression specificity and expression level. By removing the clones that displayed hybridization signals, 384 out of 3264 clones in this library remained as candidates for inflorescence-specific mRNAs expressed at low levels. Sequence analysis of all selected clones indicated that 53 were identical and 120 were homologous to genes in public protein databases. The remaining 211 selected clones had no significant amino acid sequence similarities with those deduced from any reported genes, though 62 of them appeared in Arabidopsis expressed sequenced tags (ESTs). About 40% of the selected clones were novel, validating the present approach for gene discovery. Northern blot analysis of 22 randomly selected clones confirmed that most were expressed preferentially in inflorescence tissues. In addition, many clones were transcribed at relatively low levels. We demonstrate that the screening method of the present study is useful for systematic classification of cDNA species based on expression specificity.

In plants, calcium-dependent calmodulin-independent protein kinases (CDPKs) are the predominant calcium-regulated protein kinases and their genes are encoded by a multigene family. A CDPK gene was cloned from a liverwort, Marchantia polymorpha, which showed a high level of sequence similarities to other higher plant CDPK genes. The liverwort CDPK gene consisted of 9 exons and 8 introns. The 6th and 7th exons (Exon 6A and Exon 6B) were almost identical except for 4-amino acid substitutions, both of which coded for EF-hands in the calcium-binding domain. RT-PCR analysis revealed that two species of mature mRNA containing either Exon 6A or Exon 6B were generated from a single CDPK gene by mutually exclusive alternative splicing. Both histidine-tagged fusion proteins derived from cDNAs containing either Exon 6A or Exon 6B exhibited calcium-dependent protein kinase activity in vitro. Preferential accumulation of the mature mRNA with Exon 6A detected in male sexual organ implies possible sexual control of the ratio between the two CDPK isozymes through alternative splicing. Functions and evolution of CDPKs are discussed based on the structure and expression of the liverwort CDPK gene.

A higher copy number of the rbcL gene in Chlamydomonas reinhardtii genome upregulates synthesis of Rubisco gene products (Uchida et al. 2005). To determine the influence of rbcL gene number increase on the viability and morphology of the cell, we examined the growth speed, size of pyrenoid and density of antigen to Rubisco holoenzyme antibody in the three-rbcL (3L) transformant. There were no differences detected in these phenotypes between the 3L transformant and the control transformant.

To isolate genes essential to the carbon concentrating mechanism and the CO2-signal transduction mechanisms, seven high-CO2 requiring mutants were isolated from Chlamydomonas reinhardtii by the insertion of nit1 gene encoding nitrate reductase. These mutants were grouped into two classes. Class I contains mutants that show a severe CO2-requiring phenotype (C1 and C3). Class II includes those with a moderate CO2-requiring phenotype (C2, C5, C7, C15, and C16). One of the class II mutants, C5, appeared to be defective in the utilization of intracellularly accumulated inorganic carbon. On the other hand, the mutant C16 appeared to be defective not only in the uptake of carbon but also in the induction of the periplasmic carbonic anhydrase gene, CAH1, as well as in the development of pyrenoid structure under low-CO2 conditions. These mutations in C5 and C16 mutants appeared to be caused by single insertional events of the introduced DNA fragment into the genomic DNA, suggesting that their corresponding genes could be tagged using the nit1 gene.Key words: carbon concentrating mechanism, carbonic anhydrase, gene tagging, insertional mutagenesis, nitrate reductase.

The nad7 gene, encoding subunit 7 of NADH dehydrogenase, is mitochondrially encoded in seed plants. In the liverwort, Marchantia polymorpha, only a pseudogene is located in the mitochondrial genome. We have now identified the functional nad7 gene copy in the nuclear genome of Marchantia, coding for a polypeptide of 468 amino acids. The nuclear-encoded nad7 has lost the two group II introns present in the mitochondrial pseudogene copy. Instead, a typical nuclear intron is found to split an exon encoding the presumptive mitochondrial targeting signal peptide and the mature subunit 7 of NADH dehydrogenase. These results suggest that RNA-mediated gene transfer from the mitochondrial into the nuclear genome occurs not only in seed plants but also in bryophytes.

Although 29 tRNA genes have been deduced from the complete nucleotide sequence of the mitochondrial genome from the liverwort Marchantia polymorpha, a tRNAIle gene decoding AUU and AUC codons is conspicuously absent. In order to address the question of the possible involvement of nuclear-encoded tRNA, we isolated and identified three variant copies of the nuclear-encoded tRNAIle(AAU) gene from the liverwort. Northern analysis showed the presence of nuclear-encoded tRNAIle both in the mitochondrion and the cytosol, while both chloroplast DNA-encoded tRNAIle and nuclear-encoded tRNATyr were absent in liverwort mitochondria. These results unequivocally establish that import of nuclear tRNAIle into mitochondria indeed occurs in one of the most primitive plants, M. polymorpha.

The complete nucleotide sequence of chloroplast DNA (121,025 basepairs, bp) from a liverwort, Marchantia polymorpha, has made clear the entire gene organization of the chloroplast genome. Quite a few genes encoding components of photosynthesis and protein synthesis machinery have been identified by comparative computer analysis. We also identified the complete nucleotide sequence of the liverwort mitochondrial DNA and deduced 96 possible genes in the sequence of 186,608 bp. The complete nucleotide sequence from chloroplast DNA comprises twenty introns (19 group II and 1 group I) in 18 different genes. One of the chloroplast group II introns separated the ribosomal protein gene in the trans-position. The mitochondrial genome also has thirty-two introns (25 group II and 7 group I) in the coding regions of 17 genes. From the evolutionary point of view, we describe the origin of organellar introns which gave the evidence for their vertical and horizontal transfers and their intragenic propagation, and RNA editing which was apparently lacking in the liverwort chloroplast and mitochondrial genomes.

Euphorbia tirucalli is a potential source of commercially important chemicals such as sterols. Here we report the first successful plant regeneration from internode explants of E. tirucalli. Adventitious buds were efficiently induced on LS medium supplemented with 0.02 mg l-1 thidiazuron. On average of four experiments, 17.3 adventitious buds were induced from 12 explants on this medium. The adventitious buds grew into shoots during subsequent cultures on a hormone-free LS medium. For rooting treatment, we cultured these shoots on the LS medium containing 0.02 mg l-1 naphthalenacetic acid, followed by on the half-strength LS medium without vitamins, and were successful to obtain whole plantlets.

A pseudogene, psi nad7, which has significant sequence similarity (66.7% amino acid identity) with the bovine nuclear gene for a 49 kDa subunit of the NADH dehydrogenase (NADH:ubiquinone oxidoreductase, EC 1.6.99.3), has been identified on the mitochondrial genome of the liverwort Marchantia polymorpha. The predicted coding region, which includes six termination codons, is actively transcribed into RNA molecules of 16 and 9.6 kb in length, but RNA splicing products were not detected in the liverwort mitochondria. Genomic DNA blot analysis and RNA blot analysis using poly(A)+ RNA suggest that a structurally related nuclear gene encodes the mitochondrial ND7 polypeptide. These results imply that this psi nad7 is a relic of a gene transfer event from the mitochondrial genome into the nuclear genome during mitochondrial evolution in M. polymorpha.

Inorganic carbon transport into RubisCO is one of the major limiting steps in photosynthetic carbon fixation. To find out components of the carbon concentrating mechanism in a cyanobacterium, Synechococcus PCC7942, nucleotide sequence of the 8.4-kb genomic region upstream from the carbonic anhydrase gene ( icfA ) was determined. Six open reading frames ( orfs ) were located on this genomic region. When two of the six orfs ( orf371 and orf109 ) just upstream from icfA was disrrupted, cells were sensitive to low pH condition (pH 6.2). Functional roles of these orfs are discussed with relation to the carbon concentrating mechanism.

CtBP/BARS is a unique protein family in having quite diversified cellular functions, intercellular localizations, and developmental roles. ANGUSTIFOLIA (AN) is the sole homolog of CtBP/BARS from Arabidopsis thaliana, although it has plant AN-specific motifs and a long C-terminus. Previous studies suggested that AN would function in the nucleus as a transcriptional co-repressor, as CtBPs function in animals; however, precise verification has been lacking. In this paper, we isolated a homologous gene (MAN) of AN from liverwort, Marchantia polymorpha. Transformation of the Arabidopsis an-1 mutant with 35S-driven MAN completely complemented the an-1 phenotype, although it lacks the putative nuclear localization signal (NLS) that exists in AN proteins isolated from other plant species. We constructed several plasmids for expressing modified ANs with amino acid substitutions in known motifs. The results clearly indicated that modified AN with mutations in the putative NLS-like domain could complement the an-1 phenotype. Therefore, we re-examined localization of AN using several techniques. Our results demonstrated that AN localizes on punctuate structures around the Golgi, partially overlapping with a trans-Golgi network resident, which highlighted an unexpected link between leaf development and membrane trafficking. We should reconsider the roles and evolutionary traits of AN based on these findings.

Three genes homologous to plant lipoxygenase genes were identified from the EST libraries of Marchantia polymorpha , in order to clarify the function of LOXs in bryophytes. Full-length genes were isolated using 5′- and 3′-RACE methods and named MpLOX1 , MpLOX2 , and MpLOX3 , respectively. To investigate the enzymatic activities of liverwort LOXs, recombinant MpLOX1, MpLOX2, and MpLOX3 proteins were prepared from Escherichia coli cells expressing the corresponding gene. LC–MS/MS analyses and chiral column chromatography of their reaction products showed that MpLOX1 codes for 11 S /15 S -lipoxygenase against eicosapentaenoic acid and for 15 S -lipoxygenase against arachidonic acid, and that MpLOX2 and MpLOX3 code for 15 S -lipoxygenase against eicosapentaenoic and arachidonic acids. Phylogenetic analysis showed that the liverwort lipoxygenase genes separated from the ancestor of higher plants in the early stages of plant evolution. Quantification analyses suggested that arachidonic acid and eicosapentaenoic acid were preferred substrates. Furthermore, each liverwort lipoxygenase exhibited highest activity at pH 7.0 and dependency on Ca 2+ ion in the oxygenation reaction.

Prostaglandins (PGs) are important local messenger molecules in many tissues and organs of animals including human. For applications in medicine and animal care, PGs are mostly purified from animal tissues or chemically synthesized. To generate a clean, reliable, and inexpensive source for PGs, we have now engineered expression of a suitable cyclooxygenase gene in Escherichia coli and achieved production levels of up to 2.7 mg l(-1) PGF(2α). The cyclooxygenase gene cloned from the red alga Gracilaria vermiculophylla appears to be fully functional without any eukaryotic modifications in E. coli. A crude extract of the recombinant E. coli cells is able to convert in vitro the substrate arachidonic acid (AA) to PGF(2α). Furthermore, these E. coli cells produced PGF(2α) in a medium supplemented with AA and secreted the PGF(2α) product. To our knowledge, this is the first report of the functional expression of a cyclooxygenase gene and concomitant production of PGF(2α) in E. coli. The successful microbial synthesis of PGs with reliable yields promises a novel pharmaceutical tool to produce PGF(2α) at significantly reduced prices and greater purity.

Libraries of cosmid and plasmid clones covering the entire region of mtDNA from the liverwortMarchantia polymorpha were constructed. These clones were used for the determination of the complete nucleotide sequence of the liverwort mtDNA totally 186,608 bp (GenBank no. M68929) and including genes for 3 species of ribosomal RNAs, 29 genes for 27 species of transfer RNAs, and 30 genes for functionally known proteins (16 ribosomal proteins, 3 subunits of cytochromec oxidase, apocytochromeb protein, 3 subunits of H+-ATPase, and 7 subunits of NADH ubiquinone oxidoreductase). The genome also contains 32 unidentified open reading frames. Thus the complete nucleotide sequences from both chloroplast and mitochondrial genomes have been determined in the same organism. Plasmid clones are available upon the request.

We detected 16 genes for ribosomal proteins in the complete sequence of the mitochondrial DNA from a liverwort, Marchantia polymorpha. The genes formed two major clusters, rps12-rps7 and rps10-rpl2-rps19-rps3-rpl16-rpl5- rps14-rps8- rpl6-rps13-rps11-rps1, very similar in organization to Escherichia coli ribosomal protein operons (str and S10-spc-alpha operons, respectively). In contrast, rps2 and rps4 genes were located separately in the liverwort mitochondrial genome (the latter was part of the alpha operon in E. coli). Furthermore, several ribosomal proteins encoded by the liverwort mitochondrial genome differed substantially in size from their counterparts in E. coli and liverwort chloroplast.

Analysis of the mitochondrial DNA of a liverwort Marchantia polymorpha by electron microscopy and restriction endonuclease mapping indicated that the liverwort mitochondrial genome was a single circular molecule of about 184,400 base-pairs. We have determined the complete sequence of the liverwort mitochondrial DNA and detected 94 possible genes in the sequence of 186,608 base-pairs. These included genes for three species of ribosomal RNA, 29 genes for 27 species of transfer RNA and 30 open reading frames (ORFs) for functionally known proteins (16 ribosomal proteins, 3 subunits of H(+)-ATPase, 3 subunits of cytochrome c oxidase, apocytochrome b protein and 7 subunits of NADH ubiquinone oxidoreductase). Three ORFs showed similarity to ORFs of unknown function in the mitochondrial genomes of other organisms. Furthermore, 29 ORFs were predicted as possible genes by using the index of G + C content in first, second and third letters of codons (42.0 +/- 10.9%, 37.0 +/- 13.2% and 26.4 +/- 9.4%, respectively) obtained from the codon usages of identified liverwort genes. To date, 32 introns belonging to either group I or group II intron have been found in the coding regions of 17 genes including ribosomal RNA genes (rrn18 and rrn26), a transfer RNA gene (trnS) and a pseudogene (psi nad7). RNA editing was apparently lacking in liverwort mitochondria since the nucleotide sequences of the liverwort mitochondrial DNA were well-conserved at the DNA level.

Brassica napus (canola) plants were genetically manipulated to increase the amount and composition of carotenoids in seeds by using seven key enzyme genes involved in ketocarotenoid formation, which originated from a soil bacterium Pantoea ananatis (formerly called Erwinia uredovora 20D3), and marine bacteria Brevundimonas sp. strain SD212 and Paracoccus sp. strain N81106 (formerly called Agrobacterium aurantiacum). The seven key gene cassettes, in which each gene was surrounded by an appropriate promoter and terminator, were connected in a tandem manner, and the resulting constructs (17 kb) were inserted into a binary vector and used for transformation of B. napus. Surprisingly, 73-85% of the regenerated plants retained all seven genes, and formed orange- or pinkish orange-coloured seeds (embryos), while untransformed controls had light yellow-coloured seeds with predominant accumulation of lutein. Three of the transgenic lines were analysed further. The total amount of carotenoids in these seeds was 412-657 microg g(-1) fresh weight, which was a 19- to 30-fold increase compared with that of untransformed controls. The total amount of ketocarotenoids was 60-190 microg g(-1) fresh weight. beta-Carotene was the predominant carotenoid, with significant amounts of alpha-carotene, echinenone, phytoene, lutein, and canthaxanthin also detected in the transgenic seeds. The ratio of hydroxylated carotenoids to overall carotenoids was quite small relative to the ratio of ketocarotenoids to overall carotenoids. Interestingly, expression of many endogenous carotenogenic genes was also altered in the transgenic seeds, suggesting that their expression was affected by an increase in carotenoid biosynthesis.

A 5.5-kb HindIII fragment of Synechocystis PCC6803 containing a liverwort (ORF316) homolog encoding a putative zinc finger protein was cloned. Nucleotide sequence analysis showed that the homology of the amino acid sequence deduced from the ORF326 of Synechocystis PCC6803 with the counterparts of a liverwort and tobacco was 50% and 46%, respectively. Synechocystis ORF326 also showed 38% homology with the dedB gene in Escherichia coli. The gene organization of the region in these species of organisms was quite different. This suggests that the Synechocystis ORF326 and liverwort ORF316 genes may be related to a common regulatory gene, but not photosynthetic gene characteristic to chloroplasts.

Euphorbia tirucalli L., which is also known as a petroleum plant, produces a large amount of phytosterols and triterpenes. During their biosynthesis, squalene synthase converts two molecules of the hydrophilic substrate farnesyl diphosphate into a hydrophobic product, squalene. An E. tirucalli cDNA clone of a putative squalene synthase gene (EtSS) was isolated by RT-PCR followed by 5′- and 3′-RACE. The restriction fragment polymorphisms revealed by Southern blot analysis suggest that EtSS is a single copy gene. The glycine at the 287th residue from the N-terminal end of domain C has replaced alanine, which is conserved among all the other SS sequences deposited in the Genbank database. The N-terminal 380 residues of the hydrophilic sequence was expressed as a peptide-tagged protein in E. coli, and the resultant bacterial crude extract was incubated with farnesyl diphosphate and NADPH. GC-MS analysis showed that squalene was detected in the in vitro reaction mixture. E. tirucalli transgenic callus lines, in which EtSS was overexpressed, accumulated increased amounts of phytosterols as compared with that of wild type callus. RT-PCR analysis of wild type E. tirucalli plants revealed that the EtSS transcript accumulated in almost equal amounts in the stems and the leaves with a stalk, while a lower amount was detected in the roots. In situ hybridization analysis revealed that prominent antisense-probe signal was detected in the cambia within bundle sheathes. These results indicate that EtSS functions prominently in cambia, which are located adjacent to conductive tubes, and that this gene plays important roles in phytosterol accumulation in petroleum plants.

The liverwort Marchantia polymorpha L. synthesizes arachidonic (ARA) and eicosapentaenoic acids (EPA) from linoleic and alpha-linolenic acids respectively by a series of reactions catalyzed by Delta6-desaturase, Delta6-elongase, and Delta5-desaturase. Overexpression of the M. polymorpha genes encoding these enzymes in transgenic M. polymorpha plants resulted in 3- and 2-fold accumulation of ARA and EPA respectively, as compared to those in the wild type. When these three genes were introduced and co-expressed in tobacco plants, in which long-chain polyunsaturated fatty acids (LCPUFAs) are not native cellular components, ARA and EPA represented up to 15.5% and 4.9% respectively of the total fatty acid in the leaves. Similarly in soybean, C20-LCPUFAs represented up to 19.5% of the total fatty acids in the seeds. These results suggest that M. polymorpha can provide genes crucial to the production of C20-LCPUFAs in transgenic plants.

In plants, phytosterols and triterpenes are major secondary metabolites. In an attempt to reveal the mechanism for synthesis and storage of these compounds, we isolated and characterized cDNA clones for squalene epoxidase (SE), from a succulent shrub, Euphorbia tirucalli. Southern-blot analysis of total DNA using cDNA fragment as a probe showed that the E. tirucalli squalene epoxidase gene (EtSE) is single-copy type in terms of restriction fragment length polymorphism (RFLP). Deduced amino-acid sequence of the cDNA showed 83 and 75% identity to those of rice and ginseng, respectively, in an area excluding a less homologous putative transmembrane region in the N-terminal end. Functional characterization with heterologous expression using an erg1-disrupted yeast mutant KLN1 indicated that the EtSE recovered ergosterol auxotrophy of the mutant, and gave rise to an ergosterol accumulation in the EtSE transformant. RT-PCR analysis showed the EtSE transcripts in leaves and stem internodes accumulated in almost equal amounts, which were more abundant than those in roots. In situ hybridization using EtSE antisense probe revealed prominent EtSE expression on a parenchyma cell adjacent to primary laticifers that were located in a rosary orientation in the inner region of cortex. This is the first report of expression of a gene for a rate-limiting enzyme in mevalonate pathway in organs and tissues of a plant.

Euphorbia tirucalli L., known as the petroleum plant, produces a large amount of triterpenes, such as beta-amyrin. Degenerate RT-PCR based on the sequences conserved among known beta-amyrin synthases led to cloning of a putative triterpene synthase cDNA, EtAS, from leaves of E. tirucalli. The deduced amino acid sequence of the EtAS cDNA showed the highest identity of 82% to the Panax ginseng beta-amyrin synthase. Heterologous expression of the EtAS ORF in the methylotrophic yeast, Pichia pastoris, resulted in production of beta-amyrin, revealing that the EtAS cDNA codes for a beta-amyrin synthase. This is the first report of a gene involved in the triterpene synthetic pathway from Euphorbiaceae plants.

In the haploid dioecious liverwort, Marchantia polymorpha, the X chromosome, but not the Y, carries a cluster of ribosomal RNA genes (rDNAs). Here we show that sequences of 5S, 17S, 5.8S and 26S rDNAs are highly conserved (99% identity) between the X chromosomal and autosomal rDNA repeat units, but the intergenic spacer sequences differ considerably. The most prominent difference is the presence of a 615-bp DNA fragment in the intergenic spacer, X615, which has accumulated predominantly in the rDNA cluster of the X chromosome. These observations suggest that the rDNA repeat unit on the X chromosome evolved independently of that on autosomes, incorporating sex chromosome-specific sequences.

The liverwort Marchantia polymorpha has X and Y chromosomes in the respective female and male haploids. Here we report the successful exploitation of representational difference analyses to isolate DNA markers for the sex chromosomes. Two female-specific and six male-specific DNA fragments were genetically confirmed to originate from the X and Y chromosomes, respectively.