Search

This research aims to assess cooperators involvement and satisfaction with housing activities in Plateau State, Nigeria, to measure their degree of influence on housing activities. The study was based on various questionnaire survey methods conducted on institution-based cooperative societies engaged in suitable housing activities. The data was collected from Jos University Teaching Hospital JUTH multipurpose cooperative society cooperators and analysed using mean ranking descriptive statistical tools. Multiple regression was conducted. Regression model summary and the ANOVA result were obtained. The model produced an overall R-value of 0.421 and an R2-value of 0.177 with F-statistics of 32.685, which are significant as indicated by a p-value of 0.000. The two independent variables included in the study explain about 17.7 % of the variation in housing activities. This shows that both involvement and satisfaction of cooperators influenced housing activities. The study recommended that cooperators be more involved in all housing activities from the initial stage to the completion for a more positive outcome and ensure their utmost satisfaction based on their housing demand. This will motivate them and increase patronage of the cooperative society for their housing needs at all times.

This research aims to assess Landholder's satisfaction with the compulsory acquisition and compensation process in Bauchi to identify areas of weakness in the process and propose areas of improvement. The study adopted the quantitative approach and data collected through questionnaire survey from 327 landholders affected by the compulsory acquisition and compensation exercise by the Bauchi State Government. The data collected were subjected to descriptive with mean ranking, frequency distribution. The study revealed that landholders were very satisfied before the process of compulsory acquisition, during the process of mandatory purchase, they were also happy. Still, during the compensation process, they were very dissatisfied. It recommended that the Government should make the process of compensation more transparent.

This study aims to assess the Public infrastructure provision in Bauchi Metropolis, Nigeria, to propose areas of improvement. The study adopted the use of a quantitative approach and data were collected through a questionnaire survey from 382 house head holds proportionate selected from the target population in Bauchi metropolis. The data collected were subjected to descriptive with mean ranking, frequency distribution. The study revealed that communication facilities were the most provided facility provision, followed by market facilities and water facilities provision. Solid waste disposal facilities and fire protection services were the least facilities provided in the study area. It recommended that public infrastructural facilities provided in the area should be based on the resident’s preference and need.

This study aims to assess landholder’s awareness of compulsory acquisition of land on their satisfaction with the compensation process in Bauchi, Nigeria, to identify areas of weakness in the process and propose areas of improvement. The study adopted the use of a quantitative approach and data were collected through a questionnaire survey from 327 landholders affected by the compulsory acquisition and compensation exercise by the Bauchi State Government. The data collected were subjected to descriptive with mean ranking, frequency distribution. The study revealed that the respondents are aware of the process before the compulsory acquisition and during the process of compulsory acquisition they were also aware of. This means that the respondents agreed that they were aware of the process/procedures involved in compulsory land acquisition, laws, and procedures guiding compulsory land acquisition and compensation process. It recommended that Landholders should be made more aware of the process involved in compulsory acquisition and compensation not only at inception but up to the end of the exercise.

This study aims to assess landholder’s involvement in the compulsory acquisition of land on their satisfaction with the compensation process in Bauchi, Nigeria, to identify areas of weakness in the process and propose areas of improvement. The study adopted the use of a quantitative approach and data were collected through a questionnaire survey from 327 landholders affected by the compulsory acquisition and compensation exercise by the Bauchi State Government. The data collected were subjected to descriptive with mean ranking, frequency distribution. The study revealed that before the process of compulsory acquisition landholders were very well involved, during the process of compulsory acquisition they were also involved but at the compensation process, they were not involved at all. It recommended that Landholders should be involved not only in the process of compulsory acquisition but they should be involved in the process of compensation as it will minimize resistance to compulsory.

Malaria is a life-threatening parasitic disease which causes enormous morbidity and mortality in tropical African countries. Successful prevention and treatment of infected individuals heavenly depend on successful diagnosis using recommended techniques. These routine laboratory techniques have different performance indices. Therefore, this study aimed to evaluate the performance of Polymerase Chain Reaction and Microscopy in malaria diagnosis. A total of two hundred consented study subjects were randomly selected and enrolled for the research. Vein puncture technique was use to collect venus blood from the subjects and analysed using microscopy and Polymerase chain Reaction. DNA samples were extracted using Quick-DNA™ Miniprep Plus Kit with catalogue No. D4069. 18SrRNA gene of Plasmodium falciparum from chromosome 13 was amplified using the primers F5’AACAGACGGGTAGTCATGATTGAG3’ R5’GTATCTGATCGTCTTCACTCCC3’. Malaria prevalence of 167(83.50%) and 105(52.5%) were recorded using microscopy and Polymerase Chain Reaction. Microscopy had a sensitivity, specificity, Positive predictive value and negative predictive value of 84.91, 23.40, 55.53 and 57.89%, respectively, with an overall accuracy value of 0.81. Polymerase Chain Reaction had a sensitivity value of 53.89%, specificity of 54.54%, positive predictive value of 85.79% and Negative predictive value of 18.94% with an overall accuracy of 0.54. Microscopy and Polymerase Chain Reaction demonstrated significant accuracy and relatively good performance indices. Therefore Microscopy and Polymerase Chain Reaction are highly recommended as malaria diagnostic techniques, and further research should be carried out to determine the influence of some biological factors of both the parasite and the host on the outcome of the diagnosis using both Polymerase Chain Reaction and microscopy.