Search

portuguesEste trabalho descreveu e comparou quatro estudos entre si que utilizaram metodos automaticos em fluxo com deteccao espectrofotometrica e a reacao de oxidacao do diclofenaco para determinar diclofenaco em formulacoes farmaceuticas e fluidos corporais. Para isso, utilizamos os seguintes artigos: Versatility of a multicommuted flow system in the spectrometric determination of three analytes, Sequential injection spectrophotometric method for the assay of anti-inflammatory diclofenac sodium in pharmaceutical preparations, Screening of conditions controlling spectrophotometric sequential injection analysis e Sequential injection spectrophotometric determination of diclofenac in urine and pharmaceutical formulations e detalhamos as metodologias empregadas, os resultados, conclusoes obtidas e comparamos entre eles os limites de deteccao, desvio padrao relativo e a frequencia analitica. Os resultados mostraram diferencas significativas entre metodos empregados e a utilizacao do Sistema automatico do tipo Analise por Injecao Sequencial, apesar deste possuir menor frequencia analitica. EnglishThis study described and compared four studies that used automatic flow methods with spectrophotometric detection and the oxidation reaction of diclofenac to determine diclofenac in pharmaceutical formulations and body fluids. For this, the following articles were used: Versatility of a multicommuted flow system in the spectrometric determination of three analytes, Sequential injection spectrophotometric method for the assay of anti-inflammatory diclofenac sodium in pharmaceutical preparations, Screening of conditions controlling spectrophotometric sequential injection analysis and Sequential injection spectrophotometric determination of diclofenac in urine and pharmaceutical formulations and we detail the methodologies used, the results, the conclusions obtained and compare the limits of detection, relative standard deviation and analytical frequency. The results showed significant differences between the employed methods and the use of the Automatic System of the Sequential Injection Analysis type, although this one has a lower analytical frequency.

In this work, blue-emitting carbon quantum dots and distinctly sized CdTe semiconductor quantum dots were combined to implement a ratiometric probe for the monitoring of H2O2. By implementing a sensing scheme that combines multiple nanoprobes, excited at the same wavelength and emitting at different ones, which exhibit also dissimilar reactivity, it was possible to minimize detrimental factors associated with the use of a single photoluminescence wavelength such as fluctuations in excitation source or measured signal, fluorophore concentration, matrix effects and background fluorescence. The developed ratiometric probe was applied on the implementation of a conventional fluorometric assay and on a visual assay relying on the red, green and blue (RGB)-based colour changes promoted by increasing H2O2 concentrations. For the fluorometric determination assay, a good linear relationship between the fluorescence intensity ratio (FICD434/FIMPA587) and H2O2 concentration within the range of 0.0100–0.2125% (w/w) was obtained (R = 0.9994, n = 7). The detection limit was about 0.00793% (w/w). The obtained results in the determination of H2O2 in contact lens solutions were in agreement with those provided by the reference procedure, with relative deviations between −4.71 and 1.89%. Regarding the RGB-visual assay, a linear working range for hydrogen peroxide concentrations up to 0.150% (w/w) was verified (n = 9) with a correlation coefficient of 0.9966, which confirms its potential as valuable analytical tool for on-the-spot semi-quantitative detection of H2O2.

AND XYLENE SOLVENTS IN URINE BY HPLC-UV. A method for simultaneous analysis of phenylglyoxylic (PGA), mandelic (MA), hippuric (HA), orto-, meta- and para-methylhippuric (o-, m- and p-MHA) acids in urine, by high performance liquid chromatography with UV detection was developed and validated. The substances are biotransformation products used as biological indicators to assess the exposure of workers, respectively, to ethylbenzene, styrene, toluene and xylene. The urinary metabolites were separated using a C18 column and a mixture of 5 mM phosphate buffer pH 2.6:acetonitrile (92:8, v/v) as mobile phase. Urine samples were extracted with dichloromethane:ethyl acetate (70:30, v/v). The method used phenacetin as internal standard and was linear in the interval of 100-500 µg mL-1 for PGA and MA and 150-700 µg mL-1 for HA and MHA. The detection limits in µg mL-1, were 19.8 for PGA, 1.7 for MA, 4.1 for HA, 3.9 for o-MHA, 3.3 for m-MHA and 7.3 for p-MHA. Intra- and inter-assay precisions (as relative standard deviation) were all less than 15% and accuracy (as relative standard error) did not exceed 12.3%. The recovery was higher than 65% for all metabolites. The developed method will be applied to biological evaluation of workers exposure to these solvents.

Several studies have suggested that differences in the natural rooting ability of plant cuttings could be attributed to differences in endogenous auxin levels. Hence, during rooting experiments, it is important to be able to routinely monitor the evolution of endogenous levels of plant hormones. This work reports the development of a new method for the quantification of free auxins in auxin-treated Olea europaea (L.) explants, using dispersive liquid–liquid microextraction (DLLME) and microwave assisted derivatization (MAD) followed by gas chromatography/mass spectrometry (GC/MS) analysis. Linear ranges of 0.5–500 ng mL−1 and 1–500 μg mL−1 were used for the quantification of indole-3-acetic acid (IAA) and indole-3-butyric acid (IBA), respectively. Determined by serial dilutions, the limits of detection (LOD) and quantification (LOQ) were 0.05 ng mL−1 and 0.25 ng mL−1, respectively for both compounds. When using the calibration curve for determination, the LOQ corresponded to 0.5 ng mL−1 (IAA) and 0.5 μg mL−1 (IBA). The proposed method proved to be substantially faster than other alternatives, and allowed free auxin quantification in real samples of semi-hardwood cuttings and microshoots of two olive cultivars. The concentrations found in the analyzed samples are in the range of 0.131–0.342 μg g−1 (IAA) and 20–264 μg g−1 (IBA).

This work proposes a liquid-phase microextraction (LPME) method to extract the highly polar compounds phenol (Ph), o-cresol (o-Cr), m-cresol (m-Cr), p-cresol (p-Cr), and 2,4-dimethylphenol (2,4-DMP) from aqueous matrices. The first extraction step of the LPME method employed a common volumetric flask and n-octanol, and the second extraction step used NaOH as the acceptor phase. The optimized extraction conditions were 900 μL of n-octanol as the extraction solvent, NaOH at 0.60 mol L(-1) as the acceptor phase, an extraction time of 5.0 min, HCl at 0.01 mol L(-1) and NaCl at 20.0% as the donor phase, and an extraction temperature of 20.0°C. The analysis of 50.0 mL of aqueous sample, pretreated under the optimized LPME conditions, afforded a limit of detection (LOD) between 0.3 and 3.5 μg L(-1), a limit of quantification (LOQ) between 1.2 and 11.6 μg L(-1), and a linear range from 2.50 to 50.0 μg L(-1) for Ph, o-Cr, m-Cr and p-Cr and from 12.5 to 250 μg L(-1) for 2,4-DMP. The proposed LPME method was a successful sample preparation strategy, and allowed for precise and accurate quantification of polar phenolic compounds in aqueous matrices such as tap water, river water, groundwater, and seawater, and also in a soil extract. The recovery values ranged from 72.5% to 126.0%, and the relative standard deviation was between 0.3 and 11.5%.

The groundwater contamination by petroleum products such as gasoline is one of the main impacts of retail comercial activity of retail automotive fuels. And one of the ways to detect such impact is to characterize the quality of groundwater near these sites for the presence of monoaromatic hydrocarbons such as benzene, toluene, ethylbenzene and xylene isomers (BTEX). In this sense, we sought to characterize the quality of groundwater for the presence of BTEX in the north of the city of Fortaleza - CE, study area of this research. For this, it deployed the analytical methodology for the detection of BTEX by gas chromatography coupled to PID detectors (photoionization) and FID (flame ionization), preceded by the technique of pre-concentration of static headspace sample. The method was validated by assessing the selectivity parameters, linearity, precision (re-peatability), accuracy (recovery), limit of detection (LOD) and limit of quantification (LOQ). Sampling of groundwater was carried out by low-flow method, according to ABNT NBR 15847/2010, with the aid of an automated sampling system - Low-Flow Sampling on 11 monitoring wells. The analytical method was very selective, repetitive linear, showed good recovery (70 to 110%) and low detection limits (from 0.01 to 0.08 g / L) and quantitation limit (0.04 to 0, 32 g / L). BTEX compounds were detected in all monitored wells, althoughcon-centrations measured were very low values of the maximum established by CONAMA 396/2008, which is 5 μg.L-1, 170 μg.L-1, 200 μg.L-1 and 300μg.L-1 for benzene, toluene, ethylbenzene and xylenes, respectively. A contaminação das águas subterrâneas por derivados do petróleo, como a gasolina é um dos principais impactos causados pela atividade comercial varejista de revenda de combustíveis automotivos. Uma das formas de se detectar esse tipo de impacto é realizar a caracterização da qualidade das águas subterrâneas próximas a esses locais quanto à presença de hidrocarbonetos monoaromáticos, como benzeno, tolueno, etilbenzeno e os isômeros do xileno (BTEX). Nesse sentido, buscou-se caracterizar a qualidade da água subterrânea quanto à presença de BTEX na região norte do município de Fortaleza - CE, área de estudo desta pesquisa. Para isso, foi implantada a metodologia analítica de detecção dos BTEX por cromatografia gasosa, acoplada aos detectores PID (fotoionização) e FID (ionização em chama), antecedida da técnica de pré-concentração da amostra heads-pace estático. O método foi validado através da avaliação dos parâmetros seletividade, linearidade, precisão (repetibilidade), exatidão (recuperação), limite de detecção (LD) e limite de quantificação (LQ). A amostragem da água subterrânea foi realizada pelo método de baixa-vazão, conforme a norma ABNT NBR 15847/2010, com o auxílio de um sistema de amostragem automatizado - Low-Flow Sampling, em 11 poços de monitoramento. O método analítico mostrou-se bastante seletivo, repetitivo, linear, apresentou boa recuperação (70 a 110%) e bai-xos limites de detecção (0,01 a 0,08 μg/L) e limite de quantificação (0,04 a 0,32 μg/L). Os compostos BTEX foram detectados em todos os poços monitorados, entretanto as concentrações medidas ficaram muito a baixo dos valores máximos estabelecidos pela Resolução CONAMA 396/2008, que é de 5 μg.L-1, 170 μg.L-1, 200 μg.L-1 e 300μg.L-1, para o benzeno, tolueno, etilbenzeno e xilenos, respectivamente.

An enzymatic spectrophotometric method for the determination of methyldopa in a dissolution test of tablets was developed using peroxidase from radish (Raphanus sativus). The enzyme was extracted from radish roots using a phosphate buffer of pH 6.5 and partially purified through centrifugation. The supernatant was used as a source of peroxidase. The methyldopachrome resulting from the oxidation of methyldopa catalyzed by peroxidase was monitored at 480 nm. The enzymatic activity was stable for a period of at least 25 days when the extract was stored at 4 or -20 oC. The method was validated according to RDC 899 and ICH guidelines. The calibration graph was linear in the range 200-800 µg mL-1, with a correlation coefficient of 0.9992. The limits of detection and quantification in the dissolution medium were 36 and 120 µg mL-1, respectively. Recovery was greater than 98.9%. This method can be applied for the determination of methyldopa in dissolution tests of tablets without interference from the excipients.

This work describes the development of a biosensor based on the tyrosinase enzyme (Tyr) for the determination of phenol (PHEN) in laboratory effluent samples derived from ammoniacal nitrogen analysis of the water samples from the Muquém dam in the city of Cariús, CE, using square-wave voltammetry (SWV). The electrode modification consisted of the immobilization of gold nanoparticles, multi-walled carbon nanotubes, cobalt phthalocyanine, and Tyr on a glassy carbon electrode. The electrolyte, pH, enzyme quantity, and voltammetric parameters were optimized to detect PHEN. The analytical curves presented a linear range from 4.97 × 10-6 mol L-1 to 6.10 × 10-5 mol L-1, and the detection limit (DL) and quantitation limit (QL) values were 4.81 × 10-6 mol L-1 and 4.97 × 10-6mol L-1, respectively. The repetition of measurements with the same biosensor and repetition for three other prepared biosensors exhibited a relative standard deviation (RSD) of 5.50 and 1.75%, respectively. The percentage recovery of PHEN in effluent samples varied from 86.40 to 105.04%. The stability of the biosensor was evaluated (at 21 days) with satisfactory results, showing 97.86% of the initial response. Moreover, the DL and recovery percentages agreed with the established values from CONAMA and ABNT, respectively. Thus, the electrode configuration developed seems a promising tool in the detection and quantification of PHEN in complex samples.

Nos últimos anos o consumo de achocolatados tem aumentado, principalmente pelo público infantil. Dessa maneira o controle de qualidade do produto em relação a sua composição, principalmente quanto à concentração dos minerais, torna-se importante para facilitar a escolha do produto pelo consumidor. Um método simples e rápido para a determinação de Fe, K e Na em amostras de achocolatado utilizando extração assistida por ultrassom foi proposto. As análises foram realizadas por fotometria de chama e espectrometria de absorção atômica com atomização em chama (FAAS). O método proposto mostrou-se simples, rápido e preciso, apresentando limites de detecção (LOD) para o método de 10 mg.100g-1 para K e Na e 0,2 mg.100g-1 para Fe, e valores de RSD menores que 13%. Foram analisadas 10 amostras de achocolatado em pó de diferentes marcas e as concentrações obtidas comparadas aos valores estabelecidos pela Tabela Brasileira de Composição de Alimentos (TACO) e aos valores informados nos rótulos dos produtos. Os resultados obtidos, para a maioria das amostras, não estavam de acordo com os valores estabelecidos na tabela TACO e com os valores informados nos rótulos. In recent years the consumption of chocolate powder has been increasing, mainly by kids, and for this reason quality control of the product in relation to its composition, especially regarding the mineral concentrations, is important to facilitate the choice of product by the consumers. A simple and quick method for the determination of Fe, K and Na in chocolate powder samples using ultrasound assisted extraction was proposed. The measurements were carried out using photometric detection and atomic absorption spectrophotometry with flame atomization (FAAS). The method was shown to be simple and accurate, with detection limits (LOD) of 10 mg.100g-1 for K and Na and 0,2 mg.100g-1 for Fe, and RSD values below 13%. To check the efficiency of the method, the results were compared with acid digestion. Ten chocolate powder samples of different brands were analyzed, and the concentrations obtained compared with those found in the Brazilian Table of Food Composition (TACO) and also with the values informed on the product labels. For the majority of samples the results obtained were not in accordance with the values established by the TACO tables or with those printed on the labels.

BY HIGH PERFORMANCE LIQUID CHROMATOGRAPHY. Validation of a rapid method for the determination of ascorbic, citric, fumaric and tartaric acids in stored pulp fruit and its application as a quality parameter was performed. The validation parameters showed that for the four evaluated acids, the method presented low limits of detection (LOD) and quantification (LOQ), indicating good precision and accuracy, thus representing an important tool for quality assessment of stored fruit pulp. The results showed that the concentration of organic acids generally decreased with longer storage time in the fruit pulp under study. Amongst all the organic acids under investigation, ascorbic proved the least stable.

This paper describes the evaluation of a new method of sample preparation using a cold finger system with continuous water flow for rice analysis by flame atomic absorption spectrometry. The limits of detection for Cu, Fe, Mn and Zn for the proposed method were 0.36, 1.84, 2.12 and 0.16 mg kg-1, respectively. The RSDs were lower than 6.0% for all elements and the CRM analyzed showed values with 95% agreement. The proposed method is simple and safe for the proposed objective and does not require the use of mixtures of acid or special equipment for sample preparation.

Neste trabalho foram imobilizados nanotubos de carbono de parede simples sobre um eletrodo de ouro policristalino gerando uma camada de nanotubos alinhados verticalmente na superfície do eletrodo. Para isto, foi utilizado um fragmento de DNA (ssDNA tiol-terminado (5-HS-TGG-GGT-TTA-TGG-AAA-TTGGAA-3)) que foi posicionado ao redor do nanotubo de carbono com o procedimento seguinte: 1,0 mg SWCNT funcionalizado foi misturado com 1,0 mL de uma solução de ssDNA de 1,0 µmol L-1, e o ssDNA foi preparado em 0,1 molL-1 de PBS contendo cloreto de sódio a 10% (v / v). Em seguida, a mistura foi sonicada usando uma sonda de ultra-som por 45 min e depois centrifugada a 10000 rpm por 30 min. Finalmente, um eletrodo de Au previamente limpo foi imerso na solução de sobrenadante e monocamadas auto-organizadas (SAM), que consistem de ssDNA/SWCNT foram formadas durante 24 h numa sala refrigerada a 4 °C. As características morfológicas dos eletrodos foram determinadas por microscopia de força atômica, observando-se o alinhamento vertical, que alterou a rugosidade do eletrodo de 1,95 nm para 47,5 nm, com a altura média dos SWCNTs de 260,3 nm, com um desvio padrão relativo de 19,9%. O comportamento eletroquímico do eletrodo de ouro modificado com o hibrido ssDNA/SWCNT foi caracterizado utilizando voltametria cíclica em meio de Na2SO4 0,1 mol L-1 contendo K3Fe(CN)6 5,0 mmol L-1, com velocidade de varredura de potencial de 50 mVs-1. Observou-se que a reversibilidade do par redox Fe(CN)63-/Fe(CN)64- é maior para o eletrodo modificado com ssDNA/SWCNT (ΔEpico= 80 mV) quando comparado ao eletrodo de Au (ΔEpico = 115 mV). A modificação proporcionou uma resposta mais eletrocatalítica com um deslocamento de 43 mV para valores menos positivos do potencial de oxidação do Fe(CN)63-. A oxidação no eletrodo de Au/ssDNA/SWCNTs ocorre em +417 mV e no eletrodo de Au em +460 mV. Este aumento de reversibilidade foi quantificado por espectroscopia eletroquímica de impedância faradaica, onde se encontrou os valores de constantes de velocidade de 7.56 × 10-5 cm s-1 para o eletrodo modificado e apenas 3,36 × 10-5 cm s-1 para o de ouro puro. O efeito da modificação da superfície Au com o nanohíbrido ssDNA / SWCNT na oxidação do bisfenol-A (BPA) foi avaliado em Na2SO4 0,1 mol L-1, pH 6,0, contendo 100 µmol L-1 de BPA por voltametria cíclica a 50 mV s-1. Observou-se um processo de oxidação com um pico voltamétrico anódico num valor de potencial de 510 mV. Este processo de oxidação está relacionado com a eletro-oxidação de BPA para íons fenoxeno. O processo ocorreu em um potencial menos positivo do que o valor observado para o eletrodo de Au não modificado, ou seja 720 mV. Além disso, o processo oxidativo referente à superfície modificada mostrou-se mais catalítico, proporcionando um aumento do pico de oxidação de 163%. Para a metodologia analítica, procurou-se se maximizar o sinal analítico da técnica de voltametria de pulso diferencial, DPV, assim a resposta para o eletrodo de Au/ssDNA/SWCNT foi estudada em relação ao pH, salto de potenciais e a amplitude de pulso. Os valores ótimos encontrados foram 6,0, 2 mV e 50 mV, respectivamente. Nestas condições o eletrodo de Au/ssDNA/SWCNT foi aplicado para a determinação de BPA em uma solução de Na2SO4 0,1 mol L-1, pH 6,0. A resposta analítica tem um comportamento linear na faixa entre 1,0 - 4,5 µmol L-1, de acordo com a seguinte equação: I (µA) = 0.019 (µA) + 5.82 (µA/ µmolL-1) [BPA], com um coeficiente de correlação de 0,996 (n = 10) e um limite de detecção (LOD) de 11,0 nmol L-1 (2,51 µg L-1) determinado de acordo com as recomendações da IUPAC. O valor obtido é menor que aqueles disponíveis na literatura. In the present work, single-walled carbon nanotubes (SWCNT) were immobilized over top a polycrystalline gold electrode. This immobilization assembled a layer of vertically aligned nanotubes on the electrode surface. For this purpose, it was used a DNA probe (ssDNA thiolated (HS-5-TGG-TTA-TGG-GGT-AAA-TTGGAA-3)) that has been used to wrap the carbon nanotube as the following procedure: 1.0 mg of functionalized SWCNT was mixed with 1.0 mL of 1.0 µmol L-1 of a ssDNA solution prepared in 0.1 mol L-1 of PBS containing 10% (v/v) of sodium chloride. Next, the mixture was sonicated using an ultrasonic horn probe and then centrifuged at 10000 rpm; each process took 45 min. Finally, a previously cleaned Au electrode was immersed in the supernatant solution. Self-assembled monolayers (SAMs) consisting of ssDNA/SWCNT were formed after 24 h in a refrigerated room at 4 °C. The morphological characteristics of the electrodes were determined using atomic force microscopy. It was observed that the vertical alignment increased the electrode surface roughness of 1.95 nm to 47.5 nm. The average height of the SWCNT was calculated at 260.3 nm, with a relative standard deviation of 19.9%. The electrochemical behavior of gold electrode modified with the ssDNA/SWCNT hybrid was characterized using cyclic voltammetry (CV) in 0.1 mol L-1 of Na2SO4 containing 5.0 mmol L-1 of [K3Fe(CN)6], with a scan rate of 50 mVs-1. It was observed that the reversibility of the redox couple Fe(CN)63-/Fe(CN)64- decreased using the electrode modified with ssDNA/SWCNT (ΔEpeak = 80 mV), when compared with the Au electrode (ΔEpeak = 115 mV). The modification provided an electrocatalytic response with a shift of 43 mV to less positive values on the Fe(CN)63- oxidation potential value. The oxidation on the Au/ssDNA/SWCNT electrode occurs at +417 mV and the Au electrode at +460 mV. This improvement on the reversibility was quantified using the electrochemical impedance spectroscopy, in which it was observed an apparent constant rate at 7.56 x 10-5 cm s-1 for the modified electrode and 3.36 x 10-5 cm s-1 for pure gold. The effect of the modification of the Au surface with the nanohybrid ssDNA/SWCNT on the bisphenol A (BPA) oxidation was evaluated 0.1 mol L-1 of Na2SO4 (pH 6.0) containing 100 µmol L-1 of BPA. The system was evaluated using CV at 50 mV s-1. The CV experiments showed an oxidation process with an anodic peak potential at 510 mV. This oxidation process is attributed to the electro-oxidation of the BPA forming the fenoxene ions. The process occurred at a less positive potential value when compared with the unmodified Au electrode, i.e. 720 mV. Moreover, surface modified with the nanohybrid presented more catalytic providing an increase of 163% on the oxidation current peak. For the analytical methodology, the analytical signal was maximized. For this, the differential pulse voltammetry (DPV) parameters such as: pulse amplitude and step potential and pH were optimized. The optimum values found were pH at 6.0, pulse amplitude at 50 mV and step potential at 2 mV. In these conditions, the Au/ssDNA/SWCNT electrode was applied for the BPA determination in 0.1 mol L-1 of Na2SO4. The analytical response showed a linear relationship in a range from 1.0 to 4.5 µmol L-1, in accordance with the following equation: I (µA) = 0.019 (µA) + 5.82 (µA / µmol L-1) [BPA ], with a correlation coefficient of 0.996 (n = 10). The limit of detection (LOD) of 11.0 nmol L-1 (2.51 µg L-1) was determined in accordance with the IUPAC recommendations. The obtained value is smaller than those available in the literature.

O uso do cloro para a desinfecção e/ou oxidação nas estações de tratamento de água favorece a formação de subprodutos orgânicos halogenados (SOH), muitos deles carcinogênicos. O objetivo desta pesquisa foi validar uma metodologia analítica proposta para a quantificação simultânea de 12 subprodutos da desinfecção por cromatografia a gás com detector de captura de elétrons (CG-DCE). O método apresentou linearidade (r>0,998), repetibilidade menor que 0,15%, limites de detecção de 1 a 6 µg.L-1 e de quantificação de 3 a 21 Î1/4g.L-1, precisão (0.998), repeatability lower than 0.15%, limits of detection from 1 to 6 Î1/4g.L-1 and of quantification from 3 to 21 Î1/4g.L-1, precision (

Made available in DSpace on 2014-10-01T13:08:39Z (GMT). No. of bitstreams: 0 Previous issue date: 2013-09-01Bitstream added on 2014-10-01T14:02:59Z : No. of bitstreams: 1 S1809-68912013000300014.pdf: 168194 bytes, checksum: b1f16a396d45959b1878afc958c2ff37 (MD5) Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF-5'gcgctcaggctgccgacgcaa3' (cromóforo FAM) e BR-5'accagccattgcggtcggta3' para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10³ bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 10(5) bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial. This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers. Universidade Federal do Tocantins Universidade Estadual Paulista Universidade Estadual Paulista

This paper proposes an alternative analytical spectrophotometric method for the total polyphenol quantification in the aqueous extract of plants. When these extracts are added to solutions of Fe(III), in presence of 1,10-phenanthroline, the absorbance values at 551 nm (A511nm) due to the complexes formed are proportional to the total polyphenol concentration expressed as pyrogallic acid (PA). A typical calibration graph of A511nm values vs. PA is linear from 0.16 to 0.64 mg L-1 (r = 0.994, n = 6) with a limit of detection 0.041 mg L-1. The results of the polyphenol content of the aqueous extracts of twenty medicinal Brazilian plants obtained with the proposed method were compared with values using the Folin-Ciocalteu reagent. A paired t-test revealed no statistically significant difference for the species analyzed. The total antioxidant capacity of the same twenty extracts was determined based on the scavenging of stable radical DPPH.

A simple flow system with multiple pulse amperometric detection using a single working electrode is proposed for simultaneous determination of ascorbic (AA) and acetylsalicylic (AAS) acids in pharmaceutical formulations. The procedure is based on application of two potential pulses: 0.90 V/50 ms: oxidation and determination of AA without the interference of AAS; 1.35 V/50 ms: oxidation of both compounds and quantification of AAS by current subtraction using a correction factor. Sampling rate was estimated as 125 injections per hour and the limits of detection were 0.17 and 0.16 µmol L-1 for AA and AAS, respectively. Results for commercial samples agreed with those obtained using HPLC.

p. 1133-1136 Submitted by Edileide Reis (leyde-landy@hotmail.com) on 2014-07-16T12:02:50Z No. of bitstreams: 1 Alete Paixão Teixeira.pdf: 271728 bytes, checksum: 2784ac76d40631f89dab38d47a96afd2 (MD5) Made available in DSpace on 2014-07-16T12:02:50Z (GMT). No. of bitstreams: 1 Alete Paixão Teixeira.pdf: 271728 bytes, checksum: 2784ac76d40631f89dab38d47a96afd2 (MD5) Previous issue date: 2012 Simple, fast and inexpensive method was developed to determine essential elements in pellets of rice samples using energy dispersive X-ray fluorescence spectrometry (EDXRF). The accuracy and precision were evaluated using Standard Reference Material (rice flour NIST 1568a), and yielding relative standard deviation below 5%. The paired t-test showed good agreement within 95% confidence values. The detection limits (3σ) of Mn and Zn were 5.1 and 2.2 mg kg-1, respectively. The proposed method proved to be effective when used to determine Mn and Zn in commercial samples of rice without go by stage of decomposition.

This paper describes selective molecularly imprinted solid-phase extraction of ttMA from urine samples followed by derivatization and analysis by gas chromatography/mass spectrometry (GC/MS). The analytical calibration curve ranged from 0.3 to 7.0 mg L-1 (r = 0.999) and the limit of quantitation (LOQ) was 0.3 mg L-1. The method was applied for the determination of ttMA in urine samples from smokers and concentrations detected ranged from < LOQ to 1.64 mg L-1. Thus, the proposed method proved adequate for the determination of urinary ttMA in the biomonitoring of occupational exposure to low levels of benzene.

Submitted by Guilherme Lemeszenski (guilherme@nead.unesp.br) on 2013-08-22T18:48:56Z No. of bitstreams: 1 S0100-40422012000100021.pdf: 834074 bytes, checksum: 2d30bb8c1912b76349629261a642e0f3 (MD5) Made available in DSpace on 2013-08-22T18:48:56Z (GMT). No. of bitstreams: 1 S0100-40422012000100021.pdf: 834074 bytes, checksum: 2d30bb8c1912b76349629261a642e0f3 (MD5) Previous issue date: 2012-01-01 Made available in DSpace on 2013-09-30T19:39:03Z (GMT). No. of bitstreams: 2 S0100-40422012000100021.pdf: 834074 bytes, checksum: 2d30bb8c1912b76349629261a642e0f3 (MD5) S0100-40422012000100021.pdf.txt: 28148 bytes, checksum: d5c447a79a875349b6d45fd8d9e25f11 (MD5) Previous issue date: 2012-01-01 Submitted by Vitor Silverio Rodrigues (vitorsrodrigues@reitoria.unesp.br) on 2014-05-20T14:21:01Z No. of bitstreams: 2 S0100-40422012000100021.pdf: 834074 bytes, checksum: 2d30bb8c1912b76349629261a642e0f3 (MD5) S0100-40422012000100021.pdf.txt: 28148 bytes, checksum: d5c447a79a875349b6d45fd8d9e25f11 (MD5) Made available in DSpace on 2014-05-20T14:21:01Z (GMT). No. of bitstreams: 2 S0100-40422012000100021.pdf: 834074 bytes, checksum: 2d30bb8c1912b76349629261a642e0f3 (MD5) S0100-40422012000100021.pdf.txt: 28148 bytes, checksum: d5c447a79a875349b6d45fd8d9e25f11 (MD5) Previous issue date: 2012-01-01 Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) A flow injection spectrophotometric procedure for the determination of glyphosate in commercial formulations of herbicides is proposed. The determination is based on the reaction of glyphosate and p-dimethylaminocinnamaldehyde, in acid medium, yielding a colored compound (l máx = 495 nm). Under optimal conditions, Beer's law is obeyed in a concentration range 40-640 mg mL-1 with a correlation coefficient of 0.9996. The detection limit was 8.60 mg mL-1 for glyphosate. The method was successfully applied for the determination of glyphosate in commercial formulations of herbicides. Recovery of glyphosate from various commercial samples of herbicides range from 91.0 to 110%. Universidade Estadual Paulista Instituto de Química de Araraquara Universidade Estadual Paulista Instituto de Química de Araraquara

Fundação Oswaldo Cruz. Instituto Nacional de Controle de Qualidade em Saúde. Departamento de Química. Rio de Janeiro, RJ, Brasil. Fundação Oswaldo Cruz. Instituto Nacional de Controle de Qualidade em Saúde. Departamento de Química. Rio de Janeiro, RJ, Brasil. Fundação Oswaldo Cruz. Instituto Nacional de Controle de Qualidade em Saúde. Departamento de Química. Rio de Janeiro, RJ, Brasil. Fundação Oswaldo Cruz. Instituto Nacional de Controle de Qualidade em Saúde. Departamento de Química. Rio de Janeiro, RJ, Brasil. Fundação Oswaldo Cruz. Instituto Nacional de Controle de Qualidade em Saúde. Departamento de Química. Rio de Janeiro, RJ, Brasil. Fundação Oswaldo Cruz. Instituto Nacional de Controle de Qualidade em Saúde. Comissão do Programa de Ensaio de Proficiência de Produtos Sujeitos ao Regime de Vigilância Sanitária. Rio de Janeiro, RJ, Brasil. Este artigo diz respeito à implementação do método QuEChERS para a análise por GC-FPD de 53 pesticidas diferentes da classe organofosforados, no todo UHT e leite pasteurizado. Foram avaliadas seletividade, linearidade, repetibilidade, a recuperação e os limites de detecção e quantificação. De todas as cobranças de pesticidas, 51 foram considerados satisfatórios uma vez que os valores variaram de 70 a 120%, com RSD

SIMULTANEOUS DETERMINATION OF OLANZAPINE AND FLUOXETINE HYDROCHLORIDE IN PHARMACEUTICAL FORMULATIONS BY DERIVATIVE SPECTROPHOTOMETRY. Simple, sensitive and accurate spectrophotometric derivative methods were developed for the simultaneous determination of olanzapine and fluoxetine hydrochloride in pharmaceutical formulations by derivative spectrophotometry. On all orders of derivative studied, the linear response range was 10 to 60 mg L-1, with limit of quantitation (LoQ) ranging from 0.73 to 1.49 mg L-1 for fluoxetine hydrochloride and from 0.18 to 0.96 mg L -1 for olanzapine. The best orders for derivative analyses showed recoveries ranging from 99 to 103% and from 98 to 100%, and inter-day accuracy ≤ 2.1% and ≤ 2.8%, for fluoxetine hydrochloride and olanzapine, respectively.

The present study proposes a method for cloud point preconcentration of copper ions at pH 2.0 based on complexes formed with [4,5-dimercapto-1,3-dithyol-2-thionate] and subsequent determination by flame atomic absorption spectrometry (FAAS). Under optimal analytical conditions, the method provided limits of detection of 0.84 and 0.45 µg L-1, by preconcentrating 12.0 and 24.0 mL of sample, respectively. The method was applied for copper determination in water samples, synthetic saliva, guarana powder, tea samples and soft drinks and the accuracy was assessed by analyzing the certified reference materials Dogfish Liver (DOLT-4) and Lobster Hepatopancreas (TORT-2).

The determination of pesticide residues in water samples by Liquid Chromatography require sample preparation for extraction and enrichment of the analytes with the minimization of interferences to achieve adequate detection limits. The Solid Phase Extraction (SPE), Solid Phase Microextraction (SPME), Stir Bar Sorptive Extraction (SBSE) and Dispersive Liquid-Liquid Microextraction (DLLME) techniques have been widely used for extraction of pesticides in water. In this review, the principles of these sample preparation techniques associated with the analysis by Liquid Chromatography with Diode Array Detection (LC-DAD) or Mass Spectrometry (LC-MS) are described and an overview of several applications were presented and discussed.

A method based on headspace - solid phase microextraction coupled with gas chromatography - mass spectrometry was validated for the quantitative determination of 18 organochlorine pesticides in water. For the extraction conditioning some parameters as the best type of coating fiber, time and temperature of extraction, pH and ionic strength were evaluated. The method HS-SPME/GC-MS/MS showed linear coefficient above 0.9948. The repeatability of the measurements were lower than 7.6%. Relative recoveries were between 88 and 110%. Limits of detection from 0.5 x 10-3 to 1.0 mg L-1 were obtained. A total of 31 samples were analyzed and 16 presented from 1 to 5 pesticides.

p. 1198–1201 Submitted by Edileide Reis (leyde-landy@hotmail.com) on 2014-03-31T13:08:45Z No. of bitstreams: 1 Leonardo S. G. Teixeira.pdf: 117575 bytes, checksum: 59b3c427bd217964a46c3e862a9dc6da (MD5) Made available in DSpace on 2014-03-31T13:08:45Z (GMT). No. of bitstreams: 1 Leonardo S. G. Teixeira.pdf: 117575 bytes, checksum: 59b3c427bd217964a46c3e862a9dc6da (MD5) Previous issue date: 2011 Three nitroanilines (2-methoxy-4-nitroaniline, 2,4-dinitroaniline and 2-methyl-4-nitroaniline) were tested as spectrophotometric reagents for determination of ethinylestradiol (ETE). The determinations were based on absorbance measurments of the reaction product obtained from the coupling of each diazotized nitroaniline with ETE. Optimization of temperature, pH and diazotization coupling reaction time was realized. 2-Methyl-4-nitroaniline provided the more sensitive system for ETE spectrophotometric determination at 531 nm and the analytical response was linear in the concentration range of 0.65–10.0 µg ml−1. The limit of detection and coefficient of variation were estimated as 197 µg l−1 and 4.5%, respectively. The results showed that the proposed method is simple and rapid, allowing selective determination of analyte. The method successfully determined ETE in oral contraceptive formulations.

Simvastatin is an oral anti-hyperlipidemic that has been widely used to reduce the cardiovascular disease risk. There isn't any pharmacopoeic method to assay this drug in capsules. It was proposed and validated a method for determining the content of simvastatin in capsules by UV/visible spectrophotometry (l = 237 nm), a more affordable method for the compounding pharmacy. The method was validated for linearity, specificity, range, accuracy, precision, performance, robustness, and limits of detection and quantification.

The present work describes the determination of polychlorinated biphenyls in 123 umbilical cord serum samples by liquid-liquid extraction method with acid hydrolyze step and analysis by GC-mECD. The analytical method was evaluated with following figures of merit for all PCBs: linearity (>0.997); precision (

This paper describes the development of methods for the determination of Pb and Mn in fishes by GF AAS after solubilization with tetramethylamonium hidroxide. The optimization of the operational conditions and the choice of modifier were made using multivariated optimization. Analytical Figures of Merit were adequately to propose. The Limit of Quantification obtained were 150 and 18.5 µg kg-1 to Mn and Pb, respectively. No significant difference was found between the slope values obtained for the aqueous and standard addition calibration curves. The D.P.R. was always lower than 12% and the analysis of the SRM NRCC TORT2 showed 80-120% of recovery.

Um modelo de procedimento para validação de método de ensaio para determinação de cinco agrotóxicos (γ - HCH, clorotalonil, fenitrotiona, clorpirifós e procimidona em matriz tomate) é demonstrado através da análise cromatográfica. A amostra processada é extraída com 30 mL de acetona e em seguida com 60 mL de uma mistura diclometano: éter de petróleo (1:1). O volume total é centrifugado e a alíquota orgânica é filtrada sob Na2SO4. Um mililitro de extrato orgânico é concentrado e dissolvido em um mililitro de iso-octano. Um microlitro do extrato é analisado no cromatógrafo a gás com detector por captura de elétrons - CG/DCE. Foram avaliados seletividade, linearidade, repetitividade, recuperação e limites de detecção e de quantificação. As recuperações obtidas variaram de 70 a 110%, considerando-se os níveis de adição de agrotóxicos/amostra de 0,02 a 2,50 mg.kg-1. Os limites de detecção do método variaram de 0,004 a 0,006 mg.kg-1 e os de quantificação entre 0,014 e 0,020 mg.kg-1. A validation procedure model of a multiresidue method is presented for chromatographic analyses of five pesticides residues γ-HCH, chlorothalonil, fenitrothion, chlorpyrifos and procymidone applied on tomatoes. The tomatoes were processed and extracted by acetone plus a mixture of dichloromethane:petroleum benzine (1:1). The volume was centrifuged and was then filtered under Na2SO4. One milliliter of organic extract was concentrated then diluted in isooctane and one microliter was analyzed in the gas chromatograph with electron capture detector - GC/ECD. The parameters evaluated were selectivity, linearity, repeatability, recovery, and limits of detection and quantification. The recovery ranged from 70 to 110% in the concentration range of 0.02 to 2.50 mg.kg-1. The limits of detection ranged from 0.004 to 0.006 mg.kg-1 and the limits of quantification were between 0.014 to 0.02 mg.kg-1.

Spectrophotometric methods of zero order, first and second derived order had been developed for olanzapine determination in tablets using ethanol and isopropanol as solvent. The two solvents revealed to be adequate. For the three methods the calibration curve coefficient of correlation had been greater than 0.9998 with limit of detection varying from 0.068 to 0.190 mg L-1, in ethanol, and 0.026 to 0.205 mg L-1, in isopropanol. The inter-day precision was inferior to 1.1 and 1.9 mg L-1 for ethanol and isopropanol, respectively. The average recoveries varied from 98 to 101%, in ethanol and 99 to 103% in isopropanol.

The aim of this work was the single-laboratory validation of a quantitative method for the determination of amoxicillin residues in support of cleaning control and validation. Linearity was demonstrated between 2.5 and 17.5 μg/mL, without matrix effects. Mean recoveries ranged from 84.00 to 103.74% and the relative standard deviation under repetitivity and within-reproducibility conditions were from 0.58 to 4.20% and from 0.79 to 4.39%, respectively. The theoretical limits of detection and quantification were 0.133 and 0.442 μg/mL, respectively. The studied method was suitable for cleaning control purpose within good manufacturing practices.

The present work purposes the preparation of a silica gel sorbent organically modified with 2-aminoethyl-3-aminobutylmethyldimethoxysilane (AAMDMS) and imprinted with Cu2+ ions by means surface imprinting technique and its use for selective on-line sorbent preconcentration of Cu2+ ions with further UV-VIS spectrophotometric determination by flow injection analysis. The Cu2+-imprinted silica gel, when compared with non imprinted silica gel and silica gel, showed from the binary mixture of Cu2+/Ni2+ relative selectivity coefficient (k') of 6.84 and 5.43 and 6.64 and 19.83 for the mixture Cu2+/Pb2+, thus demonstrating higher selectivity of Cu2+-imprinted silica gel towards Cu2+ ions. Under optimized condition, the on-line preconcentration method provided detection limit of 3.4 μg L-1 and linear range ranging from 30.0 up to 300.0 μg L-1 (r = 0.995). The accuracy of method was successfully assessed by analyzing different kind of spiked water samples with recovery values ranging from 92.2 up to 103.0%.

Submitted by Guilherme Lemeszenski (guilherme@nead.unesp.br) on 2013-08-22T18:48:49Z No. of bitstreams: 1 S0100-40422010000200039.pdf: 522843 bytes, checksum: 0f20f2fcc212e4ed940ae4f281938995 (MD5) Made available in DSpace on 2013-08-22T18:48:49Z (GMT). No. of bitstreams: 1 S0100-40422010000200039.pdf: 522843 bytes, checksum: 0f20f2fcc212e4ed940ae4f281938995 (MD5) Previous issue date: 2010-01-01 Made available in DSpace on 2013-09-30T19:38:53Z (GMT). No. of bitstreams: 2 S0100-40422010000200039.pdf: 522843 bytes, checksum: 0f20f2fcc212e4ed940ae4f281938995 (MD5) S0100-40422010000200039.pdf.txt: 29986 bytes, checksum: 34751217eaffd2926281847a7376ad8d (MD5) Previous issue date: 2010-01-01 Submitted by Vitor Silverio Rodrigues (vitorsrodrigues@reitoria.unesp.br) on 2014-05-20T14:21:02Z No. of bitstreams: 2 S0100-40422010000200039.pdf: 522843 bytes, checksum: 0f20f2fcc212e4ed940ae4f281938995 (MD5) S0100-40422010000200039.pdf.txt: 29986 bytes, checksum: 34751217eaffd2926281847a7376ad8d (MD5) Made available in DSpace on 2014-05-20T14:21:02Z (GMT). No. of bitstreams: 2 S0100-40422010000200039.pdf: 522843 bytes, checksum: 0f20f2fcc212e4ed940ae4f281938995 (MD5) S0100-40422010000200039.pdf.txt: 29986 bytes, checksum: 34751217eaffd2926281847a7376ad8d (MD5) Previous issue date: 2010-01-01 Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) A simple and more environmentally friendly method by combined spot test-diffuse reflectance spectroscopy for determining metoclopramide in pharmaceutical formulations is described. The method is based on the reaction between metoclopramide and p-dimethylaminocinnamaldehyde, in the presence of HCl, producing a colored compound (λmáx = 580 nm) on the filter paper. The linear range was from 5.65 x 10-4-6.21x10-3 mol L-1 (r = 0.999). The limit of detection was 1.27 x 10-4 mol L-1. The proposed reflectometric method was applied successfully to the determination of metoclopramide in pharmaceuticals and it was favorably compared with the Brazilian or British Pharmacopoeia methods at 95% confidence level. Universidade Estadual Paulista Júlio de Mesquita Filho Instituto de Química do Campus de Araraquara Universidade Estadual Paulista Júlio de Mesquita Filho Instituto de Química do Campus de Araraquara

This work describes methods for the simultaneous determination of Cd and Pb by graphite furnace atomic absorption spectrometry and As by hydride generation atomic absorption spectrometry in Brazilian nuts. The samples (~ 0.300 g) were digested to clear solutions in a closed vessel microwave oven. The pyrolysis and atomization temperatures for simultaneous determinations of Cd and Pb were 1100 and 2100 °C, respectively, using 0.5% (w v-1) NH4H2PO4 + 0.03% (w v-1) Mg(NO3)2 as chemical modifier. The limits of detection (3Δ) were 3.8 μg kg-1 for As, 0.86 μg kg-1 for Cd and 13 μg kg-1 for Pb. The reliability of the entire procedures was confirmed by peach leaves (No. 1547 - NIST) certified reference material analysis and addition and recovery tests. The found concentrations presented no statistical differences at the 95% confidence level.

A simple, accurate and precise flow-injection turbidimetric procedure for the determination of fluoxetine hydrochloride in pharmaceutical formulations is reported. The procedure is based on the precipitation of chloride of fluoxetine hydrochloride with silver nitrate solution and the yielded insoluble AgCl(s) was monitored at 420 nm. The analytical curve was linear in the fluoxetine hydrochloride concentration range 3.0 x 10-5 - 5.0 x 10-4 mol L-1 with a detection limit of 10 µmol L-1 and, a sample throughout of 60 h-1.

The use of antioxidants either to prevent or retard food's lipids oxidation was approved after inquires that verified their security within a daily intake limit. In this study, the methodology was developed and validated for the analysis of synthetic antioxidants: propylgallate (PG), tert-butylhydroquinone (TBHQ), butylhydroxyanisole (BHA), octylgallate (OG) and butylhydroxytoluene (BHT) in vegetables oils, margarine and hydrogenated fats by high performance liquid chromatographic. The methodology revealed itself efficient, with recovery rates above 90% for all antioxidant substances, besides good linearity in concentration range of 40-240 mg kg-1 (r = 0,999), repeatability with CV < 3,7% and limit of quantification 16.55, 10.32, 1.40, 3.76 and 9.30 mg/kg for BHT, BHA, PG, OG and TBHQ, respectively.

Submitted by Guilherme Lemeszenski (guilherme@nead.unesp.br) on 2013-08-22T18:49:20Z No. of bitstreams: 1 S0100-46702008000400009.pdf: 277208 bytes, checksum: 576201445573363004fbf2e2d6e43801 (MD5) Made available in DSpace on 2013-08-22T18:49:20Z (GMT). No. of bitstreams: 1 S0100-46702008000400009.pdf: 277208 bytes, checksum: 576201445573363004fbf2e2d6e43801 (MD5) Previous issue date: 2008-12-01 Made available in DSpace on 2013-09-30T19:09:36Z (GMT). No. of bitstreams: 2 S0100-46702008000400009.pdf: 277208 bytes, checksum: 576201445573363004fbf2e2d6e43801 (MD5) S0100-46702008000400009.pdf.txt: 30645 bytes, checksum: 6f8ae6d7f143b4ee2f82da90bb0c549f (MD5) Previous issue date: 2008-12-01 Submitted by Vitor Silverio Rodrigues (vitorsrodrigues@reitoria.unesp.br) on 2014-05-20T14:19:52Z No. of bitstreams: 2 S0100-46702008000400009.pdf: 277208 bytes, checksum: 576201445573363004fbf2e2d6e43801 (MD5) S0100-46702008000400009.pdf.txt: 30645 bytes, checksum: 6f8ae6d7f143b4ee2f82da90bb0c549f (MD5) Made available in DSpace on 2014-05-20T14:19:52Z (GMT). No. of bitstreams: 2 S0100-46702008000400009.pdf: 277208 bytes, checksum: 576201445573363004fbf2e2d6e43801 (MD5) S0100-46702008000400009.pdf.txt: 30645 bytes, checksum: 6f8ae6d7f143b4ee2f82da90bb0c549f (MD5) Previous issue date: 2008-12-01 Os hidrocarbonetos policíclicos aromáticos (HPAs) estão associados ao aumento da incidência de diversos tipos de cânceres no homem. Essas moléculas são formadas principalmente na queima incompleta de matéria orgânica, sendo encontradas em todos os compartimentos ambientais. Órgãos regulamentadores das áreas ambiental e de saúde ocupacional consideram 17 HPAs como contaminantes atmosféricos prioritários. Este trabalho apresenta um método para análise simultânea destes HPAs utilizando-se a cromatografia a gás acoplada à espectrometria de massas operando no modo tandem (GC-MS/MS). Os limites de detecção e quantificação do método mostraram-se até 5 vezes inferiores aos obtidos no método GC-MS (SCAN). O método mostrou-se seletivo para análise de HPAs em extratos de amostras de material particulado atmosférico. Uma análise comparativa de dois sistemas de solventes (diclorometano/metanol 4:1 v/v e hexano/acetona 1:1 v/v) para a extração de HPAs, utilizando amostras de material particulado atmosférico, revelou que ambas as misturas de solventes possuem poder de extração semelhante. Os resultados sugerem que é possível realizar extração de HPAs de material particulado atmosférico em ultra-som com a mistura hexano/acetona (1:1), que é menos tóxica em relação à mistura diclorometano/metanol (4:1), bastante utilizada nestas análises, sem perdas significativas na exatidão do método. Polycyclic aromatic hydrocarbons (PAHs) are associated with increased incidence of various types of cancers in humans. These molecules are formed mainly in the incomplete burning of organic matter and can be found in all environmental compartments. North American regulatory agencies for environmental and occupational health areas consider 17 PAHs as air contaminants having priority. This work presents a method for simultaneous analysis of these PAHs using gas chromatography coupled to mass spectrometry, operating in tandem mode (GC-MS/MS). The limits of detection and quantification of this method were 5 times lower than that obtained with GC-MS (SCAN) method. The method was selective in analysis of PAHs from airborne particulate matter. A comparative analysis of two systems of solvents (dichloromethane/methanol (4:1 v / v) and hexane/acetone (1:1 v / v)) for PAHs extraction, using samples of airborne particulate matter, shows that both mixtures of solvents have similar extraction ability. The results pointed out that it is possible to extract PAHs from airborne particulate matter using a mixture hexane/acetone (1:1), which is less toxic in than dichloromethane/methanol (4:1), usually used in these analyses, without significant losses in the accuracy of the method. Universidade Estadual Paulista Instituto de Química Departamento de Química Analítica Universidade Estadual Paulista Instituto de Química Departamento de Química Analítica

Este trabalho teve por objetivo determinar a composição centesimal e o conteúdo de Daidzeína (D) e Genisteína (G) da cultivar BRS 243 RR por CLAE. O preparo da amostra para cromatografia envolveu a remoção da gordura com hexano . Os analitos foram extraídos com etanol 70% acrescido de 0,1% de ácido acético. As condições cromatográficas otimizadas foram: coluna C18, fase móvel metanol: ácido acético 5% (1:1 v/v), vazão 0,5 mL/minuto, temperatura da coluna 30 °C, volume de injeção 40 µL e leitura em 254 nm. Os parâmetros de validação avaliados foram: linearidade y = 11242 x -37433, r = 0,9976 (D) e y = 18510 x -66761, r = 0,9980 (G); coeficientes de variação dos estudos de precisão intradia CV = 5,3% (D), CV = 6,7% (G) e interdias CV = 8,7% (D), CV = 9,7% (G); limite de quantificação 10 µg.g-1; limite de detecção 5 µg.g-1 e recuperação 95,7%. Portanto, o método desenvolvido foi adequado para a determinação de daidzeína e genisteína em soja. Os níveis de carboidratos (31,4%), proteínas (35,9%), lipídios (20,9%), umidade (6,9%), cinzas (4,9%), daidzeína (44,1 µg.g-1) e genisteína (37,4 µg.g-1) determinados na soja transgênica foram similares aos de outros estudos com soja convencional. The objective of this work was to evaluate the proximate composition, as well as Daidzein (D) and Genistein (G) contents by HPLC, of BRS 243 RR soybean. Sample preparation for the chromatographic analysis involved the use of hexane to remove lipids. Isoflavones were extracted with 70% ethanol containing 0.1% acetic acid. The optimized chromatographic conditions were: C18 column, mobile phase methanol:5% acetic acid (1:1 v/v), flow rate 0.5 mL/minute, column temperature 30 °C, UV absorbance at 254 nm and volume injected 40 µL. The validation parameters were: linearity of daidzein (y = 11242 x -37433, r = 0.9976) and genistein (y = 18510 x -66761, r = 0.9980); variation coefficients obtained in intra-day precision assays [CV = 5.3% (D), CV = 6.7% (G)] and inter-day precision assays [CV = 8.7% (D), CV = 9.7% (G)]; quantification limit 10 µg.g-1; detection limit 5 µg.g-1 and recovery 95.7%. Therefore, the optimized method was appropriate for the determination of daidzein and genistein in soybean. Carbohydrate (31.4%), protein (35.9%), lipid (20.9%), moisture (6.9%), ash (4.9%), daidzein (44.1 µg.g-1) and genistein (37.4 µg.g-1) contents determined in transgenic soybean were similar to those of conventional soybean determined in other studies.

Oito amostras, provenientes do Brasil, Chile e Argentina, de Peumus boldus Molina (Monimiaceae), espécie comum e abundante no Chile, cujas folhas são amplamente empregadas pela medicina tradicional para o tratamento de uma variedade de afecções do sistema digestivo e hepatobiliar, foram analisadas, após digestão nítrica, para a quantifi cação de ferro, manganês, cobre, chumbo, cromo, cobalto e níquel, por espectrofotometria de absorção atômica. Chumbo, cromo e cobalto não foram detectados (limite de detecção de 5 µg/g) em nenhuma das amostras. Todas as amostras apresentaram maior teor em ferro, que variou de 109,7 mg/kg a 315,7 mg/kg, seguido por manganês (65,5 mg/kg a 158,8 mg/kg), cobre (3,04 mg/kg a 9,16 mg/kg) e níquel (0,77 mg/kg a 4,31 mg/kg). Eight samples, obtained from Brazil, Chile and Argentina, of Peumus boldus Molina (Monimiaceae), an abundant and widespread native tree in Chile, which leaves are widely used in folk medicine for the treatment of digestive and hepatobiliary disorders, were analyzed, after nitric digestion, for the content of iron, manganese, copper, lead, chromium, cobalt and nickel, by atomic absorption spectrophotometry. Lead, chromium and cobalt were not detected (detection limit of 5 µg/g) in any sample. The samples showed a high level of iron, which ranged from 109.7 mg/kg to 315.7 mg/kg, followed by manganese (65.5 mg/kg to 158.8 mg/kg), copper (3.04 mg/ kg to 9.16 mg/kg) and nickel (0.77 mg/kg to 4.31 mg/kg).

The present work purposes the development of an analytical method for amitriptyline determination in pharmaceutical formulations using FIA system. It was based on interaction of amitriplyline with sodium lauryl sulphate in acid medium (pH 2.5) resulting in the ion-pair formation turbidimetrically detected at 410 nm. The fitting regression equation for range curve from 2.0 x 10-3 up to 3.2 x 10-3 mol L-1 was found to be analytical signal = -2.7417 + 0.1538 [amitriptyline] (r = 0.99991) with a detection limit of 1.8 x 10-3 mol L-1. The precision assessed as relative standard deviation (n = 10) was found to be 2.40 and 1.94%, for the respective concentration of amitriplyline 2.0 x 10-3 and 3.2 x 10-3 mol L-1 and the sample throughout was 60 h-1. The accuracy of method was successfully assessed in pharmaceutical formulation after comparison with a reference analytical method.

Neste trabalho foi investigado o índice de HMF (5-hidroximetilfurfural) em méis comercializados em Porto Alegre - RS, utilizando Cromatografia Capilar Eletrocinética Micelar. O HMF, produto da condensação da frutose, é um indicador da qualidade e conservação do mel. Foram analisadas 11 marcas de méis comercializados na cidade de Porto Alegre. O composto estudado esteve presente em todas as amostras, em um intervalo de concentração de 0,191 a 6,206 mg.kg-1. Para quantificar o HMF presente nos méis, utilizou-se a técnica de adição de padrão. A taxa de recuperação foi de 98% e o limite de detecção foi de 0,025 mg.kg-1. O limite permitido de HMF em méis, segundo a legislação brasileira, é de 60 mg.kg-1. In this work, the occurrence of HMF (5-hydroxymethylfurfural) in honey marketed in Porto Alegre - RS was investigated using Micellar Electrokinetic Capillary Chromatography. The HMF, which is the product of the fructose condensation, is an indicator of honey quality and conservation. Eleven types of honey commercialized in Porto Alegre were analyzed, and all of them contained HMF in a range from 0.191 to 6.206 mg.kg-1. In order to quantify the HMF present in the samples, the technique of standard addition was employed. The recovery was 98% and the detection limit was 0.025 mg.kg-1. The allowed limit of HMF in honey, according to the Brazilian Legislation, is 60 mg.kg-1.

The use of square-wave voltammetry in conjunction with a cathodically pre-treated diamond electrode for the analytical determination of sodium cyclamate is described. The samples were analyzed as received in a 0.5 mol L-1 H2SO4 solution in the concentration range from 5.0 × 10-5 mol L-1 to 4.1 × 10-4 mol L-1, with a detection limit of 4.8 × 10-6 mol L-1. The RSD was smaller than 1.2 % and the proposed method was applied with success in the determination of sodium cyclamate in several dietary products.

No presente trabalho os parâmetros de desempenho (validação intralaboratorial) da metodologia de determinação de TPH (Total Petroleum Hydrocarbons) foram determinados por detecção na região do infravermelho com o equipamento da Infracal TOG/TPH, visando aplicação em amostras de areia contaminadas com petróleo. Os ensaios foram realizados utilizando Óleo Marine Fuel 380, com densidade igual 0,987 g cm-3 e viscosidade de 5313 cP a 20°C. Este óleo foi fornecido pelo Centro de Pesquisa da Petrobrás (CENPES/PETROBRÁS/RJ), sendo o mesmo óleo derramado no acidente ocorrido em janeiro de 2000, na Baia de Guanabara, RJ, quando 1.300 m3 vazaram do duto que interliga a REDUC (Refinaria Duque de Caxias, RJ) ao terminal da Ilha d’Água/RJ, atingindo praias. Os resultados da validação indicaram que o desempenho da metodologia foi favorável à aplicação que se destina. Entre os parâmetros metrológicos obtidos neste trabalho, o limite de detecção do método foi de 4,06 mg L-1, consideravelmente inferior à faixa de concentração normalmente obtida para amostras em tais situações. This work deals with an optimization of TPH (Total Petroleum Hydrocarbon) analysis methodology for samples of contaminated sands, validating the infrared detection technique through the use of Infracal TOG/TPH equipment. Tests were validated using Marine Fuel 380 oil, density 0.987 g cm-3 and viscosity 5313 cP at 20 ºC. This oil sample was kindly supplied by Petrobras Research Centre (CENPES), and is the same oil that leaked from a pipeline in REDUC Refinery on January 2000, contaminating several beaches in Guanabara Bay, including Anil and Mauá. The validation results suggested that the methodology performance was adequate for this application. Amongst the metrological parameters obtained from this work, the detection limit, 4.06 mg L-1, was a plus; since it was far below to the concentration range obtained from this samples.

The objective of this work was to optimize the derivatization reaction for determining deoxynivalenol (DON) by gas chromatography employing an experimental planning procedure. The factors were: temperature, reaction time, catalyst and trifluoroacetic anhydride concentration. The relative peak areas were used to evaluated the effects. The best conditions for DON derivatization were 200 µL TFAA and 18 mg sodium bicarbonate for 6 min at 74 ºC for 7 to 21 µg of DON. Under these conditions, the detection limit was 1.4 µg of DON.