Search

The ease with which racemic mixtures crystallize compared with the equivalent chiral systems is routinely taken advantage of to produce crystals of small molecules. However, biological macromolecules such as DNA and proteins are naturally chiral, and thus the limited range of chiral space groups available hampers the crystallization of such molecules. Inspiring work over the past 15 years has shown that racemic mixtures of proteins, which were made possible by impressive advances in protein chemical synthesis, can indeed improve the success rate of protein crystallization experiments. More recently, the racemic crystallization approach was extended to include nucleic acids as a possible aid in the determination of enantiopure DNA crystal structures. Here, findings are reported that suggest that the benefits may extend beyond this. Two racemic crystal structures of the DNA sequence d(CCCGGG) are described which were found to fold into A-form DNA. This form differs from the Z-form DNA conformation adopted by the chiral equivalent in the solid state, suggesting that the use of racemates may also favour the emergence of new conformations. Importantly, the racemic mixture forms interactions in the solid state that differ from the chiral equivalent (including the formation of racemic pseudo-helices), suggesting that the use of racemic DNA mixtures could provide new possibilities for the design of precise self-assembled nanomaterials and nanostructures.

Because microRNAs (miRNAs) are biological indicators for the diagnosis, treatment, and monitoring of tumors, cancers, and other diseases, it is significant to develop a rapid, sensitive, and reliable miRNA detection platform. In this study, based on miRNA-21 detection, DNA-a with a 3′ end overhang and Texas Red fluorophore-labeled 5′ end was designed, which reacts with miRNA-21 and hybridizes with exonuclease III (Exo III), where the part connected to miRNA-21 is hydrolyzed, leaving a-DNA. At the same time, miRNA-21 is released to participate in the following reaction, to achieve cyclic amplification. a-DNA reacts with DNA-b conjugated to gold nanoparticles to achieve fluorescence quenching, with the quenching value denoted as F; additionally, after adding DNA-d and linked streptavidin immunomagnetic beads (SIBs), fluorescence recovery was achieved using DNA-c, with the recovered fluorescence recorded as F0. By comparing the difference in the fluorescence (F0 − F) between the two experiments, the amount of DNA-a hydrolyzed to produce a-DNA was established to determine the target miRNA-21 content. Under optimized conditions, by comparing the changes in the fluorescence signal, the developed strategy shows good sensitivity and repeatability, with a detection limit of 18 pM, good discriminative ability and selectivity, and promise for the early diagnosis of breast and intestinal cancers.

The structure of A-DNA with biological activity is double helix. Researches of A-DNA structure have wide application on the development of DNA drug. In aqueous solution, the structure of A-DNA will have a free transformation over time and be finally stabilized in the B-form. In this work, molecular dynamics simulations have been performed on the A-DNA with sequence of CCCGGCCGGG, to elucidate the influence of ionic valence and temperature on the structural stability of A-DNA in salt solution. The results show that the structure of A-DNA is more stable in AlCl

Accurate parametrization of force fields (FFs) is of ultimate importance for computer simulations to be reliable and to possess a predictive power. In this work, we analyzed, in multi-microsecond simulations of a 40-base-pair DNA fragment, the performance of four force fields, namely, the two recent major updates of CHARMM and two from the AMBER family. We focused on a description of double-helix DNA flexibility and dynamics both at atomistic and at mesoscale level in coarse-grained (CG) simulations. In addition to the traditional analysis of different base-pair and base-step parameters, we extended our analysis to investigate the ability of the force field to parametrize a CG DNA model by structure-based bottom-up coarse-graining, computing DNA persistence length as a function of ionic strength. Our simulations unambiguously showed that the CHARMM36 force field is unable to preserve DNA's structural stability at over-microsecond time scale. Both versions of the AMBER FF, parmbsc0 and parmbsc1, showed good agreement with experiment, with some bias of parmbsc0 parameters for intermediate A/B form DNA structures. The CHARMM27 force field provides stable atomistic trajectories and overall (among the considered force fields) the best fit to experimentally determined DNA flexibility parameters both at atomistic and at mesoscale level. Ministry of Education (MOE) Accepted version This work was supported by the Singapore Ministry of Education Academic Research Fund (AcRF) Tier 2 (MOE2014-T2-1-123 (ARC51/14)) and Tier 3 (MOE2012- T3-1-001) grants (to L.N.) and by the Swedish Research Council (grant 2017-03950 to A.P.L.).

P element transposase catalyzes the mobility of P element DNA transposons within the Drosophila genome. P element transposase exhibits several unique properties, including the requirement for a guanosine triphosphate cofactor and the generation of long staggered DNA breaks during transposition. To gain insights into these features, we determined the atomic structure of the Drosophila P element transposase strand transfer complex using cryo-EM. The structure of this post-transposition nucleoprotein complex reveals that the terminal single-stranded transposon DNA adopts unusual A-form and distorted B-form helical geometries that are stabilized by extensive protein-DNA interactions. Additionally, we infer that the bound guanosine triphosphate cofactor interacts with the terminal base of the transposon DNA, apparently to position the P element DNA for catalysis. Our structure provides the first view of the P element transposase superfamily, offers new insights into P element transposition and implies a transposition pathway fundamentally distinct from other cut-and-paste DNA transposases.

Double stranded DNA can adopt different forms, the so-called A-, B-, and Z-DNA, which play different biological roles. In this work, the thermodynamic and the kinetic parameters for the base-pair closing and opening in A-DNA and B-DNA were calculated by all-atom molecular dynamics simulations at different temperatures. The thermodynamic parameters of the base pair in B-DNA were in good agreement with the experimental results. The free energy barrier of breaking a single base stack results from the enthalpy increase ΔH caused by the disruption of hydrogen bonding and base-stacking interactions, as well as water and base interactions. The free energy barrier of base pair closing comes from the unfavorable entropy loss ΔS caused by the restriction of torsional angles and hydration. It was found that the enthalpy change ΔH and the entropy change ΔS for the base pair in A-DNA are much larger than those in B-DNA, and the transition rates between the opening and the closing state for the base pair in A-DNA are much slower than those in B-DNA. The large difference of the enthalpy and entropy change for forming the base pair in A-DNA and B-DNA results from different hydration in A-DNA and B-DNA. The hydration pattern observed around DNA is an accompanying process for forming the base pair, rather than a follow-up of the conformation.

The use of a small molecule compound to reduce toxic repeat RNA transcripts or their translated aberrant proteins to target repeat-expanded RNA/DNA with a G4C2 motif is a promising strategy to treat C9orf72-linked disorders. In this study, the crystal structures of DNA and RNA–DNA hybrid duplexes with the -GGGCCG- region as a G4C2 repeat motif were solved. Unusual groove widening and sharper bending of the G4C2 DNA duplex A-DNA conformation with B-form characteristics inside was observed. The G4C2 RNA–DNA hybrid duplex adopts a more typical rigid A form structure. Detailed structural analysis revealed that the G4C2 repeat motif of the DNA duplex exhibits a hydration shell and greater flexibility and serves as a ‘hot-spot’ for binding of the anthracene-based nickel complex, NiII(Chro)2 (Chro = Chromomycin A3). In addition to the original GGCC recognition site, NiII(Chro)2 has extended specificity and binds the flanked G:C base pairs of the GGCC core, resulting in minor groove contraction and straightening of the DNA backbone. We have also shown that Chro-metal complexes inhibit neuronal toxicity and suppresses locomotor deficits in a Drosophila model of C9orf72-associated ALS. The approach represents a new direction for drug discovery against ALS and FTD diseases by targeting G4C2 repeat motif DNA.

In ordinary aqueous solution, B-DNA is the major structural form of DNA. After the addition of ethanol, DNA is thought to be aggregated/condensed in the A-form structure. However, there is uncertainty as to whether the B-to-A conformational change is connected to the aggregation/condensation steps. In this study, we performed all-atom molecular dynamics simulations and calculated the free-energy surface involved in the A/B conformational transition for isolated and aggregated Dickerson-Drew dodecamers (DDDs) in water and 85% ethanol environments. We found in the case of an isolated DDD, the overall free-energy profile is entirely downhill to give the B-DNA conformation in both water and 85% ethanol. However, in the aggregated state and 85% ethanol environment, there is a free-energy minimum associated with the A-DNA region in addition to the global B-DNA minimum, and there is a ∼3 kcal/mol free-energy barrier to the A-to-B conformational change. The molecular dynamics results suggest that aggregation of DNA is essential for forming A-DNA.

The right-handed DNA helix exhibits two major conformations, A-DNA and B-DNA, depending on the environmental conditions. The B-DNA to A-DNA (B→A) transition is sequence specific, cooperative, and reversible. The reduced water activity due to the addition of solvents like ethanol or the presence of protein or drug molecules causes B→A transition. In several biological cases, B→A transition occurs at a local level where small fragments of a long DNA sequence undergoes B→A transition. In this review, we have discussed various aspects of B→A transition such as the role of water, sequence specificity, mechanism of B→A transition, etc. The review primarily focuses on the B→A mechanism involved at a local level, and finally its connection to the global transition in theoretical and experimental studies.

B- to A-DNA transition is known to be sensitive to the macroscopic properties of the solution, such as salt and ethanol concentrations. Microenvironmental effects on DNA conformational transition have been broadly studied. Providing an intuitive picture of how DNA responds to environmental changes is, however, still needed. Analyzing the chemical equilibrium of B-to-A DNA transition at critical concentrations, employing explicit-solvent simulations, is envisioned to help understand such microenvironmental effects. In the present study, free-energy calculations characterizing the B- to A-DNA transition and the distribution of cations were carried out in solvents with different ethanol concentrations. With the addition of ethanol, the most stable structure of DNA changes from the B- to A-form, in agreement with previous experimental observation. In 60% ethanol, a chemical equilibrium is found, showing reversible transition between B- and A-DNA. Analysis of the microenvironment around DNA suggests that with the increase of ethanol concentration, the cations exhibit a significant tendency to move toward the backbone, and mobility of water molecules around the major groove and backbone decreases gradually, leading eventually to a B-to-A transition. The present results provide a free-energy view of DNA microenvironment and of the role of cation motion in the conformational transition.

The motors that drive double-stranded DNA (dsDNA) genomes into viral capsids are among the strongest of all biological motors for which forces have been measured, but it is not known how they generate force. We previously proposed that the DNA is not a passive substrate but that it plays an active role in force generation. This “scrunchworm hypothesis” holds that the motor proteins repeatedly dehydrate and rehydrate the DNA, which then undergoes cyclic shortening and lengthening motions. These are captured by a coupled protein–DNA grip-and-release cycle to rectify the motion and translocate the DNA into the capsid. In this study, we examined the interactions of dsDNA with the dodecameric connector protein of bacteriophage ϕ29, using molecular dynamics simulations on four different DNA sequences, starting from two different conformations (A-DNA and B-DNA). In all four simulations starting with the protein equilibrated with A-DNA in the channel, we observed transitions to a common, metastable, highly scrunched conformation, designated A*. This conformation is very similar to one recently reported by Kumar and Grubmüller in much longer MD simulations on B-DNA docked into the ϕ29 connector. These results are significant for four reasons. First, the scrunched conformations occur spontaneously, without requiring lever-like protein motions often believed to be necessary for DNA translocation. Second, the transition takes place within the connector, providing the location of the putative “dehydrator”. Third, the protein has more contacts with one strand of the DNA than with the other; the former was identified in single-molecule laser tweezer experiments as the “load-bearing strand”. Finally, the spontaneity of the DNA–protein interaction suggests that it may play a role in the initial docking of DNA in motors like that of T4 that can load and package any sequence.

The structure of double-stranded DNA (dsDNA) is sensitive to solvent conditions. In solution, B-DNA is the favored conformation under physiological conditions, while A-DNA is the form found under low water activity. The A-form is induced locally in some protein-DNA complexes, and repeated transitions between the B- and A-forms have been proposed to generate the forces used to drive dsDNA into viral capsids during genome packaging. Here, we report analyses on previous molecular dynamics (MD) simulations on B-DNA, along with new MD simulations on the transition from A-DNA to B-DNA in solution. We introduce the A–B Index (ABI), a new metric along the A–B continuum, to quantify our results. When A-DNA is placed in an equilibrated solution at physiological ionic strength, there is no energy barrier to the transition to the B-form, which begins within about 1 ns. The transition is essentially complete within 5 ns, although occasionally a stretch of a few base pairs will remain A-like for up to ~10 ns. A comparison of four sequences with a range of predicted A-phobicities shows that more A-phobic sequences make the transition more rapidly than less A-phobic sequences. Simulations on dsDNA with a region of roughly one turn locked in the A-form allow us to characterize the A/B junction, which has an average bend angle of 20–30°. Fluctuations in this angle occur with characteristic times of about 10 ns.

CRISPR (clustered regularly interspaced short palindromic repeat) endonucleases are at the forefront of biotechnology, synthetic biology and gene editing. Methods for controlling enzyme properties promise to improve existing applications and enable new technologies. CRISPR enzymes rely on RNA cofactors to guide catalysis. Therefore, chemical modification of the guide RNA can be used to characterize structure-activity relationships within CRISPR ribonucleoprotein (RNP) enzymes and identify compatible chemistries for controlling activity. Here, we introduce chemical modifications to the sugar–phosphate backbone of Streptococcus pyogenes Cas9 CRISPR RNA (crRNA) to probe chemical and structural requirements. Ribose sugars that promoted or accommodated A-form helical architecture in and around the crRNA ‘seed’ region were tolerated best. A wider range of modifications were acceptable outside of the seed, especially D-2′-deoxyribose, and we exploited this property to facilitate exploration of greater chemical diversity within the seed. 2′-fluoro was the most compatible modification whereas bulkier O-methyl sugar modifications were less tolerated. Activity trends could be rationalized for selected crRNAs using RNP stability and DNA target binding experiments. Cas9 activity in vitro tolerated most chemical modifications at predicted 2′-hydroxyl contact positions, whereas editing activity in cells was much less tolerant. The biochemical principles of chemical modification identified here will guide CRISPR-Cas9 engineering and enable new or improved applications.

Apart from being storage devices for genetic information, nucleic acids can provide regulatory structures through evolutionarily optimized sequences. The interaction of proteins binding specifically to such sequences and resulting secondary structures, or the exposure of single-stranded DNA add a versatile regulatory framework for cells. Biochemical and structural biology experiments have revealed important underlying concepts of protein-DNA interactions but are often limited by ensemble averaging or static information. To decipher the dynamics of conformations adopted by protein-DNA complexes, single-molecule approaches have become a powerful resource over the past two decades. In particular single-molecule FRET (smFRET), which allows a read-out of DNA or protein conformations, became widely used. Here, we illustrate how to implement the technique and exemplarily describe how smFRET yields insights into conformational changes of DNA secondary structures induced by the single-stranded DNA binding protein SSB. We further explain how we use smFRET to study mechanisms of the replication initiator DnaA and the competition of DnaA and SSB for single-stranded DNA. We anticipate that smFRET will further develop into a particularly useful technique to study dynamic competitions of proteins for the same DNA substrate.

The objective of this study is to evaluate the structure and protein recognition properties of hybrid four-way junctions (4WJs) composed of DNA and peptide nucleic acid (PNA) strands. We compare a classic immobile DNA junction, J1, vs. six PNA-DNA junctions, including a number with blunt DNA ends and multiple PNA strands. Circular dichroism (CD) analysis reveals that hybrid 4WJs are composed of helices that possess structures intermediate between A- and B-form DNA, the apparent level of A-form structure correlates with the PNA content. The structure of hybrids that contain one PNA strand is sensitive to Mg(+2). For these constructs, the apparent B-form structure and conformational stability (Tm) increase in high Mg(+2). The blunt-ended junction, b4WJ-PNA3, possesses the highest B-form CD signals and Tm (40.1 °C) values vs. all hybrids and J1. Protein recognition studies are carried out using the recombinant DNA-binding protein, HMGB1b. HMGB1b binds the blunt ended single-PNA hybrids, b4WJ-PNA1 and b4WJ-PNA3, with high affinity. HMGB1b binds the multi-PNA hybrids, 4WJ-PNA1,3 and b4WJ-PNA1,3, but does not form stable protein-nucleic acid complexes. Protein interactions with hybrid 4WJs are influenced by the ratio of A- to B-form helices: hybrids with helices composed of higher levels of B-form structure preferentially associate with HMGB1b.

Platinum-based chemotherapeutics exert their therapeutic efficacy via the formation of DNA adducts which interfere with DNA replication, transcription and cell division and ultimately induce cell death. Repair and tolerance of these Pt-DNA lesions by nucleotide excision repair (NER) and homologous recombination (HR) can substantially reduce the effectiveness of therapy. Inhibition of these repair pathways, therefore, holds the potential to sensitize cancer cells to Pt treatment and increase clinical efficacy. Replication Protein A (RPA) plays essential roles in both NER and HR, along with its role in DNA replication and DNA damage checkpoint activation. Each of these functions is, in part, mediated by RPA binding to single-stranded DNA (ssDNA). Here we report the synthesis and characterization of novel derivatives of RPA small molecule inhibitors and their activity in models of epithelial ovarian cancer (EOC) and non-small cell lung cancer (NSCLC). We have synthesized analogs of our previously reported RPA inhibitor TDRL-505 and determined the structure-activity relationships. These data led us to the identification of TDRL-551, which exhibited a greater than 2-fold increase in in vitro activity. TDRL-551 showed synergy with Pt in tissue culture models of EOC and in vivo efficacy, as a single agent and in combination with platinum, in a NSCLC xenograft model. These data demonstrate the utility of RPA inhibition in EOC and NSCLC and the potential in developing novel anticancer therapeutics that target RPA-DNA interactions.

Hydration forces between DNA molecules in the A- and B-Form were studied using a newly developed technique enabling simultaneous in situ control of temperature and relative humidity. X-ray diffraction data were collected from oriented calf-thymus DNA fibers in the relative humidity range of 98%–70%, during which DNA undergoes the B- to A-form transition. Coexistence of both forms was observed over a finite humidity range at the transition. The change in DNA separation in response to variation in humidity, i.e. change of chemical potential, led to the derivation of a force-distance curve with a characteristic exponential decay constant of ∼ 2 A for both A- and B-DNA. While previous osmotic stress measurements had yielded similar force-decay constants, they were limited to B-DNA with a surface separation (wall-to-wall distance) typically > 5 A. The current investigation confirms that the hydration force remains dominant even in the dry A-DNA state and at surface separation down to ∼ 1.5 A, within the first hydration shell. It is shown that the observed chemical potential difference between the A and B states could be attributed to the water layer inside the major and minor grooves of the A-DNA double helices, which can partially interpenetrate each other in the tightly packed A phase. The humidity-controlled X-ray diffraction method described here can be employed to perform direct force measurements on a broad range of biological structures such as membranes and filamentous protein networks.

Empirical force fields seek to relate the configuration of a set of atoms to its energy, thus yielding the forces governing its dynamics, using classical physics rather than more expensive quantum mechanical calculations that are computationally intractable for large systems. Most force fields used to simulate biomolecular systems use fixed atomic partial charges, neglecting the influence of electronic polarization, instead making use of a mean-field approximation that may not be transferable across environments. Recent hardware and software developments make polarizable simulations feasible, and to this end, polarizable force fields represent the next generation of molecular dynamics simulation technology. In this work, we describe the refinement of a polarizable force field for DNA based on the classical Drude oscillator model by targeting quantum mechanical interaction energies and conformational energy profiles of model compounds necessary to build a complete DNA force field. The parametrization strategy employed in the present work seeks to correct weak base stacking in A- and B-DNA and the unwinding of Z-DNA observed in the previous version of the force field, called Drude-2013. Refinement of base nonbonded terms and reparametrization of dihedral terms in the glycosidic linkage, deoxyribofuranose rings, and important backbone torsions resulted in improved agreement with quantum mechanical potential energy surfaces. Notably, we expand on previous efforts by explicitly including Z-DNA conformational energetics in the refinement.

We present here a comparison of three different X-ray crystal structures of DNA tetradecamer sequence d(CCCGGGTACCCGGG)

DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations. MOE (Min. of Education, S’pore) Published version

The ion atmosphere around nucleic acids is an integral part of their solvated structure. However, detailed aspects of the ionic distribution are difficult to probe experimentally, and comparative studies for different structures of the same sequence are almost non-existent. Here, we have used large-scale molecular dynamics simulations to perform a comparative study of the ion distribution around (5'-CGCGCGCGCGCG-3')2 dodecamers in solution in B-DNA, A-RNA, Z-DNA and Z-RNA forms. The CG sequence is very sensitive to ionic strength and it allows the comparison with the rare but important left-handed forms. The ions investigated include Na(+), K(+) and Mg(2 +), with various concentrations of their chloride salts. Our results quantitatively describe the characteristics of the ionic distributions for different structures at varying ionic strengths, tracing these differences to nucleic acid structure and ion type. Several binding pockets with rather long ion residence times are described, both for the monovalent ions and for the hexahydrated Mg[(H2O)6](2+) ion. The conformations of these binding pockets include direct binding through desolvated ion bridges in the GpC steps in B-DNA and A-RNA; direct binding to backbone oxygens; binding of Mg[(H2O)6](2+) to distant phosphates, resulting in acute bending of A-RNA; tight 'ion traps' in Z-RNA between C-O2 and the C-O2' atoms in GpC steps; and others.

Base stacking is known to make an important contribution to the stability of DNA and RNA, and accordingly, significant efforts are ongoing to calculate stacking energies using ab initio quantum mechanical methods. To date, impressive improvements have been made in the model chemistries used to perform stacking energy calculations, including extensions that include robust treatments of electron correlation with extended basis sets, as required to treat interactions where dispersion makes a significant contribution. However, those efforts typically use rigid monomer geometries when calculating the interaction energies. To overcome this, in the present work, we describe a novel internal coordinate definition that allows the relative, intermolecular orientation of stacked base monomers to be constrained during geometry optimizations while allowing full optimization of the intramolecular degrees of freedom. Use of the novel reference frame to calculate the impact of full geometry optimization versus constraining the bases to be planar on base monomer stacking energies, combined with density-fitted, spin-component scaling MP2 treatment of electron correlation, shows that full optimization makes the average stacking energy more favorable by -3.4 and -1.5 kcal/mol for the canonical A and B conformations of the 16 5' to 3' base stacked monomers. Thus, treatment of geometry optimization impacts the stacking energies to an extent similar to or greater than the impact of current state of the art increases in the rigor of the model chemistry itself used to treat base stacking. Results also indicate that stacking favors the B-form of DNA, though the average difference versus the A-form decreases from -2.6 to -0.6 kcal/mol when the intramolecular geometry is allowed to fully relax. However, stacking involving cytosine is shown to favor the A-form of DNA, with that contribution generally larger in the fully optimized bases. The present results show the importance of allowing geometry optimization, as well as properly treating the appropriate model chemistry, in studies of nucleic acid base stacking.

The X-ray crystal structure of the DNA tetradecamer sequence d(CCGGGGTACCCCGG)(2) is reported at 1.4 Å resolution in the tetragonal space group P4(1)2(1)2. The sequence was designed to fold as a four-way junction. However, it forms an A-type double helix in the presence of barium chloride. The metal ion could not be identified in the electron-density map. The crystallographic asymmetric unit consists of one A-type double helix with 12 base pairs per turn, in contrast to 11 base pairs per turn for canonical A-DNA. A large number of solvent molecules have been identified in both the grooves of the duplex and around the backbone phosphate groups.

Little is known about the influence of multiple consecutive ‘non-standard’ (Z, 6-amino-5-nitro-2(1H)-pyridone, and P, 2-amino-imidazo[1,2-a]-1,3,5-triazin-4(8H)-one) nucleobase pairs on the structural parameters of duplex DNA. P:Z nucleobase pairs follow standard rules for Watson–Crick base pairing but have rearranged hydrogen bonding donor and acceptor groups. Using the X-ray crystal structure as a starting point, we have modeled the motions of a DNA duplex built from a self-complementary oligonucleotide (5΄-CTTATPPPZZZATAAG-3΄) in water over a period of 50 μs and calculated DNA local parameters, step parameters, helix parameters, and major/minor groove widths to examine how the presence of multiple, consecutive P:Z nucleobase pairs might impact helical structure. In these simulations, the PZ-containing DNA duplex exhibits a significantly wider major groove and greater average values of stagger, slide, rise, twist and h-rise than observed for a ‘control’ oligonucleotide in which P:Z nucleobase pairs are replaced by G:C. The molecular origins of these structural changes are likely associated with at least two differences between P:Z and G:C. First, the electrostatic properties of P:Z differ from G:C in terms of density distribution and dipole moment. Second, differences are seen in the base stacking of P:Z pairs in dinucleotide steps, arising from energetically favorable stacking of the nitro group in Z with π–electrons of the adjacent base.

Nucleic acids adopt a broad array of hydrogen-bonded structures that enable their diverse roles in the cell; even the familiar DNA double helix displays subtle architectural nuances that are sequence dependent. While there have been many approaches for recognition of B-form nucleic acids, A-form DNA recognition has lagged behind. Here, using a tight binding fluorescein-neomycin (F-neo) conjugate that can probe the electrostatic environment of A-form DNA major groove, we developed a fluorescent displacement assay to be used as a screen for DNA duplex-binding compounds. As opposed to intercalating dyes that can significantly perturb DNA structure, the groove binding F-neo allows the probing of native DNA conformation. In combination with the assay development and probing of DNA grooves, we also report the synthesis and binding of a series of neomycin-anthraquinone conjugates, two units with a known preference for binding GC rich DNA. The assay can be used to identify duplex DNA-binding compounds, as well as probe structural features of a target DNA duplex, and can easily be scaled up for high throughput screening of compound libraries.

Natural RNAs, especially tRNAs, are extensively modified to tailor structure and function diversities. Uracil is the most modified nucleobase among all natural nucleobases. Interestingly, >76% of uracil modifications are located on its 5-position. We have investigated the natural 5-methoxy (5-O-CH(3)) modification of uracil in the context of A-form oligonucleotide duplex. Our X-ray crystal structure indicates first a H-bond formation between the uracil 5-O-CH(3) and its 5'-phosphate. This novel H-bond is not observed when the oxygen of 5-O-CH(3) is replaced with a larger atom (selenium or sulfur). The 5-O-CH(3) modification does not cause significant structure and stability alterations. Moreover, our computational study is consistent with the experimental observation. The investigation on the uracil 5-position demonstrates the importance of this RNA modification at the atomic level. Our finding suggests a general interaction between the nucleobase and backbone and reveals a plausible function of the tRNA 5-O-CH(3) modification, which might potentially rigidify the local conformation and facilitates translation.

Molecular dynamics simulations have been performed to characterize the conformation of DNA that is present when DNA links gold nanoparticles to form nanoparticle superlattice crystals. To model the DNA-linked gold nanoparticles, four strands of DNA are used to connect two gold surfaces, with a small interstrand separation and high added salt to match experiment. A-form DNA was assumed for the initial conformation, as this form of DNA has a length per base-pair that matches lengths that have been inferred from X-ray measurements. The DNA structure was monitored for 40 ns, and the distributions of the slide and z(p) coordinates were obtained from the simulations. We find that all the double-stranded DNA (ds-DNA) strands transform from A- to B-DNA during the simulations. In addition, single-stranded DNAa (ss-DNAs) that are used to connect the ds-DNA to each surface are found to become adsorbed on the gold surfaces during this process, and the ds-DNAs bend (∼143°) at their junctions with the two gold surfaces to accommodate the observed distance between gold surfaces using B-form DNA. We infer from this that the short length of DNA between the gold surfaces is not due to the presence of A-DNA.

The crystal structure of the tetradecanucleotide sequence d(CCCCGGTACCGGGG)(2) has been determined at 2.5 Å resolution in the tetragonal space group P4(1). This sequence was designed with the expectation of a four-way junction. However, the sequence crystallized as an A-DNA duplex and represents more than one full turn of the A-helix. The crystallographic asymmetric unit consists of one tetradecanucleotide duplex. The structural parameters of the A-type DNA duplex structure and the crystal-packing arrangement are described. One Mn(2+) ion was identified with direct coordination to the N7 position of G(13) and a water molecule at the major-groove side of the C(2)·G(13) base pair.

We report the 2.6Å resolution crystal structure of the tetra-decamer d(CGCGGGTACCCGCG) in the tetragonal space group P4₃. This sequence contains the KpnI restriction site GGTACC in the centre which is flanked by alternating 'CG' sequences, and has a 'TA' step at the centre. These are features could favour the left-handed Z type helix. Despite this, overall the molecule has the A form. This is the first tetra-decamer crystallized in the A-DNA conformation, i.e. more than one full turn of the A helix. The crystallographic asymmetric unit consists of one tetra-decamer duplex. The helical twist and slide, as well as the base pair-base pair stacking interactions show alternations at the alternating pyrimidine-purine and purine-pyrimidine base steps. This variation is reminiscent of the dinucleotide repeat in left-handed Z-DNA helices. The crystal packing is unlike other A-DNA crystal structures, with each helix having a large number of contacts of many different types with symmetry-related neighbours.

Nucleic acids can fold into well-defined 3D structures that help determine their function. Knowing precise nucleic acid structures can also be used for the design of nucleic acid-based therapeutics. However, locations of hydrogen atoms, which are key players of nucleic acid function are normally not determined with X-ray crystallography. Accurate determination of hydrogen atom positions can provide indispensable information on protonation states, hydrogen bonding, and water architecture in nucleic acids. Here, we used neutron crystallography in combination with X-ray diffraction to obtain joint X-ray/neutron structures at both room- and cryo-temperatures of a self-complimentary A-DNA oligonucleotide d[GTGG(C(Se))CAC](2) containing 2’-SeCH(3) modification on Cyt5 (C(Se)) at pH 5.6. We directly observed protonation of a backbone phosphate oxygen of Ade7 at room temperature. The proton is replaced with hydrated Mg(2+) upon cooling the crystal to 100K, indicating that metal binding is favoured at low temperature, whereas proton binding is dominant at room temperature.

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

s We describe a new method used for quantitating weak interactions between proteins in which the weak interaction is “assisted” by a known DNA–DNA interaction. Oligonucleotides, which are conjugated to proteins of interest, contain short complementary DNA sequences that provide additional binding energy for protein–protein interactions. A stretch of unpaired bases links the protein to the hybridizing DNA sequence to allow formation of both protein–protein and DNA–DNA interactions with minimal structural interference. We validated the DNA-assisted binding method using heterodimerizing coiled-coil proteins. The method was then used to measure the predicted weak interaction between two domains of the Escherichia coli l -arabinose operon regulatory protein AraC. The interaction between domains has the expected magnitude ( K d = 0.37 mM) in the absence of arabinose. Upon addition of arabinose, we detected a weaker and unexpected interaction, which may necessitate modification of the proposed mechanism of AraC. The DNA-assisted binding method may also prove useful in the study of other weak protein–protein interactions.

We have previously shown that a critical region of the gata2 promoter contains an inverted CCAAT box and adopts a partial A-form DNA structure in vitro. At gastrula stages of development transcription requires binding of CBTF (CCAAT box transcription factor), a multi-subunit transcription factor, to this region. Xilf3 is one component of CBTF and the double stranded RNA binding domains (dsRBDs) of Xilf3 must be active for both binding to, and transcription from, this promoter. Here we determine the contribution of DNA sequence and structure at the gata2 promoter to transcriptional activity. In all the constructs we tested a CCAAT box was a requirement for full activity. However, base substitutions that increase B-form structure propensity in the sequences flanking the CCAAT box are equally able to decrease activity even if a CCAAT box is present. In contrast, mutations that maintain A-form propensity in these regions also maintain, or increase, transcription factor binding and transcriptional activity. We propose a two-component model for the interaction of CBTF with the gata2 promoter, requiring both a CCAAT sequence and flanking A-form DNA structures. These results support a novel role for dsRBDs in transcriptional regulation and suggest a function for A-form DNA in vivo.

The energies of intra- and inter-strand stacking interactions in model d(GpC) and d(CpG) two-base-pair steps were estimated by MP2/aug-cc-pVDZ single point calculations corrected for basis superposition errors. The stacked two-nucleobase pairs were constructed using experimental values of base pair and base step parameters taken from Nucleic Acid Database (http://ndbserver.rutgers.edu/). Three distinct polymorphic forms were analysed, namely A-, B- and Z-DNA. The applied methodology enables statistical analysis of structural and energetic diversities. The structural relationships between polymorphic forms are quite complex and depend on the sequence of pairs. The variability of parameters such as shift and tilt is almost the same irrespective of the polymorphic form and sequence of steps analysed. In contrast, shift and twist distributions easily discriminate all three polymorphic forms of DNA. Interestingly, despite significant structural diversities, the energies of the most frequent energy ranges are comparable irrespective of the polymorphic form and base sequence. There was observed compensation of inter- and intra-strand interactions, especially for d(GpC) and d(CpG) steps found in A- and B-DNA. Thus, among many other roles, these pairs act as a kind of energetic buffer, balancing the double helix.

In recent years, significant progress has been made towards uncovering the physical mechanisms of low-hydration polymorphism in double-helical DNA. The effect appears to be mechanistically similar in different biological systems, and it is due to the ability of water to form spanning H-bonded networks around biomacromolecules via a quasi-two-dimensional percolation transition. In the case of DNA, disintegration of the spanning H-bonded network leads to electrostatic condensation of DNA strands because, below the percolation threshold, water loses its high dielectric permittivity, whereas the concentration of neutralizing counterions becomes high. In this Concept article arguments propose that this simple electrostatic mechanism represents the universal origin of low-hydration polymorphism in DNA.

Fully modified 4'-thioDNA, an oligonucleotide only comprising 2'-deoxy-4'-thionucleosides, exhibited resistance to an endonuclease, in addition to preferable hybridization with RNA. Therefore, 4'-thioDNA is promising for application as a functional oligonucleotide. Fully modified 4'-thioDNA was found to behave like an RNA molecule, but no details of its structure beyond the results of circular dichroism analysis are available. Here, we have determined the structure of fully modified 4'-thioDNA with the sequence of d(CGCGAATTCGCG) by NMR. Most sugars take on the C3'-endo conformation. The major groove is narrow and deep, while the minor groove is wide and shallow. Thus, fully modified 4'-thioDNA takes on the A-form characteristic of RNA, both locally and globally. The only structure reported for 4'-thioDNA showed that partially modified 4'-thioDNA that contained some 2'-deoxy-4'-thionucleosides took on the B-form in the crystalline form. We have determined the structure of 4'-thioDNA in solution for the first time, and demonstrated unexpected differences between the two structures. The origin of the formation of the A-form is discussed. The remarkable biochemical properties reported for fully modified 4'-thioDNA, including nuclease-resistance, are rationalized in the light of the elucidated structure.

A comprehensive conformational analysis of isolated 2'-beta-deoxy-6-azacytidine (d6AC), an analogue of therapeutically active 6-azacytidine (6AC), has been performed by means of ab initio calculations at the MP2/6-311++G(2df,pd)//DFT B3LYP/6-31G(d,p) level of theory. Among the 81 conformers located within a 7.83 kcal/mol Gibbs energy range at T = 298.15 K, 38 contain syn-oriented bases with respect to 2'-deoxyribose; the other conformers include anti-oriented bases. Energetic analysis of these conformers shows that conformational equilibrium of isolated d6AC at T = 298.15 K is shifted to syn conformation with a syn/anti ratio estimated as 61.4%:38.6%. As far as the sugar conformation is concerned, 40 conformers contain north (N) (with 0.3 degreesor = Por = 40.1 degrees), and the rest possess south (S) (with 157.1 degreesor = Por = 207.0 degrees) puckers, where P is the pseudorotational angle of the furanose ring. The S/N occupancy ratio is estimated as 80.2%:19.8% (T = 298.15 K). The two most stable conformers are energetically quasidegenerate and correspond to both C2'-endo/syn conformers differing only by orientation of the O3'H hydroxyl group. They are both stabilized by means of similar intramolecular H-bonds, i.e., O5'H...O2, C2'H2...O2, and C2'H2...O5'. As examined by AIM criteria, from 1 to 3 H-bonds per conformer were identified among 13 possible interactions: O5'H...O2, O5'H...N6, O3'H...O5', O5'H...O3', C1'H...O2, C2'H2...O2, C2'H2...O5', C3'H...O2, C3'H...N6, C5'H1...O2, C5'H2...O2, C5'H1...N6, and C5'H2...N6. The biological effect of d6AC is conceived as an inhibition of replicative DNA polymerase caused by an unusual orientation of the sugar residue against the base in the only A form DNA-like conformer.

Unzipping of double-stranded nucleic acids by an electric field applied across a wild-type α-hemolysin (αHL) nanopore provides structural information about different duplex forms. In this work, comparative studies on A-form DNA-RNA duplexes and B-form DNA-DNA duplexes with a single-stranded tail identified significant differences in the blockage current and the unzipping duration between the two helical forms. We observed that the B-form duplex blocks the channel 1.9 ± 0.2 pA more and unzips ∼15-fold more slowly than an A-form duplex at 120 mV. We developed a model to describe the dependence of duplex unzipping on structure. We demonstrate that the wider A-form duplex (d = 2.4 nm) is unable to enter the vestibule opening of αHL on the cis side, leading to unzipping outside of the nanopore with higher residual current and faster unzipping times. In contrast, the smaller B-form duplexes (d = 2.0 nm) enter the vestibule of αHL, resulting in decreased current blockages and slower unzipping. We investigated the effects of varying the length of the single-stranded overhang, and studied A-form DNA-PNA duplexes to provide additional support for the proposed model. This study identifies key differences between A- and B-form duplex unzipping that will be important in the design of future probe-based methods for detecting DNA or RNA.

Protein-DNA interactions induce conformational changes in DNA such as B- to A-form transitions at a local level. Such transitions are associated with a junction free energy cost at the boundary of two different conformations in a DNA molecule. In this study, we performed umbrella sampling simulations to find the free energy values of the B-A transition at the dinucleotide and trinucleotide level of DNA. Using a combination of dinucleotide and trinucleotide free energy costs obtained from simulations, we calculated the B/A junction free energy. Our study shows that the B/A junction free energy is 0.52 kcal mol(-1) for the A-philic GG step and 1.59 kcal mol(-1) for the B-philic AA step. This observation is in agreement with experimentally derived values. After excluding junction effects, we obtained an absolute free energy cost for the B- to A-form conversion for all the dinucleotide steps. These absolute free energies may be used for predicting the propensity of structural transitions in DNA.

We investigate the use of algebraic state-space models for the sequence dependent properties of DNA. By considering the DNA sequence as an input signal, rather than using an all atom physical model, computational efficiency is achieved. A challenge in deriving this type of model is obtaining its structure and estimating its parameters. Here we present two candidate model structures for the sequence dependent structural property Slide and a method of encoding the models so that a recursive least squares algorithm can be applied for parameter estimation. These models are based on the assumption that the value of Slide at a base-step is determined by the surrounding tetranucleotide sequence. The first model takes the four bases individually as inputs and has a median root mean square deviation of 0.90 A. The second model takes the four bases pairwise and has a median root mean square deviation of 0.88 A. These values indicate that the accuracy of these models is within the useful range for structure prediction. Performance is comparable to published predictions of a more physically derived model, at significantly less computational cost.

The dynamics of the B-A transition of DNA double helices with different GC contents and various chain lengths has been characterized by an electric field pulse technique. The field-induced B-A reaction is separated from orientation effects using the magic angle technique. Amplitudes reflecting the B-A reaction are observed selectively in the limited range of ethanol contents, where CD spectra demonstrate the B-A transition. The maximum amplitude appears at 1-2% higher ethanol content than the center of the B-A transition observed by CD because electric field pulses induce a relatively large perturbation from the A- toward the B-form. The relaxation curves measured after pulse termination reflect a spectrum of up to three relaxation processes. For DNA's with approximately 50% GC, the main part of the amplitude ( approximately 75%) is associated with time constants of approximately 2 micros, and another major component appears with time constants of 50-100 micros. These relaxation effects have been observed for DNA samples with 859, 2629, 7160, and 48501 bp. The time constant associated with the main amplitude increases with decreasing GC content from approximately 2 micros at 50% GC to approximately 3 mus at 41% GC and approximately 10 micros at 0% GC at the center of the B-A transition. Model calculations on the kinetics of cooperative linear Ising lattices predict the appearance of a distinct maximum of the mean relaxation time at the center of the transition. The absence of such maximum in our experimental data indicates a low cooperativity of the B-A transition with a nucleation parameter of approximately 0.1. The rate of the B-A transition is lower by approximately 3 orders of magnitude than that predicted by molecular dynamics simulations.

The interconversion between the well-characterized A- and B-forms of DNA is a structural transition for which the intermediate states and the free energy difference between the two endpoints are not known precisely. In the present study, the difference between the Root Mean Square Distance (RMSD) from canonical A-form and B-form DNA is used as an order parameter to characterize this free energy difference using umbrella sampling molecular dynamics (MD) simulations with explicit solvent. The constraint imposed along this order parameter allows relatively unrestricted evolution of the intermediate structures away from both canonical A- and B-forms. The free energy difference between the A- and B-forms for the hexamer DNA sequence CTCGAG in aqueous solution is conservatively estimated to be at least 2.8 kcal/mol. A continuum of intermediate structures with no well-defined local minima links the two forms. The absence of any major barriers in the free energy surface is consistent with spontaneous conversion of the A-form DNA to B-form DNA in unconstrained simulations. The extensive sampling in the MD simulations (>0.1 mus) also allowed quantitative energetic characterization of local backbone conformational variables such as sugar pseudorotation angles and BI/BII state equilibria and their dependence on base identity. The absolute minimum in the calculated free energy profile corresponds closely to the crystal structure of the hexamer sequence, indicating that the present method has the potential to identify the most stable state for an arbitrary DNA sequence in water.

Despite the existence of numerous models to account for the B-Z DNA transition, experimenters have not yet arrived at a conclusive answer to the structural and dynamical features of the B-Z transition. By applying the stochastic difference equation to simulate the B-Z DNA transition, we have shown that the stretched intermediate model of the B-Z transition is more probable than other B-Z transition models such as the Harvey model. This is accomplished by comparing potential energy profiles of various B-Z DNA transition models and calculating relative probabilities based on the stochastic difference equation with respect to length (SDEL) formalism. The results garnered in this article allow for new approaches in determining the structural transition of B-DNA to Z-DNA experimentally. We have also simulated the B-A DNA transition using the stochastic difference equation. Unlike the B-Z DNA transition, the mechanism for the B-A DNA transition is well established. The variation in the pseudorotation angle during the transition is in good agreement with experimental results. Qualitative features of the simulated B-A transition also agree well with experimental data. The SDEL approach is thus a suitable numerical technique to compute long-time molecular dynamics trajectory for DNA molecules.

The crystal structure of the tetradecanucleotide d(CCCCGGTACCGGGG)2has previously been reported as an A-type double helix at a resolution of 2.5 Å in space groupP41. Here, the structure of this sequence was determined at a significantly higher resolution of 1.65 Å in space groupP41212. The differences in crystal packing between the former and latter are described. The crystallographic asymmetric unit consists of one tetradecanucleotide duplex that spans more than one full turn of the A-helix. This structure allowed the unambiguous identification of solvent interactions.

Background Transcriptional regulation is normally based on the recognition by a transcription factor of a defined base sequence in a process of direct read-out. However, the nucleic acid secondary and tertiary structure can also act as a recognition site for the transcription factor in a process known as indirect read-out, although this is much less understood. We have previously identified such a transcriptional control mechanism in early Xenopus development where the interaction of the transcription factor ilf3 and the gata2 promoter requires the presence of both an unusual A-form DNA structure and a CCAAT sequence. Rapid identification of such promoters elsewhere in the Xenopus and other genomes would provide insight into a less studied area of gene regulation, although currently there are few tools to analyse genomes in such ways. Results In this paper we report the implementation of a novel bioinformatics approach that has identified 86 such putative promoters in the Xenopus genome. We have shown that five of these sites are A-form in solution, bind to transcription factors and fully validated one of these newly identified promoters as interacting with the ilf3 containing complex CBTF. This interaction regulates the transcription of a previously uncharacterised downstream gene that is active in early development. Conclusions A Perl program (APTE) has located a number of potential A-form DNA promotor elements in the Xenopus genome, five of these putative targets have been experimentally validated as A-form and as targets for specific DNA binding proteins; one has also been shown to interact with the A-form binding transcription factor ilf3. APTE is available from http://www.port.ac.uk/research/cmd/software/ under the terms of the GNU General Public License.

PKZ, protein kinase containing Z-DNA domains, is a novel member of the vertebrate eIF2α kinase family. Containing a catalytic domain in C-terminus and two Z-DNA binding domains (Zα1 and Zα2) in N-terminus, PKZ can be activated through the binding of Zα to Z-DNA. However, the regulatory function of PKZ Zα remains to be established. Here, to understand the impact of PKZ Zα on DNA conformational transition, wild-type Zα1Zα2 and 11 mutant proteins were expressed and purified. At the same time, several different lengths of DNA hairpins-d(GC)nT4(GC)n (n = 2-6) and an RNA hairpin-r(GC)6T4(GC)6 were synthesized. The effects of Zα1Zα2 and mutant proteins on the conformation of these synthetic DNA or RNA hairpins were investigated by using circular dichroism spectrum and gel mobility shift assays. The results showed that DNA hairpins retained a conventional B-DNA conformation in the absence of Zα1Zα2, while some of the DNA hairpins (n≥3) were converted to Z-conformation under Zα1Zα2 induction. The tendency was proportionally associated with the increasing amount of GC repeat. In comparison with Zα1Zα2, Zα1Zα1 rather than Zα2Zα2 displayed a higher ability in converting d(GC)6T4(GC)6 from B- to Z-DNA. These results demonstrated that Zα1 sub-domain played a more essential role in the process of B-Z conformational transition than Zα2 sub-domain did. Mutant proteins (K34A, N38A, R39A, Y42A, P57A, P58A, and W60A) could not convert d(GC)6T4(GC)6 into Z-DNA, whereas S35A or K56A retained some partial activities. Interestingly, Zα1Zα2 was also able to induce r(GC)6T4(GC)6 RNA from A-conformation to Z-conformation under appropriate conditions.

International audience; Transient or long-term DNA self-assembly participates in essential genetic functions. The present review focuses on tight DNA-DNA interactions that have recently been found to play important roles in both controlling DNA higher-order structures and their topology. Due to their chirality, double helices are tightly packed into stable right-handed crossovers. Simple packing rules that are imposed by DNA geometry and sequence dictate the overall architecture of higher order DNA structures. Close DNA-DNA interactions also provide the missing link between local interactions and DNA topology, thus explaining how type II DNA topoisomerases may sense locally the global topology. Finally this paper proposes that through its influence on DNA self-assembled structures, DNA chirality played a critical role during the early steps of evolution.

A-tracts in DNA are generally associated with reduced nucleosome occupancy relative to other sequences, such that the longer the A-tract, the less likely that nucleosomes are found. In this paper, we use molecular dynamics methods to study the structural properties of A-tracts, and in particular the role that the spine of hydration in A-tracts plays in allowing DNA to distort to the highly bent structure needed to form nucleosomes. This study includes a careful assessment of the ability of the Amber (parmbsc0), CHARMM27, and BMS force fields to describe these structural waters for the AAATTT sequence (here capped with CGC and GCG), including comparisons with X-ray results. All three force fields show a spine of hydration, but BMS and Amber show better correlation with measured properties, such as in narrowing of the minor groove width associated with the A-tract. We have used Amber to study the spine properties for several 6 and 14 base-pair A-tracts (all capped with CGC and GCG). These calculations show that the structural waters are tightly bound for "pure" A-tracts that allow for A-water-T links, and for AT steps that allow for a T-water-T link, but other sequences disfavor structural water, especially those that lead to A-water-A, G-water-G, and C-water-A structures. In addition, we show that pure A-tracts favor roll values close to the Watson-Crick value for linear DNA, while A-tract sequences containing embedded T's, C's, or G's that are less favorable to structural water are more flexible. This implies the essential role of the spine of hydration in disfavoring nucleosome formation.

Processive chromosomal replication relies on sliding DNA clamps, which are loaded onto DNA by pentameric clamp loader complexes belonging to the AAA+ family of adenosine triphosphatases (ATPases). We present structures for the ATP-bound state of the clamp loader complex from bacteriophage T4, bound to an open clamp and primer-template DNA. The clamp loader traps a spiral conformation of the open clamp so that both the loader and the clamp match the helical symmetry of DNA. One structure reveals that ATP has been hydrolyzed in one subunit and suggests that clamp closure and ejection of the loader involves disruption of the ATP-dependent match in symmetry. The structures explain how synergy among the loader, the clamp, and DNA can trigger ATP hydrolysis and release of the closed clamp on DNA.