Search

The period between the fragmentation of the ‘Abbāsid empire in the 10th century AD and the formation of the Mamlūk state in the 13th century was one of considerable social, economic, and political change in the Levant. The period is marked by competition and shifting alliances among centralizing polities and autonomous local elites, a situation that makes archaeological investigation both difficult and rewarding.This dissertation examines the tension between autonomy and centralization within the Ayyūbid polity (ca. 1186-1263 AD) through the lens of industry, focusing specifically on copper production. The Ayyūbid copper production system in southern Jordan is reconstructed using data from systematic archaeological excavations and surveys in the arid lowlands of Faynān, including new excavations at two early 13th century copper production sites: Khirbat Nuqayb al-Asaymir (KNA) and Khirbat Faynān. The analysis takes a Braudelian approach, situating the 13th century copper industry within long-term (primarily economic), medium-term (primarily political), and short-term (primarily social) changes in the Faynān region, and southern Jordan more broadly. The primary conclusion of this work is that the short-lived revival of copper production was part of a broader reorganization of the southern Levantine agricultural regime toward industrial-scale production of cane sugar. This reorganization took place, first, under the rule of the Ayyūbid princes of al-Karak in central Jordan, who adopted a local provisioning strategy that provided them considerable autonomy from the regional centers of Cairo and Damascus. Copper production in Faynān ended in the late 13th century, as the region came under the control of the Mamlūk state, and the Levantine sugar industry was integrated into a production system more dependent on Cairo.

International audience; Carbon catabolite repression (CCR) plays a key role in many physiological and adaptive responses in a broad range of microorganisms that are commonly associated with eukaryotic hosts. When a mixture of different carbon sources is available, CCR, a global regulatory mechanism, inhibits the expression and activity of cellular processes associated with utilization of secondary carbon sources in the presence of the preferred carbon source. CCR is known to be executed by completely different mechanisms in different bacteria, yeast, and fungi. In addition to regulating catabolic genes, CCR also appears to play a key role in the expression of genes involved in plant-microbe interactions. Here, we present a detailed overview of CCR mechanisms in various bacteria. We highlight the role of CCR in beneficial as well as deleterious plant-microbe interactions based on the available literature. In addition, we explore the global distribution of known regulatory mechanisms within bacterial genomes retrieved from public repositories and within metatranscriptomes obtained from different plant rhizospheres. By integrating the available literature and performing targeted meta-analyses, we argue that CCR-regulated substrate use preferences of microorganisms should be considered an important trait involved in prevailing plant-microbe interactions.

DNA supercoiling acts as a global transcriptional regulator in bacteria, that plays an important role in adapting their expression programme to environmental changes, but for which no quantitative or even qualitative regulatory model is available. Here, we focus on spatial supercoiling heterogeneities caused by the transcription process itself, which strongly contribute to this regulation mode. We propose a new mechanistic modeling of the transcription-supercoiling dynamical coupling along a genome, which allows simulating and quantitatively reproducing in vitro and in vivo transcription assays, and highlights the role of genes’ local orientation in their supercoiling sensitivity. Consistently with predictions, we show that chromosomal relaxation artificially induced by gyrase inhibitors selectively activates convergent genes in several enterobacteria, while conversely, an increase in DNA supercoiling naturally selected in a long-term evolution experiment with Escherichia coli favours divergent genes. Simulations show that these global expression responses to changes in DNA supercoiling result from fundamental mechanical constraints imposed by transcription, independently from more specific regulation of each promoter. These constraints underpin a significant and predictable contribution to the complex rules by which bacteria use DNA supercoiling as a global but fine-tuned transcriptional regulator.

Summary Nucleoid-associated proteins (NAPs) are a class of highly abundant DNA-binding proteins in bacteria and archaea. While both the composition and relative abundance of the NAPs change during the bacterial growth cycle, surprisingly little is known about their crosstalk in mutually binding and stabilizing higher-order nucleoprotein complexes in the bacterial chromosome. Here, we use atomic force microscopy and solid-state nanopores to investigate long-range nucleoprotein structures formed by the binding of two major NAPs, FIS and H-NS, to DNA molecules with distinct binding site arrangements. We find that spatial organization of the protein binding sites can govern the higher-order architecture of the nucleoprotein complexes. Based on sequence arrangement the complexes differed in their global shape and compaction as well as the extent of FIS and H-NS binding. Our observations highlight the important role the DNA sequence plays in driving structural differentiation within the bacterial chromosome., Graphical abstract, Highlights • The location of protein binding sites along DNA is important for 3D organization • FIS protein forms DNA loops while H-NS forms compact DNA plectonemes • FIS DNA loops inhibit H-NS from spreading over the DNA • FIS and H-NS competition creates regions of ‘open’ and ‘closed’ DNA, Organizational Aspects of Cell Biology;Structural Biology

Recombinases are responsible for homologous recombination and maintenance of genome integrity. In Escherichia coli, the recombinase RecA forms a nucleoprotein filament with the ssDNA present at a DNA break and searches for a homologous dsDNA to use as a template for break repair. During the first step of this process, the ssDNA is bound to RecA and stretched into a Watson–Crick base-paired triplet conformation. The RecA nucleoprotein filament also contains ATP and Mg2+, two cofactors required for RecA activity. Then, the complex starts a homology search by interacting with and stretching dsDNA. Thanks to supercoiling, intersegment sampling and RecA clustering, a genome-wide homology search takes place at a relevant metabolic timescale. When a region of homology 8–20 base pairs in length is found and stabilized, DNA strand exchange proceeds, forming a heteroduplex complex that is resolved through a combination of DNA synthesis, ligation and resolution. RecA activities can take place without ATP hydrolysis, but this latter activity is necessary to improve and accelerate the process. Protein flexibility and monomer–monomer interactions are fundamental for RecA activity, which functions cooperatively. A structure/function relationship analysis suggests that the recombinogenic activity can be improved and that recombinases have an inherently large recombination potential. Understanding this relationship is essential for designing RecA derivatives with enhanced activity for biotechnology applications. For example, this protein is a major actor in the recombinase polymerase isothermal amplification (RPA) used in point-of-care diagnostics.

Small non-coding RNAs (sRNAs) regulate numerous cellular processes in all domains of life. Several approaches have been developed to identify them from RNA-seq data, which are efficient for eukaryotic sRNAs but remain inaccurate for the longer and highly structured bacterial sRNAs. We present APERO, a new algorithm to detect small transcripts from paired-end bacterial RNA-seq data. In contrast to previous approaches that start from the read coverage distribution, APERO analyzes boundaries of individual sequenced fragments to infer the 5′ and 3′ ends of all transcripts. Since sRNAs are about the same size as individual fragments (50–350 nucleotides), this algorithm provides a significantly higher accuracy and robustness, e.g., with respect to spontaneous internal breaking sites. To demonstrate this improvement, we develop a comparative assessment on datasets from Escherichia coli and Salmonella enterica, based on experimentally validated sRNAs. We also identify the small transcript repertoire of Dickeya dadantii including putative intergenic RNAs, 5′ UTR or 3′ UTR-derived RNA products and antisense RNAs. Comparisons to annotations as well as RACE-PCR experimental data confirm the precision of the detected transcripts. Altogether, APERO outperforms all existing methods in terms of sRNA detection and boundary precision, which is crucial for comprehensive genome annotations. It is freely available as an open source R package on https://github.com/Simon-Leonard/APERO

International audience; In the quest for a sustainable economy of the earth resources and for renewable sources of energy, a promising avenue is to exploit the vast quantity of polysaccharide molecules contained in green wastes. To that end, the decomposition of pectin appears to be an interesting target because this polymeric carbohydrate is abundant in many fruit pulps and soft vegetables. To quantitatively study this degradation process, here we designed a bioreactor that is continuously fed with de-esterified pectin (PGA). Thanks to the pectate lyases produced by bacteria cultivated in the vessel, the PGA is depolymerized into oligo-galacturonates (UGA) which is continuously extracted from the tank. A mathematical model of our system predicted that the conversion efficiency of PGA into UGA increases in a range of coefficient of dilution until reaching an upper limit where the fraction of UGA that is extracted from the bioreactor is maximized. Results from experiments with a continuous reactor hosting a strain of the plant pathogenic bacterium Dickeya dadantii and in which the dilution coefficients were varied, quantitatively validated the predictions of our model. A further theoretical analysis of the system enabled an a priori comparison of the efficiency of eight other pectate lyases-producing microorganisms with that of D. dadantii. Our findings suggest that D. dadantii is as the most efficient microorganism and therefore the best candidate for a practical implementation of our scheme for the bioproduction of UGA from PGA.

International audience; Microbial fermentation is an indispensable process for high quality chocolate from cocoa bean raw material. lactic acid bacteria (LAB) are among the major microorganisms responsible for cocoa fermentation but their exact role remains to be elucidated. In this study, we analyzed the diversity of LAB in six cocoa producing regions of Ivory Coast. Ribosomal 16S gene sequence analysis showed that Lactobacillus plantarum and Leuconostoc mesenteroides are the dominant LAB species in these six regions. In addition, other species were identified as the minor microbial population, namely Lactobacillus curieae, Enterococcus faecium, Fructobacillus pseudoficulneus, Lactobacillus casei, Weissella paramesenteroides and Weissella cibaria. However, in each region, the LAB microbial population was composed of a restricted number of species (maximum 5 species), which varied between the different regions. LAB implication in the breakdown of citric acid was investigated as a fundamental property for a successful cocoa fermentation process. High citrate lyase producer strains were characterized by rapid citric acid consumption, as revealed by a 4-fold decrease in citric acid concentration in the growth medium within 12h, concomitant with an increase in acetic acid and lactic acid concentration. The production of citrate lyase was strongly dependent on environmental conditions, with optimum production at acidic pH (pH

International audience; Plant pathogenic bacteria attack numerous agricultural crops, causing devastating effects on plant productivity and yield. They survive in diverse environments, both in plants, as pathogens, and also outside their hosts as saprophytes. Hence, they are confronted with numerous changing environmental parameters. During infection, plant pathogens have to deal with stressful conditions, such as acidic, oxidative and osmotic stresses; anaerobiosis; plant defenses; and contact with antimicrobial compounds. These adverse conditions can reduce bacterial survival and compromise disease initiation and propagation. Successful bacterial plant pathogens must detect potential hosts and also coordinate their possibly conflicting programs for survival and virulence. Consequently, these bacteria have a strong and finely tuned capacity for sensing and responding to environmental and plant stimuli. This review summarizes our current knowledge of the signals and genetic circuits that affect survival and virulence factor expression in three important and well-studied plant pathogenic bacteria with wide host ranges and the capacity for long-term environmental survival. These are: Ralstonia solanacerarum, a vascular pathogen that causes wilt disease; Agrobacterium tumefaciens, a biotrophic tumorigenic pathogen responsible for crown gall disease and Dickeya, a brute force apoplastic pathogen responsible for soft-rot disease.

International audience; Dickeya dadantii is a pathogen infecting a wide range of plant species. Soft rot, the visible symptom, is mainly due to the production of pectate lyases (Pels) that can destroy the plant cell walls. Previously we found that the pel gene expression is modulated by H-NS and FIS, two nucleoid-associated proteins (NAPs) modulating the DNA topology. Here, we show that relaxation of the DNA in growing D. dadantii cells decreases the expression of pel genes. Deletion of fis aggravates, whereas that of hns alleviates the negative impact of DNA relaxation on pel expression. We further show that H-NS and FIS directly bind the pelE promoter and that the response of D. dadantii pel genes to stresses that induce DNA relaxation is modulated, although to different extents, by H-NS and FIS. We infer that FIS acts as a repressor buffering the negative impact of DNA relaxation on pel gene transcription, whereas H-NS fine-tunes the response of virulence genes precluding their expression under suboptimal conditions of supercoiling. This novel dependence of H-NS effect on DNA topology expands our understanding of the role of NAPs in regulating the global bacterial gene expression and bacterial pathogenicity.

Dickeya dadantii is a pathogen infecting a wide range of plant species. Soft rot, the visible symptom, is mainly due to production of pectate lyases (Pels) that can destroy plant cell walls. Previously, we found that nucleoid-associated protein (NAP) H-NS is a key regulator of pel gene expression. The primary binding sites of this NAP have been determined here by footprinting experiments on the pelD gene, encoding an essential virulence factor. Quantitative analysis of DNAse I footprints and surface plasmon resonance imagery experiments further revealed that high-affinity binding sites initiate cooperative binding to establish the nucleoprotein structure required for gene expression silencing. Mutations in the primary binding sites resulted in reduction or loss of repression by H-NS. Overall, these data suggest that H-NS represses pelD, and by inference, other pel genes, by a cooperative binding mechanism, through oligomerization of H-NS molecules.

Colonization factors (CFs) mediate early adhesion of Enterotoxigenic Escherichia coli (ETEC) in the small intestine. Environmental signals including bile, glucose, and contact with epithelial cells have previously been shown to modulate CF expression in a strain dependent manner. To identify novel components modulating CF surface expression, 20 components relevant to the intestinal environment were selected for evaluation. These included mucin, bicarbonate, norepinephrine, lincomycin, carbon sources, and cations. Effects of individual components on surface expression of the archetype CF, CFA/I, were screened using a fractional factorial Hadamard matrix incorporating 24 growth conditions. As most CFs agglutinate erythrocytes, surface expression was evaluated by mannose resistant hemagglutination. Seven components, including porcine gastric mucin, lincomycin, glutamine, and glucose were found to induce CFA/I surface expression in vitro in a minimal media while five others were inhibitory, including leucine and 1,10-phenanthroline. To further explore the effect of components positively influencing CFA/I surface expression, a response surface methodology (RSM) was designed incorporating 36 growth conditions. The optimum concentration for each component was identified, thereby generating a novel culture media, SP1, for CFA/I expression. CFs closely related to CFA/I, including CS4 and CS14 were similarly induced in SP1 media. Other epidemiologically relevant CFs were also induced when compared to the level obtained in minimal media. These results indicate that although CF surface expression is complex and highly variable among strains, the CF response can be predicted for closely related strains. A novel culture media inducing CFs in the CF5a group was successfully identified. In addition, mucin was found to positively influence CF expression in strains expressing either CFA/I or CS1 and CS3, and may function as a common environmental cue.

Iron availability functions as an environmental cue for enteropathogenic bacteria, signaling arrival within the human host. As enterotoxigenic Escherichia coli (ETEC) is a major cause of human diarrhea, the effect of iron on ETEC virulence factors was evaluated here. ETEC pathogenicity is directly linked to production of fimbrial colonization factors and secretion of heat-labile enterotoxin (LT) and/or heat-stable enterotoxin (ST). Efficient colonization of the small intestine further requires at least the flagellin binding adhesin EtpA. Under iron starvation, production of the CFA/I fimbriae was increased in the ETEC H10407 prototype strain. In contrast, LT secretion was inhibited. Furthermore, under iron starvation, gene expression of the cfa (CFA/I) and etp (EtpBAC) operons was induced, whereas transcription of toxin genes was either unchanged or repressed. Transcriptional reporter fusion experiments focusing on the cfa operon further showed that iron starvation stimulated cfaA promoter activity in ETEC, indicating that the impact of iron on CFA/I production was mediated by transcriptional regulation. Evaluation of cfaA promoter activity in heterologous E. coli single mutant knockout strains identified IscR as the regulator responsible for inducing cfa fimbrial gene expression in response to iron starvation, and this was confirmed in an ETEC Δ iscR strain. The global iron response regulator, Fur, was not implicated. IscR binding sites were identified in silico within the cfaA promoter and fixation confirmed by DNase I footprinting, indicating that IscR directly binds the promoter region to induce CFA/I. IMPORTANCE Pathogenic enterobacteria modulate expression of virulence genes in response to iron availability. Although the Fur transcription factor represents the global regulator of iron homeostasis in Escherichia coli , we show that several ETEC virulence factors are modulated by iron, with expression of the major fimbriae under the control of the iron-sulfur cluster regulator, IscR. Furthermore, we demonstrate that the apo form of IscR, lacking an Fe-S cluster, is able to directly fix the corresponding promoter region. These results provide further evidence implicating IscR in bacterial virulence and suggest that IscR may represent a more general regulator mediating the iron response in enteropathogens.

The bacterial gene regulatory regions often demonstrate distinctly organized arrays of RNA polymerase binding sites of ill-defined function. Previously we observed a module of closely spaced polymerase binding sites upstream of the canonical promoter of the Escherichia coli fis operon. FIS is an abundant nucleoid-associated protein involved in adjusting the chromosomal DNA topology to changing cellular physiology. Here we show that simultaneous binding of the polymerase at the canonical fis promoter and an upstream transcriptionally inactive site stabilizes a RNAP oligomeric complex in vitro. We further show that modulation of the upstream binding of RNA polymerase affects the fis promoter activity both in vivo and in vitro. The effect of the upstream RNA polymerase binding on the fis promoter activity depends on the spatial arrangement of polymerase binding sites and DNA supercoiling. Our data suggest that a specific DNA geometry of the nucleoprotein complex stabilized on concomitant binding of RNA polymerase molecules at the fis promoter and the upstream region acts as a topological device regulating the fis transcription. We propose that transcriptionally inactive RNA polymerase molecules can act as accessory factors regulating the transcription initiation from a nearby promoter.

International audience; Bacteria use biofilm structures to colonize surfaces and to survive in hostile conditions, and numerous bacteria produce cellulose as a biofilm matrix polymer. Hence, expression of the bcs operon, responsible for cellulose biosynthesis, must be finely regulated in order to allow bacteria to adopt the proper surface-associated behaviours. Here we show that in the phytopathogenic bacterium, Dickeya dadantii, production of cellulose is required for pellicle-biofilm formation and resistance to chlorine treatments. Expression of the bcs operon is growth phase-regulated and is stimulated in biofilms. Furthermore, we unexpectedly found that the nucleoid-associated protein and global regulator of virulence functions, Fis, directly represses bcs operon expression by interacting with an operator that is absent from the bcs operon of animal pathogenic bacteria and the plant pathogenic bacterium Pectobacterium. Moreover, production of cellulose enhances plant surface colonization by D. dadantii. Overall, these data suggest that cellulose production and biofilm formation may be important factors for surface colonization by D. dadantii and its subsequent survival in hostile environments. This report also presents a new example of how bacteria can modulate the action of a global regulator to co-ordinate basic metabolism, virulence and modifications of lifestyle.

International audience; BACKGROUND: Several small diffusible molecules are involved in bacterial quorum sensing and virulence. The production of autoinducers-1 and -2, quinolone, indole and γ-amino butyrate signaling molecules was investigated in a set of soft-rot bacteria belonging to six Dickeya or Pectobacterium species including recent or emerging potato isolates. METHODOLOGY/PRINCIPAL FINDINGS: Using bacterial biosensors, immunoassay, and chromatographic analysis, we showed that soft-rot bacteria have the common ability to produce transiently during their exponential phase of growth the N-3-oxo-hexanoyl- or the N-3-oxo-octanoyl-l-homoserine lactones and a molecule of the autoinducer-2 family. Dickeya spp. produced in addition the indole-3-acetic acid in tryptophan-rich conditions. All these signaling molecules have been identified for the first time in the novel Dickeya solani species. In contrast, quinolone and γ-amino butyrate signals were not identified and the corresponding synthases are not present in the available genomes of soft-rot bacteria. To determine if the variations of signal production according to growth phase could result from expression modifications of the corresponding synthase gene, the respective mRNA levels were estimated by reverse transcriptase-PCR. While the N-acyl-homoserine lactone production is systematically correlated to the synthase expression, that of the autoinducer-2 follows the expression of an enzyme upstream in the activated methyl cycle and providing its precursor, rather than the expression of its own synthase. CONCLUSIONS/SIGNIFICANCE: Despite sharing the S-adenosylmethionine precursor, no strong link was detected between the production kinetics or metabolic pathways of autoinducers-1 and -2. In contrast, the signaling pathway of autoinducer-2 seems to be switched off by the indole-3-acetic acid pathway under tryptophan control. It therefore appears that the two genera of soft-rot bacteria have similarities but also differences in the mechanisms of communication via the diffusible molecules. Our results designate autoinducer-1 lactones as the main targets for a global biocontrol of soft-rot bacteria communications, including those of emerging isolates.

Background: Quantitative RT-PCR is the method of choice for studying, with both sensitivity and accuracy, the expression of genes. A reliable normalization of the data, using several reference genes, is critical for an accurate quantification of gene expression. Here, we propose a set of reference genes, of the phytopathogenic bacteria Dickeya dadantii and Pectobacterium atrosepticum, which are stable in a wide range of growth conditions. [br/] Results: We extracted, from a D. dadantii micro-array transcript profile dataset comprising thirty-two different growth conditions, an initial set of 49 expressed genes with very low variation in gene expression. Out of these, we retained 10 genes representing different functional categories, different levels of expression (low, medium, and high) and with no systematic variation in expression correlating with growth conditions. We measured the expression of these reference gene candidates using quantitative RT-PCR in 50 different experimental conditions, mimicking the environment encountered by the bacteria in their host and directly during the infection process in planta. The two most stable genes (ABF-0017965 (lpxC) and ABF-0020529 (yafS) were successfully used for normalization of RT-qPCR data. Finally, we demonstrated that the ortholog of lpxC and yafS in Pectobacterium atrosepticum also showed stable expression in diverse growth conditions. [br/] Conclusions: We have identified at least two genes, lpxC (ABF-0017965) and yafS (ABF-0020509), whose expressions are stable in a wide range of growth conditions and during infection. Thus, these genes are considered suitable for use as reference genes for the normalization of real-time RT-qPCR data of the two main pectinolytic phytopathogenic bacteria D. dadantii and P. atrosepticum and, probably, of other Enterobacteriaceae. Moreover, we defined general criteria to select good reference genes in bacteria.

Pathogenicity of the enterobacterium Erwinia chrysanthemi ( Dickeya dadantii ), the causative agent of soft-rot disease in many plants, is a complex process involving several factors whose production is subject to temporal regulation during infection. PecS is a transcriptional regulator that controls production of various virulence factors. Here, we used microarray analysis to define the PecS regulon and demonstrated that PecS notably regulates a wide range of genes that could be linked to pathogenicity and to a group of genes concerned with evading host defenses. Among the targets are the genes encoding plant cell wall-degrading enzymes and secretion systems and the genes involved in flagellar biosynthesis, biosurfactant production, and the oxidative stress response, as well as genes encoding toxin-like factors such as NipE and hemolysin-coregulated proteins. In vitro experiments demonstrated that PecS interacts with the regulatory regions of five new targets: an oxidative stress response gene ( ahpC ), a biosurfactant synthesis gene ( rhlA ), and genes encoding exported proteins related to other plant-associated bacterial proteins ( nipE , virK , and avrL ). The pecS mutant provokes symptoms more rapidly and with more efficiency than the wild-type strain, indicating that PecS plays a critical role in the switch from the asymptomatic phase to the symptomatic phase. Based on this, we propose that the temporal regulation of the different groups of genes required for the asymptomatic phase and the symptomatic phase is, in part, the result of a gradual modulation of PecS activity triggered during infection in response to changes in environmental conditions emerging from the interaction between both partners.

International audience; Building up from experimental knowledge of the regulatory network of the pel genes in the bacteria E. chrysanthemi, we propose for the first time a qualitative modeling of the infectious transition of this bacteria when it is hosted in a plant. We show that this infectious transition can be understood as the excitable dynamics of a metabolico-genetic network. Our mathematical model can account for the main phases which are observed in the onset of the pathogenecity by Erwinia chrysanthemi, namely the silent, latent and virulent stages. Like in many infectious agents, the silent state corresponds to the growth phase of the bacteria, where they multiply without significantly producing molecules which could trigger a counter attack of the invaded host. The latent stage is characterized by a moderate but unequivocal expression of the virulence gene, waiting for a number of conditions which have to fulfill in order to trigger a fully developed infection. In the virulent state the bacteria synthesize a massive production of virulence factors including pectate lyases (Pel) which favor the invasion of the host plant tissues. Our model is able to show cases of transitions from the silent to the virulent stages of the infection, using the method of the piecewise-affine (PA) differential equations and its implementation in the genetic network analyser software (GNA). The obtained qualitative dynamics of the models are consistent with the current experimental data about this system. Moreover it can be interpreted with respect to the relatively complex structure of the binding sites of pel. From the biological point of view, our simulations validate the picture that the promoter of pel has evolved to form a security device preventing a hastened expression of these virulent genes. This first modeling of the regulation of pel genes opens the way to new confrontations between theoretical ideas with experiments and possible strategies to fight the soft-rot disease of plants.

Bacteria use small signal molecules, referred to as autoinducers, in order to monitor their population density and coordinate gene expression in a process named quorum sensing. In Gram-negative bacteria, acylated homoserine lactones are the most common autoinducer used for cell-to-cell communication. Increasing evidence that many different functions are controlled by acylated homoserine lactone quorum sensing has stimulated intensive investigations into the physiology, molecular biology and biochemistry that underlie this process. Here we review our current understanding of the molecular mechanisms used by the transcriptional regulators responsive to acylated homoserine lactone autoinducers to control gene expression and the structural modifications induced by acylated homoserine lactones binding specifically on these regulators.

International audience; In Erwinia chrysanthemi production of pectic enzymes is controlled by a complex network involving several regulators. Among them is ExpR, the quorum-sensing regulatory protein. ExpR is a member of the LuxR family of transcriptional regulators, the activity of which is modulated by the binding of diffusible N-acylhomoserine lactone pheromones to the N-terminal receptor site of the proteins. Previous in vitro DNA-ExpR binding studies suggested that ExpR might activate pectic enzyme production and repress its cognate gene expression. This report presents genetic evidence that ExpR represses its own gene expression in the absence of pheromone and that the addition of pheromone promotes concentration-dependent de-repression. In vitro experiments show that (i) ExpR binds target DNA in the absence of pheromone and that the pheromone dissociates ExpR-DNA complexes, (ii) ExpR binds target DNA in a non-cooperative fashion, and (iii) two molecules of pheromone are bound per molecule of ExpR dimer. In the absence of N-(3-oxo-hexanoyl)-homoserine lactone, ExpR prevents RNA polymerase access to the expR promoter, thereby directly repressing transcription initiation. The presence of pheromone renders the expR promoter accessible to RNA polymerase and results in the de-repression of transcription initiation. Overall we have established that there is a direct modulation of the repressive activity of a LuxR family regulator by a pheromone. Furthermore, site-directed mutagenesis experiments strongly suggest that the ExpR residues Leu-19, Tyr-31, and Ser-125 are involved in the transduction of conformational changes induced by ligand binding, and this provides new insights into the structure-function relationship of this bacterial regulator family.In Erwinia chrysanthemi production of pectic enzymes is controlled by a complex network involving several regulators. Among them is ExpR, the quorum-sensing regulatory protein. ExpR is a member of the LuxR family of transcriptional regulators, the activity of which is modulated by the binding of diffusible N-acylhomoserine lactone pheromones to the N-terminal receptor site of the proteins. Previous in vitro DNA-ExpR binding studies suggested that ExpR might activate pectic enzyme production and repress its cognate gene expression. This report presents genetic evidence that ExpR represses its own gene expression in the absence of pheromone and that the addition of pheromone promotes concentration-dependent de-repression. In vitro experiments show that (i) ExpR binds target DNA in the absence of pheromone and that the pheromone dissociates ExpR-DNA complexes, (ii) ExpR binds target DNA in a non-cooperative fashion, and (iii) two molecules of pheromone are bound per molecule of ExpR dimer. In the absence of N-(3-oxo-hexanoyl)-homoserine lactone, ExpR prevents RNA polymerase access to the expR promoter, thereby directly repressing transcription initiation. The presence of pheromone renders the expR promoter accessible to RNA polymerase and results in the de-repression of transcription initiation. Overall we have established that there is a direct modulation of the repressive activity of a LuxR family regulator by a pheromone. Furthermore, site-directed mutagenesis experiments strongly suggest that the ExpR residues Leu-19, Tyr-31, and Ser-125 are involved in the transduction of conformational changes induced by ligand binding, and this provides new insights into the structure-function relationship of this bacterial regulator family.

In Erwinia chrysanthemi, production of pectic enzymes is modulated by a complex network involving several regulators. One of them, PecS, which belongs to the MarR family, also controls the synthesis of various other virulence factors, such as cellulases and indigoidine. Here, the PecS consensus-binding site is defined by combining a systematic evolution of ligands by an exponential enrichment approach and mutational analyses. The consensus consists of a 23-base pair palindromic-like sequence (C(-11)G(-10)A(-9)N(-8)W(-7)T(-6)C(-5)G(-4)T(-3)A(-2))T(-1)A(0)T(1)(T(2)A(3)C(4)G(5)A(6)N(7)N(8)N(9)C(10)G(11)). Mutational experiments revealed that (i) the palindromic organization is required for the binding of PecS, (ii) the very conserved part of the consensus (-6 to 6) allows for a specific interaction with PecS, but the presence of the relatively degenerated bases located apart significantly increases PecS affinity, (iii) the four bases G, A, T, and C are required for efficient binding of PecS, and (iv) the presence of several binding sites on the same promoter increases the affinity of PecS. This consensus is detected in the regions involved in PecS binding on the previously characterized target genes. This variable consensus is in agreement with the observation that the members of the MarR family are able to bind various DNA targets as dimers by means of a winged helix DNA-binding motif. Binding of PecS on a promoter region containing the defined consensus results in a repression of gene transcription in vitro. Preliminary scanning of the E. chrysanthemi genome sequence with the consensus revealed the presence of strong PecS-binding sites in the intergenic region between fliE and fliFGHIJKLMNOPQR which encode proteins involved in the biogenesis of flagellum. Accordingly, PecS directly represses fliE expression. Thus, PecS seems to control the synthesis of virulence factors required for the key steps of plant infection.

Erwinia chrysanthemi 3937 secretes an arsenal of pectinolytic enzymes, including at least eight endo-pectate lyases encoded by pel genes, which play a major role in the soft-rot disease caused by this bacterium on various plants. E. chrysanthemi also produces some hydrolases that cleave pectin. Three adjacent hydrolase genes, pehV , pehW , and pehX, encoding exo-poly-α- d -galacturonosidases, have been characterized. These enzymes liberate digalacturonides from the nonreducing end of pectin. We report the identification of a novel gene, named pehN, encoding a protein homologous to the glycosyl hydrolases of family 28, which includes mainly polygalacturonases. PehN has a low hydrolase activity on polygalacturonate and on various pectins. PehN action favors the activity of the secreted endo-pectate lyases, mainly PelB and PelC, and that of the periplasmic exo-pectate lyase PelX. However, removal of the pehN gene does not significantly alter the virulence of E. chrysanthemi . Regulation of pehN transcription was analyzed by using gene fusions. Like other pectinase genes, pehN transcription is dependent on several environmental conditions. It is induced by pectic catabolic products and is affected by growth phase, catabolite repression, osmolarity, anaerobiosis, nitrogen starvation, and the presence of calcium ions. The transcription of pehN is modulated by the repressor KdgR, which controls almost all the steps of pectin catabolism, and by cyclic AMP receptor protein (CRP), the global activator of sugar catabolism. The regulator PecS, which represses the transcription of the pel genes but activates that of pehV , pehW , and pehX , also activates transcription of pehN . The three regulators KdgR, PecS, and CRP act by direct interaction with the pehN promoter region. The sequences involved in the binding of these three regulators and of RNA polymerase have been precisely defined. Analysis of the simultaneous binding of these proteins indicates that CRP and RNA polymerase bind cooperatively and that the binding of KdgR could prevent pehN transcription. In contrast, the activator effect of PecS is not linked to competition with KdgR or to cooperation with CRP or RNA polymerase. This effect probably results from competition between PecS and an unidentified repressor involved in peh regulation.

In the plant-pathogenic bacterium Erwinia chrysanthemi production of pectate lyases, the main virulence determinant, is modulated by a complex network involving several regulatory proteins. One of these regulators, PecS, also controls the synthesis of a blue pigment identified as indigoidine. Since production of this pigment is cryptic in the wild-type strain, E. chrysanthemi ind mutants deficient in indigoidine synthesis were isolated by screening a library of Tn 5 -B21 insertions in a pecS mutant. These ind mutations were localized close to the regulatory pecS-pecM locus, immediately downstream of pecM . Sequence analysis of this DNA region revealed three open reading frames, indA , indB , and indC , involved in indigoidine biosynthesis. No specific function could be assigned to IndA. In contrast, IndB displays similarity to various phosphatases involved in antibiotic synthesis and IndC reveals significant homology with many nonribosomal peptide synthetases (NRPS). The IndC product contains an adenylation domain showing the signature sequence DAWCFGLI for glutamine recognition and an oxidation domain similar to that found in various thiazole-forming NRPS. These data suggest that glutamine is the precursor of indigoidine. We assume that indigoidine results from the condensation of two glutamine molecules that have been previously cyclized by intramolecular amide bond formation and then dehydrogenated. Expression of ind genes is strongly derepressed in the pecS background, indicating that PecS is the main regulator of this secondary metabolite synthesis. DNA band shift assays support a model whereby the PecS protein represses indA and indC expression by binding to indA and indC promoter regions. The regulatory link, via pecS , between indigoidine and virulence factor production led us to explore a potential role of indigoidine in E. chrysanthemi pathogenicity. Mutants impaired in indigoidine production were unable to cause systemic invasion of potted Saintpaulia ionantha . Moreover, indigoidine production conferred an increased resistance to oxidative stress, indicating that indigoidine may protect the bacteria against the reactive oxygen species generated during the plant defense response.

Erwinia chrysanthemi is a broad host range phytopathogenic enterobacterium responsible for soft-rot disease of many plant species. The pecT gene encodes a repressor that negatively regulates the expression of virulence factors, such as pectinases, motility or exopolysaccharide synthesis. The cloned pecT gene was overexpressed using a phage T7 system. The purification of PecT involved the use of a TSK-heparin column and delivered the PecT protein that was purified to near homogeneity. The purified repressor displayed a 34 kDa apparent molecular mass. Gel-filtration experiments revealed that the PecT protein is a dimer. Band-shift assays demonstrated that the tetramer of the PecT protein could specifically bind in vitro to the regulatory regions of the pectate lyase genes with variable affinities. In addition, we demonstrated that PecT represses its own synthesis by interacting independently with two 200 bp regions, R1 and R2, located from −382 to −632 and −17 to −234, respectively, from the distal P1 promoter and from −465 to −715 and −100 to −317 from the P2 proximal promoter. We propose a model that explains the regulation exerted by PecT on its target genes and that integrates the phenotype obtained with a PecT overproducing pec-1 mutant or a pecT mutant.

International audience; The plant pathogen Erwinia chrysanthemi produces three acyl-homoserine lactones (acyl-HSLs). One has been identified as N-(3-oxohexanoyl)-homoserine lactone (OHHL), and the two others were supposed to be N-(hexanoyl)-homoserine lactone (HHL) and N-(decanoyl)-homoserine lactone (DHL). The genes for a quorum-sensing signal generator (expI ) and a response regulator (expR ) were cloned. These genes are convergently transcribed and display high similarity to the expI-expR genes of Erwinia carotovora. ExpI is responsible for both OHHL and HHL production. Inactivation of expI had little effect on pectinase synthesis in E. chrysanthemi, as expression of only two of the pectate lyase genes, pelA and pelB, was decreased. E. chrysanthemi expR mutants still produced acyl-HSL and pectinases. However, gel shift and DNAse I footprinting experiments showed that the purified E. chrysanthemi ExpR protein binds specifically to the promoter regions of the five major pel genes. Addition of OHHL modified the ExpR-DNA bandshift profiles, indicating that ExpR interacts with OHHL and binds to DNA in different ways, depending on the OHHL concentration. Localization of the ExpR binding sites just upstream of promoter regions suggests that ExpR functions as an activator of pel expression in the presence of OHHL. The absence of a phenotype in expR mutants strongly suggests that at least an additional interchangeable ExpR homologue exists in E. chrysanthemi. Finally, transcription of expI ::uidA and expR ::uidA fusions is dependent on the population density, suggesting the existence of a quorum-sensing hierarchy in E. chrysanthemi. These results suggest that the expI-expR locus is part of a complex autoregulatory system that controls quorum sensing in E. chrysanthemi.

The pecS regulatory locus is responsible for the down-expression of many virulence genes in Erwinia chrysanthemi. This locus consists of two genes, pecS and pecM, divergently transcribed. Genetic evidence indicates that the PecM protein modulates the regulatory activity of PecS. Purification and characterization of PecS, expressed either from E. coli, from the wild-type E. chrysanthemi strain or from a pecM mutant, showed that the PecS protein produced in these three genetic backgrounds displays the same biochemical properties. Band-shift assay analysis with the three PecS isoforms confirmed the involvement of the PecM protein in modulating the PecS DNA-binding capacity. Moreover, determination of the Kdapp for operator regions of the PecS protein, produced either by the wild-type E. chrysanthemi or by E. coli, reveals similar affinities. Thus, in E. coli, there is likely to be at least one other PecM-like protein able to cross-react with the E. chrysanthemi PecS protein.

The main virulence factors of the phytopathogenic bacteria Erwinia chrysanthemi are pectinases that cleave pectin, a major constituent of the plant cell wall. The cyclic AMP receptor protein (CRP) was identified as the main activator of the pectinolysis genes. Gel shift and DNase I footprinting experiments showed that the purified E. chrysanthemi CRP protein binds specifically to the promoter regions of seven pectinolysis genes (pelB, pelC, pelD, pelE, ogl, kduI and kdgT) whose expression is positively regulated in vivo by CRP. In contrast, no interaction was observed between CRP and the promoter-operator region of pelA, whose expression is negatively regulated in vivo by CRP. Primer extension experiments demonstrated that each of the pelB, pelC, pelE and kduI genes is expressed from a unique sigma70 promoter, whereas ogl and kdgT possess three and two functional promoters respectively. The position of the CRP binding site relative to the transcription start site suggests that CRP acts as a primary activator at the pelB (via the CRP binding site 1), pelC, pelE, pelD, kdgTP1 and oglP2 promoters. In contrast, transcription at the kduI, oglP1 promoters seems to require another transcriptional activator in synergy with CRP. Investigation of the simultaneous binding of CRP and KdgR, the main repressor of pectinolysis genes, to the regulatory regions of pelB, pelC, pelD, pelE, ogl, kduI and kdgT genes showed that binding of KdgR is preferential and exclusive in the case of ogl and kdgT, whereas the binding of these two regulators is independent in the case of pelB, pelC, pelD, pelE and kduI. Taken together, our data suggest that the antagonistic effects of CRP and KdgR on the expression of the pectinolysis genes occur by different mechanisms, including direct competition between the two regulators or between the repressor and RNA polymerase for the occupation of a common DNA region on the target genes.

The main virulence factors of the phytopathogenic bacterium Erwinia chrysanthemi are pectinases that cleave pectin, a major constituent of the plant cell wall. Although physiological studies suggested that pectinase production in Erwinia species is subjected to catabolite repression, the direct implication of the cyclic AMP receptor protein (CRP) in this regulation has never been demonstrated. To investigate the role of CRP in pectin catabolism, we cloned the E. chrysanthemi crp gene by complementation of an Escherichia coli crp mutation and then constructed E. chrysanthemi crp mutants by reverse genetics. The carbohydrate fermentation phenotype of the E. chrysanthemi crp mutants is similar to that of an E. coli crp mutant. Furthermore, these mutants are unable to grow on pectin or polygalacturonate as the sole carbon source. Analysis of the nucleotide sequence of the E. chrysanthemi crp gene revealed the presence of a 630-bp open reading frame (ORF) that codes for a protein highly similar to the CRP of E. coli. Using a crp::uidA transcriptional fusion, we demonstrated that the E. chrysanthemi CRP represses its own expression, probably via a mechanism similar to that described for the E. coli crp gene. Moreover, in the E. chrysanthemi crp mutants, expression of pectinase genes (pemA, pelB, pelC, pelD, and pelE) and of genes of the intracellular part of the pectin degradation pathway (ogl, kduI, and kdgT), which are important for inducer formation and transport, is dramatically reduced in induced conditions. In contrast, expression of pelA, which encodes a pectate lyase important for E. chrysanthemi pathogenicity, seems to be negatively regulated by CRP. The E. chrysanthemi crp mutants have greatly decreased maceration capacity in potato tubers, chicory leaves, and celery petioles as well as highly diminished virulence on saintpaulia plants. These findings demonstrate that CRP plays a crucial role in expression of the pectinolysis genes and in the pathogenicity of E. chrysanthemi.

Erwinia chrysanthemi is an enterobacterium that causes various plant diseases. Its pathogenicity results from the secretion of pectinolytic enzymes responsible for the disorganization of the plant cell wall. The E. chrysanthemi strain 3937 produces two pectin methylesterases, at least seven pectate lyases, a polygalacturonase, and a pectin lyase. The extracellular degradation of the pectin leads to the formation of oligogalacturonides that are catabolized through an intracellular pathway. The pectinase genes are expressed from independent cistrons, and their transcription is favored by environmental conditions such as presence of pectin and plant extracts, stationary growth phase, low temperature, oxygen or iron limitation, and so on. Moreover, transcription of the pectin lyase gene responds to DNA-damaging agents. The differential expressions of individual pectinase genes presumably reflect their role during plant infection. The regulation of pel genes requires several regulatory systems, including the KdgR repressor, which mediates the induction of all the pectinolysis genes in the presence of pectin catabolites. KdgR also controls the genes necessary for pectinase secretion and other pectin-inducible genes not yet characterized. PecS, a cytoplasmic protein homologous to other transcriptional regulators, can bind in vitro to the regulatory regions of pectinase and cellulase genes. The PecT protein, a member of the LysR family of transcriptional regulators, represses the expression of some pectinase genes and also affects other metabolic pathways of the bacteria. Other proteins involved in global regulations, such as CRP or HNS, can bind to the regulatory regions of the pectinase genes and affect their transcription.

Summary The Erwinia chrysanthemi pecS gene encodes a repressor that negatively regulates the expression of virulence factors such as pectinases or cellulases. The cloned pecS gene was overexpressed using a phage T7 system. The purification of PecS involved DEAE-anion exchange and TSK-heparin columns and delivered the PecS protein that was purified to homogeneity. The purified repressor displayed an 18 kDa apparent molecular mass and an isoelectric point near to neutrality (PI = 6.5). Gel-filtration experiments revealed that the PecS protein is a dimer. Bandshift assays demonstrated that the PecS protein could specifically bind in vitro to the regulatory sites of the in vivo PecS-regulated genes. The interaction between the PecS protein and its DNA-binding site was characterized by a relatively low affinity (about 10−8 M). DNase I footprintings revealed short protected sequences only with the most in vivo PecS-regulated genes. Alignment of these PecS-binding sites did not show a well-conserved consensus sequence. lmmunoblotting demonstrated that the copy number of the PecS protein was approximately 50 dimers per cell. The low affinity of the PecS repressor for its DNA targets and the low cellular PecS content suggest the existence of E. chrysanthemi-specific factors able to potentiate PecS protein activity in vivo.

Erwinia chrysanthemi synthesizes and secretes a large number of pectinases. The major pectinases include a pectin methylesterase PemA and five isoenzymes of endo-pectate lyases PelA, PelB, PelC, PelD and PelE. In addition, secondary pectinases were identified: a pectin methylesterase PemB, two endopectate lyases PelL and PelZ, an exo-pectate lyase PelX and an exopolygalacturonase, PehX. The regulation of pectinase synthesis is very complex and dependent on many environmental conditions. It is induced by pectin catabolic products and affected by growth phase, catabolite repression, osmolarity, iron or oxygen starvation… Three regulators were identified by genetic analysis. The main repressor, KdgR, controls the transcription of pectinase genes, the intracellular catabolic pathway and the secretion machinery. The PecS repressor controls the production of pectate lyases and cellulases, the secretion machinery and the biosynthesis of a blue pigment. PecT acts as a repressor of the production of some pectate lyases. Other proteins are involved in the regulation of pectinase synthesis but their role is not well characterized.

The Erwinia chrysanthemi kdgR gene encodes a repressor that negatively regulates the expression of genes involved in pectinolysis and in pectinase secretion. The cloned kdgR gene was overexpressed in Escherichia coli by using a phage T7 system. Overproduced repressor was purified to homogeneity by two chromatographic steps. Gel retardation and DNase I protection experiments demonstrated the specific binding of the KdgR protein to the operators of pectinase genes (pelA, pelB, pelC, pelE), to the operator of genes involved in pectin catabolism (kdgT, ogl, kduI-kdgF) and to that of the outT gene involved in pectinase secretion. These interactions involved one (pelA, pelB, kduI-kdgF, outT) or several operator sites (pelC, pelE, ogl, kdgT) that generally overlap the promoter. Despite the presence of potential KdgR binding sites (KdgR-box) in the regulatory regions of four genes involved in pectin catabolism (kdgC, kduD, pem, kdgA) and in a pectinase secretion gene outC, no DNA-repressor complex could be observed by in vitro experiments. By using a missing contact experiment on the coding strand of ogl and pelE regulatory regions, a new KdgR-binding consensus was proposed. This new consensus, constituted by two half motifs (AATGAAAACT)N(NTCGATTTCTA), is well conserved in the operators which interact in vitro with the KdgR repressor. In contrast, this repressor-recognized motif is degenerated in the other operators that cannot interact in vitro with the repressor. These results suggest the existence of different regulation mechanisms mediated by the KdgR protein for the two classes of operators.

Pectate lyases (PL) initiate soft-rot diseases in plants by cleaving pectin which is the major component of the plant cell wall. The present paper reports the first cloning and characterization of a pectate lyase (pel) gene from the Bacillus genus. This gene was isolated from a Bacillus subtilis genomic library constructed in pUC18 as vector and Escherichia coli as host. By Southern hybridization this gene was shown to be present in a single copy in the B. subtilis genome. The nucleotide sequence of a 1.6 kb-pair HindIII restriction fragment, which confers pectate lyase activity to E. coli, indicated a 1,260 bp open reading frame encoding a 420 amino acid polypeptide which includes a 21 amino acid signal sequence. The 45,605 Da deduced protein displays homologies to PLs from Erwinia chrysanthemi. The B. subtilis PL cloned in E.coli was located in the periplasm. It was purified to homogeneity in a one-step procedure from the E. coli periplasmic fluid after overproduction using the pT7 system. Biochemical properties of the purified enzyme were similar to those found for the PL isolated from B. subtilis extracellular media.

The phytopathogenicity of the enterobacterium Erwinia chrysanthemi chiefly results from its capacity to degrade pectin, which is the major component of plant cell walls. This degradation requires the product of 12 genes which constitute independent transcriptional units. All these genes, including kdgT which encodes the 2-keto-3-deoxygluconate (KDG) transport system, are negatively regulated by the KdgR protein. The E. chrysanthemi kdgR gene was cloned into an expression vector and overexpressed in Escherichia coli. KdgR was then purified to homogeneity by two chromatographic steps as a dimer of approximately 62 kDa. Using gel retardation assays, we demonstrated that this purified repressor binds to the 25bp oligonucleotide (AAAAAAGAAACATTGTTTCATTTGT) present in the kdgT regulatory region. Dimethyl sulphate interference experiments revealed that the repressor interacts with four guanine bases and 10 adenine bases in the two strands of this KdgR box. KDG, an actual inducer of pectinolysis, releases the repressor from the operator complexes, whereas galacturonate, which is the precursor of the actual inducer, does not. These results suggest the existence of a specific interaction between KDG and KdgR protein. This study opens discussion on the relative affinity of the KdgR protein for the different operators of pectinolysis genes which are interpreted in terms of differential regulation.