Search

Objective: Meatballs are a popular meat-based food consumed widely in Indonesian society. However, the issue of unethical substitution of halal meatballs with non-halal meats, particularly pork and canine meat (CM), has emerged. The existence of non-halal meats, including CM, in food products is prohibited in Islam, necessitating the development of reliable analytical techniques for their identification. In this study, we designed species-specific primers (SSPs) targeting the D-loop region of mitochondrial DNA for CM meatball product identification. Materials and Methods: The study was commenced by creating specific primers for canine DNA using Integrated DNA Technologies software and subsequently performing DNA isolation. The designed primers were then subjected to comprehensive evaluation using RT-PCR, including spec¬ification, linearity, limit of detection, efficiency, and repeatability. Results: The results indicated that the primer D-Loop 443 (forward: 5¢-GGG ACA TCT CGA TGG ACTA ATG-3', reverse: 5'-GCG GTC ATA GAT GAG TGA TAG C-3') designed and validated in silico using primer-basic local alignment search tool nucleotide (BLAST) program from NCBI accurately identified canine DNA when the optimal annealing temperature was set at 57.5oC. The real-time PCR technique utilizing the D-loop 443 primer exhibited the ability to amplify canine DNA down to a minimum quantity of 100 pg, with an efficiency value of 91.8%, a correlation coefficient (R) of 0.990, and a precision value (RSD) of 0.30%. Conclusion: The SSP-based RT-PCR method developed is a versatile and efficient tool for detect¬ing CM in meatballs. Its implementation helps maintain consumer trust and addresses concerns regarding the substitution of halal meats with non-halal alternatives. [J Adv Vet Anim Res 2024; 11(2.000): 247-258]

Macaque monkey (Macaca fascicularis) meat (MM) has been reported to be consumed as meatball and soup products in Indonesia. MM is not allowed to be traded in Indonesia and is considered not halal meat; therefore, MM is not allowed to be consumed by Muslim communities. In this study, species-specific primer (SSP) targeting on mitochondrial displacement (D-loop) region coupled with real-time PCR assay was used to identify monkey meat in beef meatballs. The PCR product was also subjected to sequencing in order to ensure the adulteration practice of MM in beef meatballs. The primers were designed and subjected to in silico specificity test using BLAST. The used primers were: forward: 5’-TGACTCCCACCACATCCC-3’ and reverse: 5’-GTGTGGAGCTAGAATATTGAACCG-3’. Real-time PCR assay using SSP targeting on mt-D-loop primers was capable of identifying MM in meatball products, specifically with a detection limit of 0.0078 ng corresponding to 1% MM in beef meatballs. The developed method can be proposed as the standard method for detecting MM in food products intended for halal authentication analysis, provided that DNAs are available in food products.

Companies facing financial crises tend to manipulate reported earnings in unfavorable markets. Earnings management is an effort to manage earnings by managers to meet the expected profit level to obtain personal gain. The Covid-19 pandemic has caused the government to issue various tax incentives that individuals and companies can utilize. Under these conditions, management as an internal party can manage earnings to meet its expectations. This study examines differences in earnings management before and during the Covid-19 pandemic and the effect of earnings management on tax aggressiveness. The data from this study are the financial statements of manufacturing companies listed on the Indonesia Stock Exchange. The sampling method is purposive sampling. The analytical method used is the comparative test and multiple regression analysis. The results of this study are the same in the level of tax avoidance, accrual earnings management, and actual management before and during the Covid-19 pandemic. This study also concludes that real earnings management negatively affects tax aggressiveness, while accrual earnings management does not. This research indicates that the government needs to increase supervision and control over the possible tax avoidance that companies can carry out. While accrual earnings management does not. This research indicates that the government needs to increase supervision and control over the possible tax avoidance that companies can carry out. While accrual earnings management does not. This research indicates that the government needs to increase supervision and control over the possible tax avoidance that companies can carry out.

Building loyalty is no longer an option in the banking world. In recent years a trend has emerged, namely the tendency for customers to have more than one savings account at different banks. One of the ways to do this is by marketing service quality and marketing mix to customer satisfaction. The Bank's compliance with government policies to prevent the spread of COVID-19 is the Work From Home policy. Banking measures to optimize employee efforts to maintain the health of their closest people at home while providing maximum protection from the potential for contracting COVID-19 while interacting with the community while working or traveling to and from the office, namely adjustments to work systems. The role of marketing in banking is to build strong relationships sustainably by providing excellent service for the development of service quality such as Servqual, with Tangible, Responsiveness, Reliability, Assurance, and Empathy characteristics. New service quality that can be applied in the banking world in particular. The most important thing is Banking Service Quality (BSQ.) Like conventional bank service products, the bank's low rating. Testing using the PLS (Partial Least Square) analysis method. The results showed that customer satisfaction has a positive and significant effect on customer loyalty. Customer satisfaction affects the reliability, effectiveness, and assurance of the service portfolio, price, and access. Tangible must receive extra attention so that customer satisfaction can increase.

Kopaja.id as online learning had developed in 2019, and KOPAJA is an acronym for “Kompas Pajak Ajaib” which means magically direct taxes. It is also expected to provide a fun learning for students. This research is to provide an online fun learning to students who want to learn tax anytime and anywhere. This research is follow-up research using the research and development (RD) method to reach the Technology Readiness Level (TRL) for applied research. The development of an application system has been carried out based on a website with the address https://kopaja.id which can be accessed and used for learning from taxation courses. User testing with the Perceived Usability Website instrument was developed by Wang and Senecal. The research sample is from 55 students of DIV Public Sector Accounting, Department of Economics and Business, Vocational College, Universitas Gadjah Mada. The test results show that the website system is functioning correctly, and user ratings show that the website has easy navigation, speed of access, and is comfortable to explore. However, interaction with users is still not optimal. The result of self-measurement on the achievement of Technology Readiness Level reaches TRL 6 in 1- 9 scale.

The research aims to analyse the antioxidant, anti-tyrosinase and anti-wrinkle activities from grapefruit (Citrus Maxima L) and strawberry extracts. Samples were extracted by maceration using 96% ethanol and ethyl acetate, subsequently. The Ferric Reducing Antioxidant Power (FRAP) and β-carotene bleaching (BCB) were used to measure the antioxidant activity. The effect of anti-wrinkle was determined by testing the inhibition of elastase and collagenase enzyme, while anti-tyrosinase activity was analysed using mushroom tyrosinase enzyme. The results showed that strawberry extracts in ethanolic (SE) and ethyl acetate (SEA) have antioxidant activity in FRAP (EC50 = 404.39 ± 3.27 µg / mL and 1978.65 ± 37.25 µg/mL) and BCB (IC50 = 292.30 ± 4.69 µg/mL and 671.11 ± 6.74 µg/mL). Whereas the grapefruit peel extracts both in ethanolic (GPE) and ethyl acetate (GPEA) have antioxidant activity in FRAP (EC50 219.47 ± 71.96 µg / ml and 309.44 ± 95.76 µg/ml) and BCB (EC50 245.19 ± 162.47 µg/ml and 567.54 ± 95.31 µg/ml). As positive standards for FRAP antioxidant analysis were quercetin and vitamin C which has IC50 respectively 18.97 ± 4.50 µg/mL and 24.47 ± 1.44 µg/mL. While in BCB analysis, Butylated Hydroxy Toluene (BHT) used as positive standard (IC50 38.68 ± 5.70 µg/mL). The samples of SE, SEA, GPE and GPEA showed tyrosinase inhibitory activity which the IC50 values were respectively 492.68 ± 1.43; 2658 ± 48.08; 3312.5 ± 222.74; 2985.17 ± 122.80 µg/ml. Kojic acid (IC50 111.52 ± 0.42 µg/ml) is used as positive standard in this study. In addition, SE, SEA, GPE and GPEA were able to inhibit elastase and collagenase enzymes, although their activities were still lower than the positive standard used in this study. Elastastinal in concentration 50 µg/mL giving elastase inhibition about 71.71 ± 0.81 µg/mL, while vitamin C in the same concentration showed collagenase inhibition about 66.79 ± 1.23 µg/mL. It can be concluded that the extract of strawberry and grapefruit peel has antioxidant, anti-tyrosinase and anti-wrinkle activity through inhibition of elastase and collagenase enzymes; thus, they can be used as antiaging cosmetic ingredients.

Cancer is a condition of abnormal cell proliferation of tissue cells in the body that becomes malignant. It can attack other parts of the body and affect the normal function of the body organs. The sample used in this study was red nails or tubers, then extracted using 96% ethanol eluent to obtain a thick extract. The ethanolic extract of the red ferns was fractionated using column chromatography to obtain the active fraction to characterize the compound using Thin Layer Chromatography and Gas Chromatography-Mass Spectroscopy (GC-MS) and tested its cytotoxic effectiveness on MCF-7 cancer cells and HeLa cancer cells. The results of this study were obtained from fractionation using the column chromatography method to obtain sub-fraction C and the results of compound characterization using GC-MS and obtained variations in the class of compounds contained in the sample, namely amino acids, glucosinolates, alkaloids, flavonoids, and terpenoids. Based on the cytotoxic effect test of sub-fraction C on MCF-7 cancer cells, the results obtained moderate cytotoxic effects with an IC50 value of 61.027 µg/mL, and HeLa cancer cells had an IC50 value of 521.03 µg/mL, which was categorized as having a weak cytotoxic effect. Based on the results obtained from this study, it can be concluded that sub-fraction C of A. ferox Copel Tubers has a cytotoxic effect on MCF-7 breast cancer cells to be used as a reference for tracing pure compounds from A. ferox Copel tuber.

Plant callus extracts are potential to be developed as ingredient in skincare products. Tomato callus is supposed to contain protein-derivatives and or other components such as secondary metabolites that play a role in skin regeneration. Therefore the production of calli is important to be studied for callus sustainable supply. This research aims to obtain optimum medium for callus induction and to analyze tomato callus development anatomically. In vitro culture response was assessed in tomato plant (Solanum lycopersicum L. ‘Permata’) for optimum callus induction. Seeds were grown on ¼ MS medium for 10-15 days. Hypocotyl was excised and cultured on MS medium + 2 mg/l 2,4-D for 15 days as the explants for callus induction. Callus was transferred to MS medium with 8 variations of PGRs including the combination of BAP + NAA, and 2,4-D. Both fresh and dry weight was measured every 5 days over 60 days to establish the growth kinetics and growth efficiency of callus. Anatomic characters of calli were examined through paraffin-embedded method. The result showed of MS medium supplemented with 2.0 mg/l NAA and 0.2 mg/l BAP is optimum for tomato callus induction, based on highest number of the absolute growth rate on fresh weight (73.77% per day), dry weight (3.84% per day), and callus initiation time (5.56 days) achieved by the medium. Cells in the ground tissue of tomato hypocotyl are competent to be dedifferentiated into a callus. This research results were expected to find out suitable methods for tomato callus production in preparation for skincare uses.

The identification of meat species in food products and pharmaceuticals is vital to minimize food adulteration practices. Due to its specificity, polymerase chain reaction (PCR)-based methods are the most commonly reported methods for detection of food adulterants. This study was aimed to evaluate the use of real-time PCR with a species-specific primer to identify two non-halal types of meat, namely pork and wild boar meat (WBM), in chicken sausages. The primer was designed using online software PrimerQuest from NCBI (National Center for Biotechnology Information) to target the mitochondrial ND1 gene of Sus scrofa domestica. The annealing temperature (Ta) of the primer used during real-time PCR analysis was optimized to achieve the highest response fluorescence unit at the lowest cycles. Real-time PCR using the primers of NK-ND1-Ssc1 (Forward: 5’ AAAGGACCCAACGTTGTAGG 3’ and Reverse: 5’ TAGTGCTAGGGATAAGGCTAGG 3’) was validated with several parameters, namely specificity, the limit of detection for sensitivity, linearity, efficiency, and repeatability. The optimum annealing temperature of NK-ND1-Ssc1 was 58.1oC. The sensitivity evaluation revealed that the limits of detection (LoD) of pork and WBM in reference sausage samples containing 100% pork and WBM were 500 pg and 50 pg, respectively, which correspond to 0.3% meat in sausage products. The efficiency values of real-time PCR amplification were 93.1% and 94.8% for pork and WBM with coefficient variations of 0.2884% and 0.4998%, respectively. The validated method was subsequently applied to analyze the commercial samples, and among the twelve (12) samples evaluated, there was one sample positive of containing non-halal meat (pork or WBM). Real-time PCR using species-specific primers, e.g., NK-ND1-Ssc1, is specific and sensitive; therefore, this method can be used as an alternative technique for authentication of halal meat.

Studies have suggested that both carrot (Daucus carota L.) and tomato (Solanum lycopersicum L.) callus extracts contain antoxidant compounds that might have the potental to protect cells from free radicals such as H2O2 that contribute to cell damage. The other sources of free radical exposure in human cells, such as UV‐B, should also be examined. UV‐B exposure can trigger increased expression of inflammatory cytokines such as cyclooxygenase‐2 (COX‐2) and tumor necrosis factor‐α (TNF‐α) and the antinflammatory cytokine interleukin‐10 (IL‐10), which causes photoaging. This study was conducted to investigate the cytoprotectve actvity of carrot and tomato callus aqueous extracts by observing cell viability using the MTT assay. Immunocytochemistry methods were used to examine the effects of carrot and tomato callus aqueous extracts on the expression of COX‐2, TNF‐α, and IL‐10 in human dermal fibroblast adult (HDFa) cells exposed to UV‐B light. Carrot and tomato callus aqueous extracts were obtained by the maceration method using aqua bidistilled solvent. Results showed that both carrot and tomato callus aqueous extracts at 0.5 mg/mL exhibited the highest cytoprotective effect in HDFa cells compared to that at other concentratons. Both carrot and tomato callus aqueous extracts could also decrease the expression of COX‐2 and TNF‐α, whereas carrot callus aqueous extract increased the expression of the anti‐inflammatory cytokine IL‐10 in HDFa cells.

The professional challenge of internal auditors in Indonesia is how to provide added value to the organization, especially in ensuring the implementation of good governance and organizational risk management. The limited research in the field of internal audit in local governments in Indonesia has become the main urgency in this study. The purpose of this study is to examine the effect of cooperation between internal and external auditors; management support; effectiveness of internal controls; and auditor experience on the effectiveness of internal audits. This study uses a survey method with a research instrument in the form of a questionnaire. 58 research respondents were auditors and financial staff who worked at the Regional Inspectorate and Financial and Asset Agency (BKAD) in Local Government. The data analysis method used in this study was multiple regression. The results of the study state that management support and auditor experience affect the effectiveness of internal auditors. Whereas, the collaboration between the auditor's internal and external auditors and the effectiveness of internal controls does not affect the effectiveness of internal auditors.

The grapefruit (Citrus maxima L.) is a plant known by the public as a fruit consumed with various properties. This plant's use is well known, such as antioxidants, enhancing immunity, anti-aging, and antibacterial properties. This study aimed to identify and analyze the chemical compounds contained in C. maxima rind. The extract was obtained by the maceration method using ethanol and ethyl acetate as solvents. The fractionation process was carried out by Column Chromatography. Observation of thin-layer chromatography profiles with UV lamps 254 and 366 nm. Analysis of chemical compound components using GC-MS and data interpretation based on the Wiley 7.0 data library. The interpretation results of the EF1 fraction are β-copaen-4-α-ol; pentadecanoic acid; hexadecanoic acid; tetradecanoic acid; dotriacontane; osthol; 2H-1-benzopyran-2-one, 7-methoxy-8-(3-methyl-2-oxobutyl); furfural; 6-(2,3-Dihydroxy-3-methylbutyl)-7-methoxycoumarin; and 6-(iodomethyl)-5-methyl-4-oxahexanolide. The chemical compounds identified in EAF2 are 1-octadecanol; decane; tetracosane; hexacosane; and 1,2-benzenedicarboxylic acid (2-ethylhexyl) ester. It can be concluded that these compounds have biological and pharmacological activities.

The chemical contents and health benefits of black rice bran of some rice cultivars have been investigated. However, there has been little research on the ‘Cempo Ireng’ cultivar from Sleman, Yogyakarta. The aim of this present study was to determine the anthocyanin, antioxidant activity, and macro- and micronutrients contents of black rice bran from this local cultivar. The anthocyanin in the black rice bran was extracted using the maceration method with methanol as a solvent. The extract obtained was separated through a preparative thin layer chromatography (TLC) of silica GF254 and a mobile phase composed of n-butanol, acetic acid, and water. Two fractions were collected and analyzed for the anthocyanin content. The preparative TLC spots were separated for further detection and measurement of cyanidin 3-O-glucoside using HPLC followed by LC-MS. The antioxidant activity of the fractions were measured using the DPPH free radical scavenging method. The results showed that the anthocyanin in fraction 1 was identified as cyanidin 3-O-glucoside (66.1 ± 10.6 µg/g). The IC50 of fractions 1 and 2 were 200.96 and 218.36 µg/mL, respectively. Analysis of the macro- and micronutrients revealed that the black rice bran of ‘Cempo Ireng’ had nutrient contents comparable with other rice cultivars. Therefore, this local black rice bran can be used as a source of antioxidants and macro-- and micronutrients.

This study aims to determine the bioactivity of L.domesticum as cosmetic ingredient. The extraction was prepared by maceration with ethanol 96 % and ethyl acetate to obtain ethanolic extract of fruit flesh (BLE), ethanolic extract of fruit peel (KLE), ethyl acetate extract of fruit flesh (KLE) and fruit peel (KLEA). Then, determination of compounds was conducted by thin layer chromatography (TLC) and analysed of total phenolic and flavonoid content with colorimetric method. The antioxidant capacity was measured using radical scavenging assay of 1,2-diphenyl-2-picrylhydrazyl (DPPH), β-carotene bleaching assay (BCB) and ferric reducing antioxidant power assay (FRAP). The inhibitory effect of skin degradation enzymes (anti-aging) was carried out using elastase and collagenase assay. The tyrosinase inhibitory effect was determined using mushroom tyrosinase. Based on TLC result, extract of L.domesticum containing phenolic, flavonoids, terpenoids and steroids compounds. The largest of total flavonoid content was obtained in KLE (4,76±0,26 %b/b EQ) and phenolic total content in BLEA (6,4±0,15 %b/b EG). Sequence of antioxidant activity measured using DPPH method was BLEA> KLE> BLE> KLEA; while using BCB method and FRAP method were respectively KLEA>BLEA> KLE> BLE; and BLEA> KLE> BLE> KLEA. KLE and KLEA extracts showed the most potent to remaining activity of the enzyme elastase and collagenase. In addition, BLE extract has the higest tyrosinase inhibition than others. Based on these results it can be concluded that the extracts of the fruit flesh and fruit peel of L. domesticum can be used as a cosmetic active ingredient for anti-aging and anti-tyrosinase.

Seledri (Apium graviolens L.), kumis kucing (Orthosiphon stamineus Benth.), and mengkudu (Morinda citrifolia L.) have been used to treat hypertension diseases in Indonesia. Previous researches have been done to determine antihypertensive activity of extracts of the sample in single extract. However, there are limited studies on effect of the extracts on a combination of three samples. This research was therefore aimed to study the effect of the combination on lowering blood tension on normotensive and spontaneously hypertensive rats. Non Invasive Blood Pressure technique equipped with Non Invasive Blood Pressure System (CODA®) was used to measure effect of extracts on antihypertensive activity. Sprague Dawley rats were divided into 2 groups (normotensive and spontaneously hypertensive rats using fenilefrin) and treated with combination extracts in doses of 20.25 and 40.5 mg/kg BW of rats. The result showed that the combined extracts can decrease in blood pressure of both two of the groups. Normotensive group of the rats treated at doses of 20,25 and 40,5 mg/kg BW of rats had lower persentase of systolic blood pressure as much as 7,1 ± 1,8 % and 10,2 ± 2,6 %, whilst percentage of diastolic blood pressure had lower percentage as much as 13,8 ± 3,2 % and 12,3 ± 3,1 %, respectively. Furthermore, spontaneously hypertensive rats treated at doses of 20,25 and 40,5 mg/kg BW of rats also showed lower systolic blood pressure as much as 16,10 ± 0,90 % and 15,84 ± 1,55 % and diastolic blood pressure as much as 19,48 ± 1,03 % and 17,77 ± 1,34 %. These results suggest that administration of combination of three extracts exhibited antihypertensive in both of the rat groups.

Indonesia has a wide range of rice cultivars and pigments. This rice can be used as a source of phytochemical compounds for cancer prevention. This research aims to analyze the cytotoxic activities of the ethanolic extract of black rice bran of 4 local cultivars i.e. ‘Cempo Ireng’, ‘Woja Laka’, ‘Toraja’ and ‘IR­64’ (white rice) on cancer cells and to determine the compounds groups of those extracts. First step, rice bran was extracted with ethanol. This extract was applied to Raji (a human Burkitt Lymphoma cancer), HepG2 (a human liver cancer), and Vero (a nonhuman cell line) cells in order to measure the cytotoxic activities by using MTT assay. To determine descriptively the compounds groups of phenolics, flavonoids, terpenoids, steroids, and alkaloids the thin layer chromatography method was performed. The IC50 value was analyzed quantitatively by using probit analysis. Results showed that the IC50 values of ethanolic extract of rice bran ‘Woja Laka’, ‘Toraja’, ‘Cempo Ireng’ and ‘IR 64’ on HepG2 cells were 857.23±99.19; 1,896.55±83,8; 1,494.47±87.81 and 727.89±145,97 µg/ml respectively. The IC50 on Raji cells were 816.61±85.31; 1,079.93±28.31; 1,627.82; ±119.82, and 769.33±61.43 µg/ml respectively. The IC50 on Vero cells were 1,295.2±37; 1,232.07±165.51; 1,874.14±169.56, and 724.4±122.79 µg/ml respectively. The ethanolic extracts of rice bran from four cultivars contain phenolics, flavonoids, terpenoids, and steroids. However, alkaloids could not be detected. The variety of rice cultivars indicates the variation of cytotoxic activities on cancer cells. The ethanolic extracts of rice bran from those four rice cultivars contain similar kinds of organic compounds groups but vary in the Rf values.

Previous studies showed that Leunca herb ethanolic extract (LHE) has cytotoxic activity in several cancer cell lines such as HepG2 and HT-29. The extract also demonstrated as potential agent to be developed as co-chemotherapeutic in combination with doxorubicin and cisplatin. The combination is supposed to reduce occurance of cell resistance and toxicity towards normal cell. In order to verify safety before being applied to human, toxicological and genotoxic evaluation of the extract is important to be done. This research was therefore aimed to investigate acute toxicity and genotoxic activity of LHE. The acute toxicity study was carried out in three groups of 5 mice that was orally administrated by LHE at different doses consisting 300, 2000 and 5000 mg/kgBW. Mortality and sign of toxicity were observed during 7 days. Genotoxic activity was carried out using Mononuclear Polychromatic Erythrosite (MNPCE) assay at a doses range of 250, 500, and 1000 mg/kgBW. Cyclophosphamide (CYP) at the dose of 50 mg/kg was used as positive control. The result showed that LHE did not cause lethal effect on animal model up to doses of 5000 mg/kgBW. However, toxicity signs were found in animal model on day 0-6 of the observation. LHE had lower genotoxic activity compared to cyclophosphamide at the doses of 250, 500, and 1000 mg/kg. The low genotoxic activity and acute toxicity of LHE suggested that the extract might be safe to be used as medicine. Keywords: leunca herb ethanolic extract, genotoxicity, acute toxicity

Recently, the research to find alternative sources of carbohydrates as a replacement for rice has been developed. Walur is one of the carbohydrate sources that can be explored because it can be grown in any area with out special treatment. However, walur has limitation for direct consumption, because it contains calcium oxalate. The purposes of this study were to determine the chemical character (macronutrient content), calculate glycemic index and get the proper washing techniques to elimin ate calcium oxalate of walur. Macro nutrients content studied in this research include carbohydrates, fats, protein, star chand crude fiber. Analysis of macronutrients has been chemically done, while the glycemic index was measured by in vivo using glucose as a standard. Elimination of calcium oxalate was conducted by washing the fresh walur tubers using a solution of0.01NHCl-NaOH, 5% NaCl, and solution of lemon-lime. The content of oxalate before and after washing was analyzed by permanganometry method. The results showed that walur containing 4.34 ±0.07% of reducingsugar,3.24 ± 0.06 % of not-reducing sugar, 11.27±0.40 % of crude fiber,0.03±1.05 % of starchand0.57±0.01 % of protein. Qualitative analysis of fatty acids showed that hexade canoicacid, octade cadienoicacid, and the acide icosatetranoic were detected in high concentrations. The glycemic index valueof walur was relative lylow, about of 16.9. In addition, washing technique using a solution of lemon-lime was the most excellent technique and can reduce the oxalate content up to61.82%.Fromthis research, it can be concluded that walur can be used as food substitute esrice after washing treatment using lemon-lime solution to remove the calcium oxalate content.

Plant callus extracts are potential to be developed as ingredient in skincare products. Tomato callus is supposed to contain protein-derivatives and or other components such as secondary metabolites that play a role in skin regeneration. Therefore the production of calli is important to be studied for callus sustainable supply. This research aims to obtain optimum medium for callus induction and to analyze tomato callus development anatomically. In vitro culture response was assessed in tomato plant (Solanum lycopersicum L. „Permata“) for optimum callus induction. Seeds were grown on 1/4 MS medium for 10-15 days. Hypocotyl was excised and cultured on MS medium + 2 mg/l 2,4-D for 15 days as the explants for callus induction. Callus was transferred to MS medium with 8 variations of PGRs including the combination of BAP + NAA, and 2,4-D. Both fresh and dry weight was measured every 5 days over 60 days to establish the growth kinetics and growth efficiency of callus. Anatomic characters of calli were examined through paraffin-embedded method. The result showed of MS medium supplemented with 2.0 mg/l NAA and 0.2 mg/l BAP is optimum for tomato callus induction, based on highest number of the absolute growth rate on fresh weight (73.77% per day), dry weight (3.84% per day), and callus initiation time (5.56 days) achieved by the medium. Cells in the ground tissue of tomato hypocotyl are competent to be dedifferentiated into a callus. This research results were expected to find out suitable methods for tomato callus production in preparation for skincare uses. [ABSTRACT FROM AUTHOR]