Search

Studies the correlation between the level of peripheral myelin protein 22 gene expression and the degree of demyelination and reduction of the nerve conduction velocity in transgenic mice. Role of myelin proteins in Schwann cell differentiation and division; Relationship between human mitochondrial RNA expression and transgene copy number; Causes of gene disruption during integration.

Polycystin-2 (PC-2), a cation channel of the Trp family, is involved in autosomal dominant polycystic kidney disease (ADPKD) type 2 (ADPKD2). This protein has recently been localized to the primary cilium where its channel function seems to be involved in a mechanosensory phenomenon. However, its biological function is not totally understood, especially in tubule formation. In the present paper, we describe a mouse model for human PC-2 overexpression, obtained by inserting a human bacterial artificial chromosome (BAC) containing the PKD2 gene. Three lines were generated, expressing different levels of PKD2. One line, PKD2-Y, has been explored in more detail and we will present physiological and molecular exploration of these transgenic animals. Our data demonstrate that transgenic animals older than 12 months present tubulopathy with proteinuria and failure to concentrate urine. Moreover, the kidney cortex has been found disorganized. Finally, we observe that extracellular matrix protein expression is downregulated in these animals. In conclusion, overexpression of human PKD2 leads to anomalies in tubular function, probably due to abnormalities in tubule morphogenesis.

Charcot-Marie-Tooth disease (CMT) is the most common hereditary peripheral neuropathy, affecting 1 in 2,500 people. The only treatment currently available is rehabilitation or corrective surgery. The most frequent form of the disease, CMT-1A, involves abnormal myelination of the peripheral nerves. Here we used a mouse model of CMT-1A to test the ability of ascorbic acid, a known promoter of myelination, to correct the CMT-1A phenotype. Ascorbic acid treatment resulted in substantial amelioration of the CMT-1A phenotype, and reduced the expression of PMP22 to a level below what is necessary to induce the disease phenotype. As ascorbic acid has already been approved by the FDA for other clinical indications, it offers an immediate therapeutic possibility for patients with the disease.

FG syndrome is an X-linked condition comprising mental retardation, congenital hypotonia, macrocephaly, distinctive facial changes, and constipation or anal malformations. In a linkage analysis, we mapped a major FG syndrome locus [FGS1] to Xq13, between loci DXS135 and DXS1066. The same data, however, clearly demonstrated genetic heterogeneity. Recently, we studied a French family in which an inversion [inv(X)(q12q28)] segregates with clinical symptoms of FG syndrome. This suggests that one of the breakpoints corresponds to a second FG syndrome locus [FGS2]. We report the results of fluorescence in situ hybridization analysis performed in this family using YACs and cosmids encompassing the Xq11q12 and Xq28 regions. Two YACs, one positive for the DXS1 locus at Xq11.2 and one positive for the color vision pigment genes and G6PD loci at Xq28, were found to cross the breakpoints, respectively. We postulate that a gene might be disrupted by one of the breakpoints., (Copyright 2000 Wiley-Liss, Inc.)

PMP22, one of the major components of myelin, is overexpressed in Charcot-Marie-Tooth type 1A (CMT1A) patients. In an attempt to determine the mechanisms by which the expression of this gene is regulated (with a view to lowering its expression in CMT1A patients), we subcloned genomic fragments covering 6kb of the promoter region in an expression vector containing the beta-galactosidase gene as reporter, and used these in transfection assays. We show that the 300bp upstream of the transcription start contain the elements required for Schwann cell specific expression of the reporter gene. This minimal promoter activity appears to be under the control of a silencer element sensitive to cAMP, located between -0.3kb and -3. 5kb from the start of transcription. Computer analysis of 2kb of the promoter predicted the presence of transcription factor binding sites, including CREB (which may be involved in the response of PMP22 expression to cAMP stimulation) and steroid receptors. Using constructs with or without the CREB sites, we were able to demonstrate that these sites are involved in silencing the PMP22 promoter activity. Lastly, we identified a region containing blocks of polymorphic CA repeats, located close to the CREB binding site, which may further influence the transcriptional activity of PMP22.

A human clone corresponding to the homologue of the murine Polycomb-like gene M33 has been used to map this gene (CBX2) to human chromosomes. Both somatic cell hybrid panels and FISH on metaphase chromosomes have been used. These techniques gave a consistent localization, at the tip of the long arm of chromosome 17 (17q25). This localization, as well as the potential role of a mammalian Polycomb-like protein, suggests a potential involvement in two different pathologies: the campomelic syndrome, an inherited disorder, and neoplastic disorders linked to allele loss already described in this region.

The juxtacentromeric region of the human chromosome 17 short arm (17p11.2-p12) contains genes involved in the Charcot-Marie-Tooth type 1A disease (CMT1A) and the Smith-Magenis syndrome (SMS). CMT1A is associated with a duplication of a short segment whereas SMS is linked to microdeletions, extending toward the centromere. We describe the construction and analysis of a 5 Mb YAC contig spanning the CMT1A duplicated segment and the distal part of four SMS microdeletions. We concluded that the YAC contig contains about 1Mb of genomic DNA which is deleted in the four SMS patients analysed. Moreover two YACs contain both STS deleted in SMS (U3) and STS duplicated in CMT1A (5H5), but the proximal breakpoint associated with the CMT1A duplication is not the same as the distal SMS breakpoint we studied. Finally we located five new STS in SMS deletion. Two of them, a microsatellite (D17S805(23)) and the gene coding for small nuclear RNA U3, have been localized in the contig we described. We may also note that snU3 is the first expressed sequence localized in an SMS deletion so far. The possible participation of this gene in the SMS phenotype is discussed.

A human genomic library was screened with a 30-base oligomer corresponding to the 5' end of the human calretinin cDNA. A clone that contains a minisatellite composed of 21 imperfect repeats of a 37-bp sequence was isolated. The consensus (GAGGGAGGAACTGGGACGCGTGCATGTTTGCATTCTC) incidentally shares 14 consecutive matches with the oligomer used as a probe, and it was shown that the clone did not belong to the calretinin locus. The minisatellite, named K29, was used as a probe on Southern blots at high stringency. After HaeIII, MboI, or HinfI digestion, it detected a single hypervariable locus, with 65% heterozygosity among Caucasian individuals. The probe used at low stringency revealed a fingerprint, with an average of four bands in addition to the locus-specific pattern. Mendelian inheritance was assessed on pedigrees. The K29 minisatellite was mapped by in situ hybridization to the very end of the long arm of chromosome 2 (2q37.3 band), at close proximity of the Fra2J locus, and is referred to as the D2S88 locus in the genome database.

cDNA clones encoding four new receptors of the G-protein-coupled receptor family were obtained by selective amplification and cloning from thyroid cDNA and termed RDC1, RDC4, RDC7, and RDC8. RDC7 and RDC8 have recently been identified as A1 and A2 adenosine receptors, respectively. These cDNAs were utilized for chromosomal in situ hybridization to establish the genomic location of the corresponding genes in man. The results indicate that human RDC1, RDC4, RDC7, and RDC8 are in regions 2q37, 1p34.3-1p36.3, 22q11.2-22q13.1, and 11q11-11q13, respectively.

In this study we have utilized human elastin cDNAs in molecular hybridizations to establish the chromosomal location of the human elastin gene. First, in situ hybridizations were performed with metaphase chromosomes from phytohemagglutinin-stimulated human peripheral blood lymphocytes. In three separate experiments using two different regions of human elastin cDNAs, the distribution of grains was found to be concentrated on the long arm of chromosome 7 within the [q11.1-21.1] region, and the peak number of grains coincided with the locus 7q11.2. Second, hybridizations with a panel of human-rodent cell hybrids showed concordance with human chromosome 7. Third, PCR analyses with elastin-specific primers of DNA from a hybrid cell line containing chromosome 7 as the only human chromosome yielded a product of the expected size, while DNA containing human chromosome 2, but not chromosome 7, did not result in a product. The results indicate that the human elastin gene is located in the proximal region of the long arm of chromosome 7. The precise localization of the elastin gene in the human genome is useful in establishing genetic linkage between inheritance of an allele with a mutated elastin gene and a heritable disorder.

The genes encoding calbindin D28k (CALB1) and calretinin (CALB2), two closely related calcium-binding proteins, were mapped by in situ hybridization to the 8q21.3----q22.1 and 16q22----q23 regions of the human genome, respectively. These localizations match the chromosomal regions where the carbonic anhydrase isozyme gene cluster (CA1, CA2, CA3) and the related gene CA7 have been described, respectively. This suggests a common duplication o the calbindin/calretinin and the carbonic anhydrase ancestral genes.

A laminin B2 chain cDNA clone was isolated from a human lung cDNA library by screening with antibody against mouse laminin. The authenticity of the human cDNA clone was established by comparison of the nucleotide and deduced amino acid sequences of the cDNA insert with those of the previously reported mouse laminin cDNA clones. The human clone (LC7) contained an insert of 0.75 kb (kilobase pair) that corresponded to the last 232 amino acid residues in the carboxyl terminus of the B2 chain. Northern blot analyses with the LC7 probe detected two mRNA transcripts of 8.2 and 5.6 kb in both normal human skin fibroblasts and three human tumor cell lines. The cDNA probe was also used in Southern blot analysis of DNA from human rodent somatic cell hybrids to localize the gene to human chromosome 1. In situ hybridization of the cDNA with metaphase chromosome spreads confirmed the assignment and further mapped the human laminin B2 chain gene to the long arm of chromosome 1 in the band q31.

The human thyroglobulin gene was mapped by in situ hybridization whereby a 3H-labeled recombinant plasmid DNA containing a fragment of 2.3 kilobases of human thyroglobulin gene was hybridized to human chromosome preparations. A high proportion (25%) of hybridized metaphases exhibited silver grains at the distal portion of the long arm of chromosome 8. Analysis of the grain position at this site indicated that the chromosomal localization of the human thyroglobulin gene was 8q242-8q243.

Laminin, an integral component of basement membranes, consists of three subunit polypeptides, A, B1, and B2 chains. We have recently isolated cDNAs corresponding to human laminin A chain. These cDNAs were utilized for chromosomal in situ hybridizations to establish the genomic location of the laminin A chain gene. Metaphase chromosomes of PHA-stimulated human peripheral blood leukocytes were examined by in situ hybridization with 3H-labeled cDNAs, and the chromosomes were identified by R-banding (fluorochrome-photolysis-Giemsa method). The results indicated that the human laminin A chain is at locus 18p11.3. Since human laminin B1 and B2 chain genes have been previously mapped to chromosomes 7 and 1, respectively, the results indicate that genes encoding human laminin chains reside in separate chromosomes.

A human placental lambda gt11 expression cDNA library was screened for nidogen cDNAs by hybridizations with a heterologous mouse nidogen cDNA. A total of four positive overlapping clones were identified, and the sizes of the inserts were shown to vary from 0.8 to 2.8 kb. Nucleotide sequencing of the human cDNAs revealed that the largest clone, cHPN-16, contained both a 5' open reading frame encoding 582 amino acids and a 3' untranslated region of 1,063 nucleotides. Comparison of human cDNA sequences with mouse nidogen sequences revealed 84% identity on the nucleotide level and 88% identity with the deduced amino acid sequence. The deduced amino acid sequence of the human cDNAs revealed the presence of cysteine-rich epidermal growth factor-like repeats and the sequence Arg-Gly-Asp (RGD), a potential cell binding site, two features previously identified in mouse nidogen. The sequence Asn-Pro-Ser, a consensus sequence for N-linked glycosylation, was also noted. The newly isolated human cDNAs were utilized to analyze the expression of the nidogen gene by cultured human cells. Northern hybridizations revealed a single mRNA transcript of approximately 6.0 kb in human skin fibroblast and in HT 1080 fibrosarcoma cell cultures. However, the human choriocarcinoma cell line JEG-3, which expressed laminin genes, did not contain detectable levels of nidogen mRNAs. Quantitation of the relative nidogen mRNA abundance in HT 1080 fibrosarcoma cells indicated that nidogen mRNA levels were approximately the same as those for the laminin B2 chain. Finally, one of the nidogen cDNAs was used to map the nidogen gene onto locus q43 of chromosome 1.

Human inter-alpha-trypsin inhibitor is a plasma protein of Mr 180,000 which has long been described as a single polypeptide chain. However, we have previously demonstrated that it is synthesized in liver by two different mRNA populations coding for heavy or light polypeptide chains [Bourguignon, J. et al. (1983) FEBS Lett. 162, 379-383] and cDNA clones for the heavy or light chains have recently been isolated and characterized [Bourguignon, J. et. al. (1985) Biochem. Biophys. Res. Commun. 131, 1146-1153; Salier, J.P. et al. (1987) Proc. Natl Acad. Sci. USA 84, 8272-8276]. In the present study, we show that human poly(A)-rich RNAs hybrid-selected with various heavy-chain-encoding cDNA clones translate three different heavy chains, designated H1 (Mr 92,000), H2 (Mr 98,000) and H3 (Mr 107,000). We previously characterized two heavy-chain cDNA clones. We now report that they correspond to H1 and H2 chains. We have also determined the sequence of an additional cDNA clone which codes for H3 chain. Its insert size is 1.79 kb with a single open reading frame and a poly(A) tail. The deduced amino acid sequence of the H3 chain is highly similar to those of the H1 (54%) and H2 (44%) chains. Northern analysis of human liver poly(A)-rich RNAs with the three heavy-chain cDNAs as probes clearly identified a single major mRNA population of 3.3 +/- 0.1 kb. Chromosomal localization by in situ hybridization shows that inter-alpha-trypsin inhibitor genes are located on three different human chromosomes. The H1 and H3 genes are located in the p211-p212 region of chromosome 3, whereas the H2 gene resides in the p15 band of chromosome 10. The light-chain gene is located in the q32-q33 region of chromosome 9. These results indicate that heavy and light chains of inter-alpha-trypsin inhibitor are encoded by at least four functional genes.

Type VI collagen is a heterotrimer composed of three polypeptide chains, alpha 1(VI), alpha 2(VI), and alpha 3(VI). By immunological screening of an expression cDNA library, human cDNAs specific for each chain were isolated and characterized. Major mRNA species encoding these chains have a size of 4.2 kb (alpha 1), 3.5 kb (alpha 2), and 8.5 kb (alpha 3). The cDNA clones were also used to map the genes on human chromosomes by somatic cell hybrid analysis and in situ hybridization. The alpha 1 (VI) and alpha 2(VI) collagen genes were both located on chromosome 21, in band q223. This represents a third example of a possible physical proximity of two collagen loci. The alpha 3(VI) collagen gene was localized to chromosome 2, in the region 2q37. The alpha 3(VI) collagen gene is the fifth extracellular matrix gene to be localized to 2q, as four other extracellular matrix genes--i.e., the alpha 1(III) and alpha 2(V) collagen genes, the elastin gene, and the fibronectin gene--have been previously mapped to the distal region of the long arm of chromosome 2.

The two classical minisatellite probes, 33.6 and 33.15, were used for in situ hybridization to human metaphase chromosomes. Surprisingly, a single major hybridization peak was observed with each probe, respectively at 1q23 for 33.6 and 7q35-q36 for 33.15. Hybridization to human DNA cleaved with "rare-cutter" enzymes and fractionated on pulsed-field gels also showed a fairly simple, largely monomorphic pattern which allows chromosomal assignment using somatic cell hybrids. Differences in hybridization stringency and degree of resolution account for most of the discrepancy between these results and the accepted view of minisatellites, i.e., a large number of unlinked loci spread over the genome. Our results nevertheless indicate the existence of particularly large and homologous loci on a particular chromosome for each of these probes.