Search

In recent years, renewable sources of energy have been sought due to the environmental impacts associated with fossil fuels, such as greenhouse gas emissions into the atmosphere. A promising alternative is biodiesel, particularly when obtained using yeast, as they offer certain advantages over other microorganisms due to their resilience to grow in various conditions, short reproduction times, and lower susceptibility to bacterial infections because they thrive at lower pH levels and have the ability to utilize a wide variety of substrates. Furthermore, biodiesel produced with yeast is composed of methyl ester fatty acids (FAME), providing it with good quality and performance in internal combustion engines, resulting in reduced greenhouse gas emissions compared to conventional diesel. The production of biodiesel using yeast involves six general stages, which offer various methodological alternatives with different degrees of sustainability. The objective of this review is to assess the sustainability degree of various methodologies employed in each of the stages of yeast-based biodiesel production through environmental and economic sustainability indicators. [ABSTRACT FROM AUTHOR]

(1) Background: Carbohydrates are the most important source of nutritional energy for the human body. Carbohydrate digestion, metabolism, and their role in the gut microbiota modulation are the focus of multiple studies. The objective of this weight of evidence systematic review is to investigate the potential relationship between ingested carbohydrates and the gut microbiota composition at different taxonomic levels. (2) Methods: Weight of evidence and information value techniques were used to evaluate the relationship between dietary carbohydrates and the relative abundance of different bacterial taxa in the gut microbiota. (3) Results: The obtained results show that the types of carbohydrates that have a high information value are: soluble fiber with Bacteroides increase, insoluble fiber with Bacteroides and Actinobacteria increase, and Firmicutes decrease. Oligosaccharides with Lactobacillus increase and Enterococcus decrease. Gelatinized starches with Prevotella increase. Starches and resistant starches with Blautia decrease and Firmicutes increase. (4) Conclusions: This work provides, for the first time, an integrative review of the subject by using statistical techniques that have not been previously employed in microbiota reviews. [ABSTRACT FROM AUTHOR]

Microalgae have emerged as renewable and sustainable candidates for biorefineries since they can generate bioproducts and bioenergy through the removal of contaminants contained in wastewater. In the present study, a native microalgae consortium (NMC) is isolated from a wastewater treatment plant, and used to remove 100 mgL−1 Cr(III). The native microalgae consortium is enriched in a photobioreactor with the following conditions: Bold's Basal Medium (BBM), pH 8, room temperature and 20 µmolm−2s−1 light intensity. The molecular characterization reveals the presence of the following species: Tetradesmus sp., Scenedesmus sp and Ascomycota sp. The development of microalgae is evaluated through the production of biomass, pH, protein, lipid and carbohydrate, while the consortium presents the potential to obtain biofuels. The ability of the consortium to absorb two different sources of Cr (III) was determined using real tannery wastewater and synthetic water prepared with Cr 2 (SO 4) 3. The adsorption efficiency of the microalgae is analyzed using adsorption isotherms of Langmuir model, indicating 99% adsorption efficiency of 100 mgL−1 Cr(III). FT-IR and SEM analyses enable to identify the presence of Cr(III) in the native microalgae consortium. The promising features of this NMC underpin the idea of establishing a sustainable biorefinery to generate different bioproducts, in order to achieve a resource-efficient biomass use for a circular bioeconomy. [ABSTRACT FROM AUTHOR]

• Cr (III) removal sequentially occurs in abiotic and biotic stages. • Cr(III) bioremoval using isolated microbial consortia under anaerobic conditions. • Inoculum of bacteria improves tolerance for high Cr (III) concentrations. • Bioaccumulation/biotransformation as synergistic Cr(III) removal mechanisms. • Native consortia made up of Lactobacillus diolivorans and Lactobacillus brevis. Microbial consortia are isolated and enriched in discontinuous reactors under anaerobic conditions using different stoichiometric ratios of acetate (substrate): Cr(III) concentration: reactors A (0.5:1), B (1:1) and C (2:1). The inoculum is stemmed from a tannery effluent with the aim of tolerating and eliminating high concentrations of Cr(III) (2760 mg L−1). The Cr(III) removal process is performed in two stages for each reactor. Stage I is an abiotic process involving the reaction between acetate and Cr(III) forming the complex C r H 2 O x C H 3 C O O y 3 - y , which on its turn precipitates as C r 2 O 3 (s) in the first five days, thus, decreasing the metal concentration by 24, 42 and 61 % for reactors A, B and C respectively. FT-IR analysis, SEM-EDX, biomass and extracellular polymeric substances (EPS) indicate that the native bacteria enriched in the reactors eliminate Cr (III) during the biotic stage via bioadsorption and bioaccumulation mechanisms. Reactor C achieved the lowest Cr(III) concentration around 600 mg L-1 (78 % removal). The occurrence of these mechanisms was due to the nature of the inoculum since the bacteria were well adapted to the presence of high Cr(III) concentrations, whereby they did not require optimal growth conditions unlike a pure strain. The isolated strains were molecularly identified by amplification and sequencing of the 16 s rRNA gene using universal oligos 63 F (5'CAGGCCTAACACATGCAAGTC3′) and 1542R (5′AAGGAGGTGATCCAGCCGCA3′), finding a 99.06 % of similarity to Lactobacillus diolivorans (strain JCM 12183 accession number LC311745.1), and 99.88 % similarity to Lactobacillus brevis (strain C23 accession number MN880215.1). SEM-EDX enables to identify that the consortia are mainly composed of bacilli undergoing pleomorphism, due to the complex formations between functional groups in the cell wall and Cr(III). [ABSTRACT FROM AUTHOR]