Search

Iron (Fe) and zinc (Zn) are essential micronutrients needed by virtually all living organisms, including plants and humans, for proper growth and development. Due to its capacity to easily exchange electrons, Fe is important for electron transport in mitochondria and chloroplasts. Fe is also necessary for chlorophyll synthesis. Zn is a cofactor for several proteins, including Zn-finger transcription factors and redox metabolism enzymes such as copper/Zn superoxide dismutases. In humans, Fe participates in oxygen transport, electron transport, and cell division whereas Zn is involved in nucleic acid metabolism, apoptosis, immunity, and reproduction. Rice (Oryza sativa L.) is one of the major staple food crops, feeding over half of the world’s population. However, Fe and Zn concentrations are low in rice grains, especially in the endosperm, which is consumed as white rice. Populations relying heavily on rice and other cereals are prone to Fe and Zn deficiency. One of the most cost-effective solutions to this problem is biofortification, which increases the nutritional value of crops, mainly in their edible organs, without yield reductions. In recent years, several approaches were applied to enhance the accumulation of Fe and Zn in rice seeds, especially in the endosperm. Here, we summarize these attempts involving transgenics and mutant lines, which resulted in Fe and/or Zn biofortification in rice grains. We review rice plant manipulations using ferritin genes, metal transporters, changes in the nicotianamine/phytosiderophore pathway (including biosynthetic genes and transporters), regulators of Fe deficiency responses, and other mutants/overexpressing lines used in gene characterization that resulted in Fe/Zn concentration changes in seeds. This review also discusses research gaps and proposes possible future directions that could be important to increase the concentration and bioavailability of Fe and Zn in rice seeds without the accumulation of deleterious elements. We also emphasize the need for a better understanding of metal homeostasis in rice, the importance of evaluating yield components of plants containing transgenes/mutations under field conditions, and the potential of identifying genes that can be manipulated by gene editing and other nontransgenic approaches.

Breeding crops with delayed senescence could plausibly increase grain yield. Here the authors show that variation at the rice SGR locus contributes to differences in senescence between indica and japonica subspecies and show that introgression can increase yield in an elite indica rice variety.

Abstract Flag leaves (FL) and second leaves (SL) in rice show differential aging patterns during monocarpic senescence. Coordination of aging programs between FL and SL is important for grain yield and quality. However, the molecular bases for differential aging programs between FL and SL have not been systematically explored in rice. Here, we performed mRNA-sequencing of FL and SL at six time points during grain-filling and identified four molecular bases for differential aging programs between FL and SL: phenylpropanoid biosynthesis, photosynthesis, amino acid (AA) transport, and hormone response. Of them, photosynthesis (carbon assimilation) and AA transport (nitrogen remobilization) predominantly occurred in FL and SL, respectively, during grain-filling. Unlike other molecular bases, AA transport showed consistent differential expression patterns between FL and SL in independent samples. Moreover, long-distance AA transporters showed invariant differential expression patterns between FL and SL after panicle removal, which was consistent to invariant differential nitrogen contents between FL and SL after panicle removal. Therefore, our results suggest that the supplies of carbon and nitrogen to seeds is functionally segregated between FL and SL and that long-distance AA transport is an invariant core program for high nitrogen remobilization in SL.

Rice (Oryza sativa L.) is a daily staple food crop for more than half of the global population and improving productivity is an important task to meet future demands of the expanding world population. The application of nitrogen (N) fertilization improved rice growth and productivity in the world, but excess use causes environmental and economic issues. One of the main goals of rice breeding is reducing N fertilization while maintaining productivity. Therefore, enhancing rice nitrogen use efficiency (NUE) is essential for the development of sustainable agriculture and has become urgently needed. Many studies have been conducted on the main steps in the use of N including uptake and transport, reduction and assimilation, and translocation and remobilization, and on transcription factors regulating N metabolism. Understanding of these complex processes provides a base for the development of novel strategies to improve NUE for rice productivity under varying N conditions.

Internode elongation is one of the key agronomic traits determining a plant’s height and biomass. However, our understanding of the molecular mechanisms controlling internode elongation is still limited in crop plant species. Here, we report the functional identification of an atypical basic helix-loop-helix transcription factor (OsbHLH073) through gain-of-function studies using overexpression (OsbHLH073-OX) and activation tagging (osbhlh073-D) lines of rice. The expression of OsbHLH073 was significantly increased in the osbhlh073-D line. The phenotype of osbhlh073-D showed semi-dwarfism due to deficient elongation of the first internode and poor panicle exsertion. Transgenic lines overexpressing OsbHLH073 confirmed the phenotype of the osbhlh073-D line. Exogenous gibberellic acid (GA3) treatment recovered the semi-dwarf phenotype of osbhlh073-D plants at the seedling stage. In addition, quantitative expression analysis of genes involving in GA biosynthetic and signaling pathway revealed that the transcripts of rice ent-kaurene oxidases 1 and 2 (OsKO1 and OsKO2) encoding the GA biosynthetic enzyme were significantly downregulated in osbhlh073-D and OsbHLH073-OX lines. Yeast two-hybrid and localization assays showed that the OsbHLH073 protein is a nuclear localized-transcriptional activator. We report that OsbHLH073 participates in regulating plant height, internode elongation, and panicle exsertion by regulating GA biosynthesis associated with the OsKO1 and OsKO2 genes.

Iron (Fe) and zinc (Zn) are essential micronutrients required for proper development in both humans and plants. Rice (Oryza sativa L.) grains are the staple food for nearly half of the world’s population, but a poor source of metals such as Fe and Zn. Populations that rely on milled cereals are especially prone to Fe and Zn deficiencies, the most prevalent nutritional deficiencies in humans. Biofortification is a cost-effective solution for improvement of the nutritional quality of crops. However, a better understanding of the mechanisms underlying grain accumulation of mineral nutrients is required before this approach can achieve its full potential. Characterization of gene function is more time-consuming in crops than in model species such as Arabidopsis thaliana. Aiming to more quickly characterize rice genes related to metal homeostasis, we applied the concept of high throughput elemental profiling (ionomics) to Arabidopsis lines heterologously expressing rice cDNAs driven by the 35S promoter, named FOX (Full Length Over-eXpressor) lines. We screened lines expressing candidate genes that could be used in the development of biofortified grain. Among the most promising candidates, we identified two lines ovexpressing the metal cation transporter OsZIP7. OsZIP7 expression in Arabidopsis resulted in a 25% increase in shoot Zn concentrations compared to non-transformed plants. We further characterized OsZIP7 and showed that it is localized to the plasma membrane and is able to complement Zn transport defective (but not Fe defective) yeast mutants. Interestingly, we showed that OsZIP7 does not transport Cd, which is commonly transported by ZIP proteins. Importantly, OsZIP7-expressing lines have increased Zn concentrations in their seeds. Our results indicate that OsZIP7 is a good candidate for developing Zn biofortified rice. Moreover, we showed the use of heterologous expression of genes from crops in A. thaliana as a fast method for characterization of crop genes related to the ionome and potentially useful in biofortification strategies.

Zinc (Zn) is essential for normal plant growth and development. The Zn-regulated transporter, ironregulated transporter (IRT)-like protein (ZIP) family members are involved in Zn transport and cellular Zn homeostasis throughout the domains of life. In this study, we have characterized four ZIP transporters from Arabidopsis thaliana (IRT3, ZIP4, ZIP6, and ZIP9) to better understand their functional roles. The four ZIP proteins can restore the growth defect of a yeast Zn uptake mutant and are upregulated under Zn deficiency. Single and double mutants show no phenotypes under Zn-sufficient or Zn-limited growth conditions. In contrast, triple and quadruple mutants show impaired growth irrespective of external Zn supply due to reduced Zn translocation from root to shoot. All four ZIP genes are highly expressed during seed development, and siliques from all single and higher-order mutants exhibited an increased number of abnormal seeds and decreased Zn levels in mature seeds relative to wild type. The seed phenotypes could be reversed by supplementing the soil with Zn. Our data demonstrate that IRT3, ZIP4, ZIP6, and ZIP9 function redundantly in maintaining Zn homeostasis and seed development in A. thaliana. [ABSTRACT FROM AUTHOR]

Zinc is essential for normal plant growth and development. To understand its transport in rice, we characterized OsZIP5, which is inducible under Zn deficiency. OsZIP5 complemented the growth defect of a yeast Zn-uptake mutant, indicating that OsZIP5 is a Zn transporter. The OsZIP5-GFP fusion protein was localized to the plasma membrane. Transgenic plants overexpressing the gene grew less well. Overexpression of the gene decreased the Zn concentration in shoots, but caused it to rise in the roots. Knockout plants showed no visible phenotypic changes under either normal or deficient conditions. However, they were tolerant to excess Zn and contained less Zn. In contrast, overexpressing transgenics were sensitive to excess Zn. These results indicate that OsZIP5 plays a role in Zn distribution within rice. [ABSTRACT FROM AUTHOR]

OsMADSI is a rice MADS box gene necessary for floral development. To identify the key c/s-regulatory regions for its expression, we utilized transgenic rice plants expressing GUS fusion constructs. Histochemical analysis revealed that the 5.7-kb OsMADSI intragenic sequences, encompassing exon 1, intron 1, and a part of exon 2, together with the 1.9-kb 5' upstream promoter region, are required for the GUS expression pattern that coincides with flower-preferential expression of OsMADSI. In contrast, the 5' upstream promoter sequence lacking this intragenic region caused ectopic expression of the reporter gene in both vegetative and reproductive tissues. Notably, incorporation of the intragenic region into the CaMV35S promoter directed the GUS expression pattern similar to that of the endogenous spatial expression of OsMADSI in flowers. In addition, our transient gene expression assay revealed that the large first intron following the CaMV35S minimal promoter enhances flower-preferential expression of GUS. These results suggest that the OsMADSI intragenic sequence, largely intron 1, contains a key regulatory region(s) essential for expression. [ABSTRACT FROM AUTHOR]

P1B-type heavy-metal ATPases (HMAs) are transmembrane metal-transporting proteins that play a key role in metal homeo- stasis. Despite their importance, very little is known about their functions in monocot species. We report the characterization of rice (Oryza sativa) OsHMA9, a member of the P1B-type ATPase family. Semiquantitative reverse transcription-polymerase chain reaction analyses of seedlings showed that OsHMA9 expression was induced by a high concentration of copper (Cu), zinc (Zn), and cadmium. We also determined, through promoter: : β-glucuronidase analysis, that the main expression was in the vascular bundles and anthers. The OsHMA9:green fluorescence protein fusion was localized to the plasma membrane. Heterologous expression of OsHMA9 partially rescued the Cu sensitivity of the Escherichia co/i copA mutant, which is defective in Cu-transporting ATPases. It did not rescue the Zn sensitivity of the zntA mutant, which is defective in Zn-transporting ATPase. To further elucidate the functional roles of OsHMA9, we isolated two independent null alleles, oshma9-1 and oshma9-2, from the T-DNA insertion population. Mutant plants exhibited the phenotype of increased sensitivity to elevated levels of Cu, Zn, and lead. These results support a role for OsHMA9 in Cu, Zn, and lead efflux from the cells. This article is the first report on the functional characterization of a P1B-type metal efflux transporter in monocots. [ABSTRACT FROM AUTHOR]

Abstract   Arabidopsis harbors two α and two β genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFPα genes were analyzed using transgenic plants containing a promoter::-glucuronidase (GUS) fusion construct. Whereas the AtPFPα1 promoter was found to be ubiquitously active in all tissues, the AtPFPα2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFPα2 promoter identified a key regulatory element from nucleotides −194 to −175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPα2 and which is essential for AtPFPα2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a −46 CaMV35S minimal promoter, we also demonstrate that PFPα2 is sufficient for normal AtPFPα2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFPα2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes. [ABSTRACT FROM AUTHOR]

Abstract T-DNA and transposable elements e.g., Ds and Tos17, are used to generate a large number of insertional mutant lines in rice. Some carry the GUS or GFP reporter for gene trap or enhancer trap. These reporter systems are valuable for identifying tissue- or organ-preferential genes. Activation tagging lines have also been generated for screening mutants and isolating mutagenized genes. To utilize these resources more efficiently, tagged lines have been produced for reverse genetic approaches. DNA pools of the T-DNA tagged lines and Tos17 lines have been prepared for PCR screening of insertional mutants in a given gene. Tag end sequences (TES) of the inserts have also been produced. TES databases are beneficial for analyzing the function of a large number of rice genes. [ABSTRACT FROM AUTHOR]

Abstract Chlorophyll b is synthesized from chlorophyll a by chlorophyll a oxygenase. We have identified two genes (OsCAO1 and OsCAO2) from the rice genome that are highly homologous to previously studied chlorophyll a oxygenase (CAO) genes. They are positioned in tandem, probably resulting from recent gene duplications. The proteins they encode contain two conserved functional motifs the Rieske Fesulfur coordinating center and a non-heme mononuclear Fe-binding site. OsCAO1 is induced by light and is preferentially expressed in photosynthetic tissues. Its mRNA level decreases when plants are grown in the dark. In contrast, OsCAO2 mRNA levels are higher under dark conditions, and its expression is down-regulated by exposure to light. To elucidate the physiological function of the CAO genes, we have isolated knockout mutant lines tagged by T-DNA or Tos17. Mutant plants containing a T-DNA insertion in the first intron of the OsCAO1 gene have pale green leaves, indicating chlorophyll b deficiency. We have also isolated a pale green mutant with a Tos17 insertion in that OsCAO1 gene. In contrast, OsCAO2 knockout mutant leaves do not differ significantly from the wild type. These results suggest that OsCAO1 plays a major role in chlorophyll b biosynthesis, and that OsCAO2 may function in the dark. [ABSTRACT FROM AUTHOR]

We used a transgenic approach and yeast two-hybrid experiments to study the role of the rice ( Oryza sativa L.) B-function MADS-box gene, OsMADS16. Transgenic rice plants were generated that ectopically expressed OsMADS16 under the control of the maize ( Zea mays L.) ubiquitin1 promoter. Microscopic observations revealed that the innermost-whorl carpels had been replaced by stamen-like organs, which resembled the flowers of the previously described Arabidopsis thaliana (L.) Heynh. mutation superman as well as those ectopically expressing the AP3 gene. These results indicate that expression of OsMADS16 in the innermost whorl induces stamen development. Occasionally, carpels had completely disappeared. In addition, ectopic expression of OsMADS16 enhanced expression of OsMADS4, another B-function gene, causing superman phenotypes. In the yeast two-hybrid system, OsMADS16 did not form a homodimer but, rather, the protein interacted with OsMADS4. OsMADS16 also interacted with OsMADS6 and OSMADS8, both of which are homologous to SEPALLATA proteins required for the proper function of class-B and class-C genes in Arabidopsis. Based on the gene expression pattern and our yeast two-hybrid data, we discuss a quartet model of MADS-domain protein interactions in the lodicule and stamen whorls of rice florets. [ABSTRACT FROM AUTHOR]

Examines the T-DNA insertional mutagenesis for functional genomics in rice. Production of primary transgenic rice plants; Use of a binary vector in the insertion; Detection of a gene fusion between β-glucuronidase and an endogenous gene.

Rice blast, caused by the fungus Magnaporthe olyzae, is one of the most devastating diseases of rice. To understand the molecular basis of Pi5-mediated resistance to M. oryzae, we cloned the resistance (R) gene at this locus using a map-based cloning strategy. Genetic and phenotypic analyses of 2014 F2 progeny from a mapping population derived from a cross between IR50, a susceptible rice cultivar, and the RIL260 line carrying Pi5 enabled us to narrow down the Pi5 locus to a 130-kb interval. Sequence analysis of this genomic region identified two candidate genes, Pi5-1 and Pi5-2, which encode proteins carrying three motifs characteristic of Rgenes: an N-terminal coiled-coil (CC) motif, a nucleotide-binding (NB) domain, and a leucine-rich repeat (LRR) motif. In genetic transformation experiments of a susceptible rice cultivar, neither the Pi5-J nor the Pi5-2 gene was, found to confer resistance to M. oryzae. In contrast, transgenic rice plants expressing both of these genes, generated by crossing transgenic lines carrying each gene individually, conferred Pi5-mediated resistance to M. oryzae. Gene expression analysis revealed that Pi5-1 transcripts accumulate after pathogen challenge, whereas the Pi5-2 gene is constitutively expressed. These results indicate that the presence of these two genes is required for rice Pi5-mediated resistance to M. oryzae. [ABSTRACT FROM AUTHOR]

As a first step towards identifying genes involving in the signal transduction pathways mediating rice blast resistance, we isolated 3 mutants lines that showed enhanced susceptibility to rice blast KJ105 (91-033) from a T-DNA insertion library of the japonica rice cultivar, Hwayeong. Since none of the susceptible phenotypes co-segregated with the T-DNA insertion we adapted a map-based cloning strategy to isolate the gene(s) responsible for the enhanced susceptibility of the Hwayeong mutants. A genetic mapping population was produced by crossing the resistant wild type Hwayeong with the susceptible cultivar, Nagdong. Chisquare analysis of the F2 segregating population indicated that resistance in Hwayeong was controlled by a single major gene that we tentatively named Pi-hy. Randomly selected susceptible plants in the F2 population were used to build an initial map of Pi-hy. The SSLP marker RM2265 on chromosome 2 was closely linked to resistance. High resolution mapping using 105 F2 plants revealed that the resistance gene was tightly linked, or identical, to Pib, a resistance gene with a nucleotide binding sequence and leucine-rich repeats (NB-LRR) previously isolated. Sequence analysis of the Pib locus amplified from three susceptible mutants revealed lesions within this gene, demonstrating that the Pi-hy gene is Pib. The Pib mutations in 1D- 22-10-13, 1D-54-16-8, and 1C-143-16-1 were, respectively, a missense mutation in the conserved NB domain 3, a nonsense mutation in the 5th LRR, and a nonsense mutation in the C terminus following the LRRs that causes a small deletion of the C terminus. These findings provide evidence that NB domain 3 and the C terminus are required for full activity of the plant R gene. They also suggest that alterations of the resistance gene can cause major differences in pathogen specificity by affecting interactions with an avirulence factor. [ABSTRACT FROM AUTHOR]