Search

Background. The problem of agricultural waste disposal is currently very relevant. In the Russian Federation, the agro-industrial complex annually produces hundreds of millions of tons of waste that must be disposed of and used rationally. Organic waste from agricultural production and farm animal manure can be effectively disposed of using directed microbiological fermentation and larvae of the insect Hermetia illucens (black soldier fly). As a result of the activity of the enzyme system of black lion larvae and specific microflora, agricultural waste turns into zoohumus with a high content of nitrogen, phosphorus, potassium and trace elements, which can be used as an organic fertilizer that improves the quality of the soil, and the biomass of larvae for animal feed and for obtaining protein concentrate and fat. Purpose. To determine the optimal temperature conditions for the cultivation of the insect species Hermetia illucens (black soldier fly) on various types of substrates, to study the effect of the substrate composition on the production of larval biomass, protein concentrate and fat. Materials and Methods. The research work was carried out in the microbiological laboratory of the Center for Technological Excellence “Advanced Chemical and Biotechnology”, laboratories of the Department of Biology and Technologies of Living Systems, Faculty of Natural Sciences of the Tula State Pedagogical University named after L. N. Tolstoy and insectaria LLC “Lvinka”. To study the effect of the feed composition on the growth and development of the larvae of the insect species Hermetia illucens, substrates from various agricultural, food and animal waste were used. To determine the influence of temperature and humidity on the development of larvae, thermostats and insectarium rooms were used. Results. The study of the effect of various solid organic waste on the biomass of live and dried larvae showed that the larvae of the insect H. illucens grew and developed better on food waste consisting of meat and fish waste, as well as plant food waste. Larvae developed worse on plant residues. This is due to the fact that these wastes contain a large amount of cellulose and much less nutrients in their composition, therefore, on a substrate of this composition, the larvae gained biomass worse. The optimal temperature for the cultivation of insect larvae of the species H. illucens is t-22°C. The ratio of protein and fat in the larvae of the insect H. illucens depends on the composition of the feed. In those types of feed where protein predominates, the content of this component in the larvae is high. For example, when using food meat waste, the content of protein concentrate reaches 595 g/kg, fat only 323 g/ kg, and when using vegetable waste containing a large amount of carbohydrates, more fat and less protein are produced. Concisions. As a result of the research work carried out, it was possible to study the influence of environmental factors on the growth and development of the insect species H. illucens (black soldier fly), and to select favorable conditions for the development of larval biomass. Optimal substrates were selected for the cultivation of larvae of the insect species H. illucens. The most suitable substrates for the production of protein concentrate and fat were also determined.

Innovation in production use of insects allows us to speak about entomo-industry, which could cause in the future a drop in the relative cost of food. On the basis of biotechnology by using the fly Hermetia illucens the article draws theoretical and applied economic conclusions. Larvae of this fly by eating organic wastes during a few days can grow in hundred times and become a feed for animals, a basis for medicine or even a nutritious supplement, while their waste can become a fertilizer (zoo-humus). From means of labour they turn into the subject of labour with selfreproduction and solution to ecological problem, which can create the added value. In traditional livestock breeding fast transformation does not take place and animal acts mainly as the subject or means of labour. Commercialization of the technology can be achieved through development of module equipment for each of 9 processes and this can make it possible to purchase it stage by stage, depending on the need and resources. Due to this fact competitive advantage for technological entrepreneurship can be provided that can take one of the following three types: in the narrow sense (developing and selling equipment), in the broad sense (manufacturing the product with own equipment) and mixed one (manufacturing and selling of the equipment and finished product, joint work of the developer and user of the equipment). The author designed a synthetic graphic business-model of entomo-technological entrepreneurship. Logical schemes of waste treatment were put forward: centralized and decentralized. It was found out that for agricultural waste the decentralized scheme is more appropriate, as it implies treatment at the place of shaping and economizing on transportation. In Russia the process of commercialization of biotechnologies with the use of Hermetia illucens started in 2015, which is proven by patent activity. However, the market develops rather slowly.

A by-product of protein production from the larvae of the black soldier fly ( Hermetia illucens ) is a zoocompost consisting of a variety of organic compounds. The purpose of the work was to determine the hazard class of the zoo complex - the waste of cultivation of Hermetia illucens larvae using biotesting methods, since the use of calculated methods to determine the hazard class is difficult. Biotesting experiments were carried out on test organisms: planktonic crustacean Daphnia magna , algae Chlorella vulgaris , seeds of Avena sativa , Triticum vulgare and Hordeum sativum . It has been established that the zoocompost refers to low-risk waste. Extractions of the zoocompost stimulate the growth of plants Avena sativa and Hordeum sativum , it is supposed to be used as a phytostimulator. It has been shown that an environmentally friendly wasteless method for the production of protein additive from insects is possible.

The problem of food safety being an important component of the country's food security, provides not only for continuous improvement of the methodology of hygienic standardization, but also for the formation of requirements for novel food, in particular, those obtained from non-traditional sources. The accumulated practical and theoretical competence in the food hygiene area, as well as knowledge of current trends of the food base broadening, allow us to analyze the risks associated with novel food obtained of insects. The purpose of the research was to analyze the microbiological and parasitological risk of novel food sources obtained with the use of insects, suggest the effective risk management measures. Material and methods . The analytical part of the work included literature search, collection of information and statistical materials published in domestic and foreign scientific editions. The search was carried out using the Google Academy retrieval system and electronic databases (PubMed, MEDLINE, EMBASE, Scopus, Web of Science, eLIBRARY), mainly in the last 25 years, using the keywords: Hermetia illucens, Tenebrio molitor, Acheta domesticus, insects, parasite, nematode, pathogen, cysts. Results . Based on the published materials' analysis, a systematization of microbiological and parasitological factors potentially capable of colonizing edible insects has been carried out. There were identified representatives of 24 groups of pathogenic and 18 opportunistic microorganisms and helminths related to microbial and parasitic pathogens, the spread of which is significantly influenced by inappropriate conditions of feeding and keeping insects. As there are currently no veterinary requirements for insect breeding and farming conditions, contamination of end products with infectious and parasitic pathogens can vary over a very wide range. Conclusion . The use of native insect biomass carries certain risks associated with its microbial and parasitic contamination, and the development of measures to prevent them requires significant resources. The possibility of deep processing of such raw materials can be considered as one of the solutions to mitigate these risks. For use in the food industry, insects should be subjected to processing similar to that currently used for soybean seeds, which includes separation of protein (entomoprotein), fat and chitin fractions, each of which would have an independent use. Thus, at present, insects should be considered as a source of novel food ingredients, first of all, complete protein of animal origin., Competing Interests: The authors declare no conflict of interest., (Copyright© GEOTAR-Media Publishing Group.)

Forwarding development of identification methods for novel foods, derived from edible insects, is necessary to ensure control over their marketing within the framework of the current legislation's requirements. The purpose of the research was the development and validation of a monoplex TaqMan-PCR assay protocol (a real-time polymerase chain reaction with TaqMan technology) for the insect Hermetia Illucens' taxon-specific DNA detection and identification in food raw materials and foods. Material and methods . Studies were performed using samples containing the target DNA sequence (dried whole larvae of H. Illucens as well as H. Illucens in oilcake meal and powdered capsule forms) and inherently not containing the target DNA sequence (other insect species, mammals, plants, microorganisms as well as multicomponent food: meat, dairy and plant food). DNA extraction and purification were performed by CTAB methods [commercial kits "Sorb-GMO-B" (Syntol, Russia) and "DNeasy mericon Food Kit" (QIAGEN, Germany)]. For amplification of the target sequence, which was a fragment of the cytochrome c oxidase subunit I mitochondrial gene, we used primers and the probe: Hei-COI-F (CCTGAGCTGGTATAGTGGGAAC); Hei-COI-R (AATTTGGTCATCTCCAATTAAGC); Hei-COI-P (FAM-CGAGCCGAATTAGGTCATCCAGG-BHQ-1). PCR conditions were optimized using CFX96TM Real-Time PCR System (Bio-Rad, USA) and Rotor-Gene Q (QIAGEN, Germany) amplifiers by empirical selection of primer and probe concentrations and amplification of the time/temperature profile. Specificity and limit of detection were evaluated as part of method validation. Results and discussion . The optimized reaction mixture included 2.5-fold of Master Mix B [KCl, TrisCl (pH 8.8), 6.25 mM MgCl2], SynTaq DNA-polymerase, dNTP, glycerol, Tween 20, of each primers - 550 nM, probe - 100 nM. The time/temperature profile of the reaction: 95 °C - 180 s (95 °C - 15 s, 57 °C - 60 s), 40 cycles. The detection limit of the method was 0.19 ng of H. illucens DNA per reaction. The specificity of primer system and probe were experimentally confirmed in studies with DNA of other insects, animals, plants and microorganisms. Conclusion . A protocol of a monoplex TaqMan-PCR assay for the taxon-specific DNA of insect Hermetia Illucens' detection and identification in food raw materials and foods has been developed. Validity of the method has been confirmed by laboratory tests which allows to recommend it for use in surveillance of Hermetia Illucens-derived raw materials., Competing Interests: The authors have no conflict of interest to declare., (Copyright© GEOTAR-Media Publishing Group.)

Recent years a worldwide interest in the use of alternative sources of protein, in particular, protein from insects, has increased. Edible insects for thousands of years have been a part of the human diet in Asian-Pacific region and South America, while in the European Union, the USA and Canada the use of insects for food purposes is a modern trend that is determined by the care of the environment, global warming combating, etc. Thus, the legal rules governing the food use of insects have significant differences among countries. In the Eurasian Economic Union requirements to food are regulated by the Customs Union Technical Regulations. Since none of the Technical Regulations contains the name of such food as "products obtained with the use of insects", these products may be classified as "food products of novel type" which are subjected to state registration. Fundamental and applied research should be conducted as a part of this novel food safety assessment system, that include the determination of nutritional and biological value of food raw materials derived from insects, and toxicological, reprotoxicological, allergological experiments in vivo on several generations of laboratory animals. The aim of the research was studying and comparing the nutritional and biological values of Hermetia illucens larvae dry biomass and basic foodstuffs of animal and plant origin. Material and methods . Nutritional and biological value analysis of H. illucens minced dry larvae biomass, dried at 110-120 °C, was carried out on 83 indicators, which included determination of protein content and amino acid composition, determination of fat level and fatty acid composition, determination of the content of carbohydrates, vitamins, minerals and trace elements, ash and moisture. Results . A study of the nutritional value of dry larvae biomass showed high levels of protein and fat (39 and 38%, respectively), while ash, dietary fiber and carbohydrate accounted for less than 20%. The amino acid profile had a balanced content of essential amino acids and was comparable to the protein of a hen's egg, as well as other animal products. The fatty acid composition of the biomass was characterized by a relatively high content of lauric acid (39.9% of the total fatty acid content), also found in some fruits and seeds of tropical plants; the ratio of other acids was more consistent with the fatty acid profile of fish oil. The dry larvae biomass contained carotenoids (0.23 mg/100 g), tocopherol (3.1 mg/100 g) and thiamine (53 μg/100 g) in amounts significantly lower to those of foods, which traditionally are sources of these vitamins. Based on the analysis of the mineral composition, the H. illucens biomass can be attributed to the sources of calcium, iron, copper and chromium. In terms of the content of the above elements, as well as magnesium and zinc, dry biomass significantly exceed the main food products of animal origin (beef, eggs, fish and seafood), and in terms of the content of potassium and phosphorus, it was comparable to them. Conclusion . The results of dry larvae biomass comparative evaluation with the basic foodstuffs of animal and plant origin evidence to its high nutritional and biological value, allowing to consider H. illucens as a promising source of complete protein, lauric acid, minerals and trace elements., Competing Interests: The authors declare no overt and potential conflict of interest related to the publication of this article., (Copyright© GEOTAR-Media Publishing Group.)

A high protein content in the insect biomass allows to classify this product as a very promising source of protein, comparable in nutritional and biological value with proteins of animal origin. Despite a long history of safe use, in some countries insects are considered a new type of food which safety must be proven before entering the food market. The long-term Russian experience in novel food's research allows to identify the crucial stages, among which, along with toxicological and allergological tests, the protein's biological value determination takes an important place. The conclusion about the biological value of protein is formed on the basis of integrated use of chemical and biological methods, which gist comes down to the study of the nitrogen balance in the growing organism (biological method) and the calculation of the amino acid score (chemical method). The aim of the research was the comprehensive assessment of Black soldier fly (Hermetia illucens) larvae protein's biological value using chemical and biological methods. Material and methods . Biological studies based on measuring of net protein ratio/net protein utilization were performed on 28 growing (between 25-50 days of life) male Wistar rats, with an initial body weight of ~65.5±1.2 g. Rats in the control group (n=14) received a semi-synthetic casein diet with a protein content of ~12% in calories, the test group (n=14) received a diet including an equivalent amount of H. illucens protein. The diet's ingredients were replaced with the consideration of the proteins, fats, and carbohydrates content in the included product following the principle of isocaloricity and isonitrogenicity (by mass fraction of total nitrogen). H. illucens biomass and casein in the test and control groups, respectively, were the main significant sources of nitrogen in the diet. Body weight, feed intake, and fecal and urine nitrogen losses were measured during the experiment. The biological value and digestibility of protein were judged by coefficients of protein efficiency ratio, net protein ratio, true protein digestibility, true protein biological value, true net protein utilization. Chemical studies included studies of the amino acid composition of H. illucens biomass protein and calculation of the digestible indispensable amino acid score (DIAAS). Results . The general condition of animals of the both groups during the whole experiment was satisfactory, the weekly body weight increase corresponded to the level of growth typical for Wistar rats, intergroup differences were not detected. Despite the fact that in a number of indicators the test group animals differed from the control [there were noted a decrease of the net protein ratio (by 5%, p>0.05), true protein digestibility (by 11%, p<0.05), net protein utilization (by 13%, p<0.05), caused by increased excretion of nitrogen with urine (by 8%, p>0.05) and feces (by 186%, p<0.05), with the same amount of nitrogen intake], the test rats' growth rate and the nitrogen's retention degree indicate a relatively high biological value of insect protein. According to the DIAAS, H. illucens protein is characterized by high content of histidine, threonine, valine, isoleucine and leucine (DIAAS=100 and more), and is also a source of sulfur-containing amino acids - methionine and cysteine (DIAAS=86) and lysine (DIAAS=97). Conclusion . The comprehensive studies of Hermetia illucens larvae protein's biological value demonstrated a high protein content, its balanced amino acid composition and high biological value, which allows to consider Hermetia illucens as a potential source of complete dietary protein., Competing Interests: The authors declare no overt and potential conflict of interest related to the publication of this article., (Copyright© GEOTAR-Media Publishing Group.)