Search

Background Variants in genes of the nucleotide excision repair (NER) pathway have been associated with heterogeneous clinical presentations ranging from xeroderma pigmentosum to Cockayne syndrome and trichothiodystrophy. NER deficiencies manifest with photosensitivity and skin cancer, but also developmental delay and early‐onset neurological degeneration. Adult‐onset neurological features have been reported in only a few xeroderma pigmentosum cases, all showing at least mild skin manifestations. Objective The aim of this multicenter study was to investigate the frequency and clinical features of patients with biallelic variants in NER genes who are predominantly presenting with neurological signs. Methods In‐house exome and genome datasets of 14,303 patients, including 3543 neurological cases, were screened for deleterious variants in NER‐related genes. Clinical workup included in‐depth neurological and dermatological assessments. Results We identified 13 patients with variants in ERCC4 (n = 8), ERCC2 (n = 4), or XPA (n = 1), mostly proven biallelic, including five different recurrent and six novel variants. All individuals had adult‐onset progressive neurological deterioration with ataxia, dementia, and frequently chorea, neuropathy, and spasticity. Brain magnetic resonance imaging showed profound global brain atrophy in all patients. Dermatological examination did not show any skin cancer or pronounced ultraviolet damage. Conclusions We introduce NERDND as adult‐onset neurodegeneration (ND) within the spectrum of autosomal recessive NER disorders (NERD). Our study demonstrates that NERDND is probably an underdiagnosed cause of neurodegeneration in adulthood and should be considered in patients with overlapping cognitive and movement abnormalities. © 2022 The Authors. Movement Disorders published by Wiley Periodicals LLC on behalf of International Parkinson and Movement Disorder Society.

We present a rare case of a patient initially presenting with unilateral abdominal wall bulging and radicular pain caused by a lateral disc herniation at Th11/12, later suffering from a hernia recurrence with bilateral disc prolapse and motor deficits. The patient underwent sequesterectomy via a right hemilaminectomy at Th11, and after 8 weeks, a bilateral sequesterectomy with semirigid fusion Th11/12 was performed. Unilateral motor deficits at the thoracic level have been discussed in case reports; a bilateral disc protrusion with abdominal wall bulging occurring as a recurrent disc herniation has never been described before.

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease that causes progressive autonomy loss and need for care. This does not only affect patients themselves, but also the patients’ informal caregivers (CGs) in their health, personal and professional lives. The big efforts of this multi-center study were not only to evaluate the caregivers’ burden and to identify its predictors, but it also should provide a specific understanding of the needs of ALS patients’ CGs and fill the gap of knowledge on their personal and work lives. Using standardized questionnaires, primary data from patients and their main informal CGs (n = 249) were collected. Patients’ functional status and disease severity were evaluated using the Barthel Index, the revised Amyotrophic Lateral Sclerosis Functional Rating Scale (ALSFRS-R) and the King’s Stages for ALS. The caregivers’ burden was recorded by the Zarit Burden Interview (ZBI). Comorbid anxiety and depression of caregivers were assessed by the Hospital Anxiety and Depression Scale. Additionally, the EuroQol Five Dimension Five Level Scale evaluated their health-related quality of life. The caregivers’ burden was high (mean ZBI = 26/88, 0 = no burden, ≥24 = highly burdened) and correlated with patients’ functional status (rp = −0.555, p < 0.001, n = 242). It was influenced by the CGs’ own mental health issues due to caregiving (+11.36, 95% CI [6.84; 15.87], p < 0.001), patients’ wheelchair dependency (+9.30, 95% CI [5.94; 12.66], p < 0.001) and was interrelated with the CGs’ depression (rp = 0.627, p < 0.001, n = 234), anxiety (rp = 0.550, p < 0.001, n = 234), and poorer physical condition (rp = −0.362, p < 0.001, n = 237). Moreover, female CGs showed symptoms of anxiety more often, which also correlated with the patients’ impairment in daily routine (rs = −0.280, p < 0.001, n = 169). As increasing disease severity, along with decreasing autonomy, was the main predictor of caregiver burden and showed to create relevant (negative) implications on CGs’ lives, patient care and supportive therapies should address this issue. Moreover, in order to preserve the mental and physical health of the CGs, new concepts of care have to focus on both, on not only patients but also their CGs and gender-associated specific issues. As caregiving in ALS also significantly influences the socioeconomic status by restrictions in CGs’ work lives and income, and the main reported needs being lack of psychological support and a high bureaucracy, the situation of CGs needs more attention. Apart from their own multi-disciplinary medical and psychological care, more support in care and patient management issues is required., publishedVersion

(1) Background and Purpose: The skeletal muscles of patients suffering from neuromuscular diseases (NMD) are affected by atrophy, hypertrophy, fatty infiltration, and edematous changes. Magnetic resonance imaging (MRI) is an important tool for diagnosis and monitoring. Concerning fatty infiltration, T1-weighted or T2-weighted DIXON turbo spin echo (TSE) sequences enable a qualitative assessment of muscle involvement. To achieve higher comparability, semi-quantitative grading scales, such as the four-point Mercuri scale, are commonly applied. However, the evaluation remains investigator-dependent. Therefore, effort is being invested to develop quantitative MRI techniques for determination of imaging markers such as the proton density fat fraction (PDFF). The present work aims to assess the diagnostic value of PDFF in correlation to Mercuri grading and clinically determined muscle strength in patients with myotonic dystrophy type 2 (DM2), limb girdle muscular dystrophy type 2A (LGMD2A), and adult Pompe disease. (2) Methods: T2-weighted two-dimensional (2D) DIXON TSE and chemical shift encoding-based water-fat MRI were acquired in 13 patients (DM2: n = 5; LGMD2A: n = 5; Pompe disease: n = 3). Nine different thigh muscles were rated in all patients according to the Mercuri grading and segmented to extract PDFF values. Muscle strength was assessed according to the British Medical Research Council (BMRC) scale. For correlation analyses between Mercuri grading, muscle strength, and PDFF, the Spearman correlation coefficient (rs) was computed. (3) Results: Mean PDFF values ranged from 7% to 37% in adults with Pompe disease and DM2 and up to 79% in LGMD2A patients. In all three groups, a strong correlation of the Mercuri grading and PDFF values was observed for almost all muscles (rs > 0.70, p < 0.05). PDFF values correlated significantly to muscle strength for muscle groups responsible for knee flexion (rs = −0.80, p < 0.01). (4) Conclusion: In the small, investigated patient cohort, PDFF offers similar diagnostic precision as the clinically established Mercuri grading. Based on these preliminary data, PDFF could be further considered as an MRI-based biomarker in the assessment of fatty infiltration of muscle tissue in NMD. Further studies with larger patient cohorts are needed to advance PDFF as an MRI-based biomarker in NMD, with advantages such as its greater dynamic range, enabling the assessment of subtler changes, the amplified objectivity, and the potential of direct correlation to muscle function for selected muscles.

Improving quality of life (QoL) is central to amyotrophic lateral sclerosis (ALS) treatment. This Germany-wide, multicenter cross-sectional study analyses the impact of different symptom-specific treatments and ALS variants on QoL. Health-related QoL (HRQoL) in 325 ALS patients was assessed using the Amyotrophic Lateral Sclerosis Assessment Questionnaire 5 (ALSAQ-5) and EuroQol Five Dimension Five Level Scale (EQ-5D-5L), together with disease severity (captured by the revised ALS Functional Rating Scale (ALSFRS-R)) and the current care and therapies used by our cohort. At inclusion, the mean ALSAQ-5 total score was 56.93 (max. 100, best = 0) with a better QoL associated with a less severe disease status (β = −1.96 per increase of one point in the ALSFRS-R score, p < 0.001). “Limb-onset” ALS (lALS) was associated with a better QoL than “bulbar-onset” ALS (bALS) (mean ALSAQ-5 total score 55.46 versus 60.99, p = 0.040). Moreover, with the ALSFRS-R as a covariate, using a mobility aid (β = −7.60, p = 0.001), being tracheostomized (β = −14.80, p = 0.004) and using non-invasive ventilation (β = −5.71, p = 0.030) were associated with an improved QoL, compared to those at the same disease stage who did not use these aids. In contrast, antidepressant intake (β = 5.95, p = 0.007), and increasing age (β = 0.18, p = 0.023) were predictors of worse QoL. Our results showed that the ALSAQ-5 was better-suited for ALS patients than the EQ-5D-5L. Further, the early and symptom-specific clinical management and supply of assistive devices can significantly improve the individual HRQoL of ALS patients. Appropriate QoL questionnaires are needed to monitor the impact of treatment to provide the best possible and individualized care., publishedVersion

The von Willebrand Factor A domain containing 1 protein, encoded by VWA1, is an extracellular matrix protein expressed in muscle and peripheral nerve. It interacts with collagen VI and perlecan, two proteins that are affected in hereditary neuromuscular disorders. Lack of VWA1 is known to compromise peripheral nerves in a Vwa1 knock-out mouse model. Exome sequencing led us to identify bi-allelic loss of function variants in VWA1 as the molecular cause underlying a so far genetically undefined neuromuscular disorder. We detected six different truncating variants in 15 affected individuals from six families of German, Arabic, and Roma descent. Disease manifested in childhood or adulthood with proximal and distal muscle weakness predominantly of the lower limbs. Myopathological and neurophysiological findings were indicative of combined neurogenic and myopathic pathology. Early childhood foot deformity was frequent, but no sensory signs were observed. Our findings establish VWA1 as a new disease gene confidently implicated in this autosomal recessive neuromyopathic condition presenting with child-/adult-onset muscle weakness as a key clinical feature.

Frontotemporal dementia (FTD) is a clinically and genetically heterogeneous disorder. To which extent genetic aberrations dictate clinical presentation remains elusive. We investigated the spectrum of genetic causes and assessed the genotype-driven differences in biomarker profiles, disease severity and clinical manifestation by recruiting 509 FTD patients from different centers of the German FTLD consortium where individuals were clinically assessed including biomarker analysis. Exome sequencing as well as C9orf72 repeat analysis were performed in all patients. These genetic analyses resulted in a diagnostic yield of 18.1%. Pathogenic variants in C9orf72 (n = 47), GRN (n = 26), MAPT (n = 11), TBK1 (n = 5), FUS (n = 1), TARDBP (n = 1), and CTSF (n = 1) were identified across all clinical subtypes of FTD. TBK1-associated FTD was frequent accounting for 5.4% of solved cases. Detection of a homozygous missense variant verified CTSF as an FTD gene. ABCA7 was identified as a candidate gene for monogenic FTD. The distribution of APOE alleles did not differ significantly between FTD patients and the average population. Male sex was weakly associated with clinical manifestation of the behavioral variant of FTD. Age of onset was lowest in MAPT patients. Further, high CSF neurofilament light chain levels were found to be related to GRN-associated FTD. Our study provides large-scale retrospective clinico-genetic data such as on disease manifestation and progression of FTD. These data will be relevant for counseling patients and their families.

Background: Nusinersen was the first approved disease-modifying therapy for all 5q-spinal muscular atrophy (SMA) patients regardless of age or disease severity. Its efficacy in adults has recently been demonstrated in a large cohort by motor outcome measures, which were only partially suitable to detect changes in very mildly or severely affected patients. Patient-reported outcome measures (PROs) have been suggested as a valuable addition. Here, we aimed to assess treatment satisfaction and investigate whether it may be a useful PRO to monitor SMA patients. Methods: We enrolled 91 mainly adult 5q-SMA patients treated with nusinersen in a national, multicenter, cross-sectional observational study. 21 patients underwent longitudinal follow up. Patients’ satisfaction with treatment in four dimensions (global, effectiveness, convenience, side effects) was assessed by the Treatment Satisfaction Questionnaire for Medication German version 1.4 (TSQM-1.4©) and related to clinical parameters, motor scores, and treatment duration. Results: More than 90% of SMA patients were consistently satisfied over a median treatment duration of 10 months. Highest mean scores were observed in the dimensions ‘side effects,’ ‘global satisfaction,’ and ‘effectiveness’ (93.5 ± 14.8 versus 73.1 ± 21.0 and 64.8 ± 20.6, respectively). Patients’ satisfaction with the convenience of treatment was considerably lower (43.6 ± 20.2). Interestingly, satisfaction with the effectiveness was higher in ambulatory (p = 0.014) compared with non-ambulatory patients and directly correlated to motor outcome measures. Five non-ambulatory patients withdrew from therapy. All of them presented with a deterioration of motor outcome measures and reported dissatisfaction with treatment effectiveness and convenience. Conclusion: Most patients were satisfied with nusinersen treatment effectiveness. Less severely affected patients indicated higher satisfaction. The TSQM-1.4© helped to identify therapy non-responders, who mainly addressed dissatisfaction with effectiveness and convenience. We suggest introducing the TSQM-1.4© as an additional PRO in SMA into clinical practice., publishedVersion

Mitochondrial membrane protein-associated neurodegeneration is an autosomal-recessive disorder caused by C19orf12 mutations and characterized by iron deposits in the basal ganglia.The aim of this study was to quantify iron concentrations in deep gray matter structures using quantitative susceptibility mapping MRI and to characterize metabolic abnormalities in the pyramidal pathway using 1 H MR spectroscopy in clinically manifesting membrane protein-associated neurodegeneration patients and asymptomatic C19orf12 gene mutation heterozygous carriers.We present data of 4 clinically affected membrane protein-associated neurodegeneration patients (mean age: 21.0 ± 2.9 years) and 9 heterozygous gene mutation carriers (mean age: 50.4 ± 9.8 years), compared to age-matched healthy controls. MRI assessments were performed on a 7.0 Tesla whole-body system, consisting of whole-brain gradient-echo scans and short echo time, single-volume MR spectroscopy in the white matter of the precentral/postcentral gyrus. Quantitative susceptibility mapping, a surrogate marker for iron concentration, was performed using a state-of-the-art multiscale dipole inversion approach with focus on the globus pallidus, thalamus, putamen, caudate nucleus, and SN.In membrane protein-associated neurodegeneration patients, magnetic susceptibilities were 2 to 3 times higher in the globus pallidus (P = 0.02) and SN (P = 0.02) compared to controls. In addition, significantly higher magnetic susceptibility was observed in the caudate nucleus (P = 0.02). Non-manifesting heterozygous mutation carriers exhibited significantly increased magnetic susceptibility (relative to controls) in the putamen (P = 0.003) and caudate nucleus (P = 0.001), which may be an endophenotypic marker of genetic heterozygosity. MR spectroscopy revealed significantly increased levels of glutamate, taurine, and the combined concentration of glutamate and glutamine in membrane protein-associated neurodegeneration, which may be a correlate of corticospinal pathway dysfunction frequently observed in membrane protein-associated neurodegeneration patients. © 2019 International Parkinson and Movement Disorder Society.

International audience; We report bi-allelic pathogenic HPDL variants as a cause of a progressive, pediatric-onset spastic movement disorder with variable clinical presentation. The single-exon gene HPDL encodes a protein of unknown function with sequence similarity to 4-hydroxyphenylpyruvate dioxygenase. Exome sequencing studies in 13 families revealed bi-allelic HPDL variants in each of the 17 individuals affected with this clinically heterogeneous autosomal-recessive neurological disorder. HPDL levels were significantly reduced in fibroblast cell lines derived from more severely affected individuals, indicating the identified HPDL variants resulted in the loss of HPDL protein. Clinical presentation ranged from severe, neonatal-onset neurodevelopmental delay with neuroimaging findings resembling mitochondrial encephalopathy to milder manifestation of adolescent-onset, isolated hereditary spastic paraplegia. All affected individuals developed spasticity predominantly of the lower limbs over the course of the disease. We demonstrated through bioinformatic and cellular studies that HPDL has a mitochondrial localization signal and consequently localizes to mitochondria suggesting a putative role in mitochondrial metabolism. Taken together, these genetic, bioinformatic, and functional studies demonstrate HPDL is a mitochondrial protein, the loss of which causes a clinically variable form of pediatric-onset spastic movement disorder.

Background: 5q spinal muscular atrophy (SMA) is an autosomal recessive lower motoneuron disease caused by deletion or mutations in the survival motor neuron 1 gene (SMN1) which results in reduced expression of full-length SMN protein. The main symptoms are caused by spinal motor neuron demise leading to muscle atrophy, and medical care mostly refers to motor symptoms. However, new insights of recent studies in severe SMA type I revealed disease involvement of several non-motor regions, for example cardiac, vascular, sensory nerve involvement, and thalamic lesions. Non-motor symptoms (NMS) were previously described in many neurodegenerative diseases i.e., Parkinson's disease and, importantly, also amyotrophic lateral sclerosis. Methods: We screened for NMS in 70 adult patients with SMA type II (SMAII) and type III (SMAIII) and 59 age/sex-matched healthy controls (controls) in a multicenter cross-sectional study including 5 different centers with specialized expertise in medical health care of motoneuron diseases. We used a self-rating questionnaire including 30 different items of gastrointestinal, autonomic, neuropsychiatric, and sleep complaints [NMS questionnaire (NMSQuest)], which is a validated tool in Parkinson's disease. Results: Total NMS burden was low in adult SMA (median: 3 items) and not significantly different compared to controls (median: 2 items). Total NMS of SMA patients did not correlate with disease severity scores. However, the items "swallowing difficulties," "falling," and particularly "swelling legs" were significantly more frequently reported in SMA. Neuropsychiatric symptoms were reported in a frequency comparable to controls and were not significantly increased in SMA. Conclusion: Patient-reported prevalence of NMS in adult SMA was low, which does not argue for a clinically relevant multisystemic disorder in SMAII/III. Importantly, adult SMA patients do not seem to suffer more frequently from symptoms of depression or adaptive disorders compared to controls. Our results yield novel information on previously underreported symptoms and will help to improve the medical guidance of these patients. peerReviewed

Background It is a continuous matter of discussion whether immune activation by vaccination in general and Influenza vaccination in particular increases the risk for clinical deterioration of autoimmune diseases. This prospective study investigated the serological and clinical course of autoimmune Myasthenia gravis (MG) after a seasonal influenza vaccination. Methods This randomized, placebo-controlled, double-blind study enrolled MG patients with antibodies against acetylcholine-receptors (AChR-ab). They were allocated to receive seasonal influenza vaccine or placebo. The primary endpoint was the relative change of AChR-ab-titer over 12 weeks. A relative increase of 20% was set as non-inferiority margin. Secondary endpoints were clinical changes in the modified Quantitative Myasthenia Gravis Score (QMG), increase of anti-influenza-ELISA-antibodies, and changes of treatment. The study is registered with Clinicaltrialsregister.eu, EudraCT number 2006-004374-27. Findings 62 patients were included. Mean ± standard deviation (median) in the vaccine and placebo group were AChR-ab-titer changes of − 6.0% ± 23.3% (− 4.0%) and − 2.8% ± 22.0% (− 0.5%) and QMG score changes of − 0.08 ± 0.27 (0.17) and 0.11 ± 0.31 (0.00), respectively. The difference between groups (Hodges-Lehmann estimate with 95% CI) was - for the AChR-ab-titer change 4·0% [− 13.3%, 4.5%] (p = 0.28 for testing a difference, p, Highlights • The ProPATIent trial is the first RCT on seasonal influenza vaccination in Myasthenia gravis (MG). • Vaccination neither affects the titer of the acetylcholine receptor antibody, nor muscle strength of clinically stable MG patients. • Patients receiving standard immunosuppressive therapy can show a low vaccination response according to WHO recommendations. • In patients receiving standard immunosuppressive therapy a second dose of seasonal influenza vaccination should be considered. Evidence from randomized controlled trials about the safety of influenza vaccinations in patients with myasthenia gravis was non-existent before this study. 2 retrospective studies implied that vaccinations were safe without aggravation of clinical symptoms. With the evidence derived from the present randomized controlled trial, it can now be concluded that patients with myasthenia gravis do not experience a clinically relevant increase in AChR-antibody titers. Furthermore the slightly higher incidence of flu-like symptoms in the verum group does not change risk-benefit ratio in MG patients, Hence, the ProPATIent-trial provides class 1b evidence, that the risk-benefit ration of influenza vaccination in autoimmune MG is positive. Therefore vaccination should be recommended in this patient group. Since myasthenia gravis is an index disease for antibody-mediated autoimmunity, this finding can be postulated for other antibody-mediated autoimmune disorders. Presumably, the use of other attenuated vaccines may be similarly safe, but should be studied further. The finding of a reduced immune response, particularly in the subgroup of patients receiving immunosuppressive therapy indicates the need to investigate the effect of a second vaccine dose in these patients. The current study is the first randomized placebo-controlled trial to show that seasonal influenza vaccination of myasthenia gravis patients does not induce clinically relevant changes in the titer of antibodies against the acetylcholine receptor, independent of immunosuppressive treatment.

Motor neuron diseases (MNDs) encompass an extensive and heterogeneous group of upper and/or lower motor neuron degenerative disorders, in which the particular clinical outcomes stem from the specific neuronal component involved in each condition. While mutations in a large number of molecules associated with lipid metabolism are known to be implicated in MNDs, there remains a lack of clarity regarding the key functional pathways involved, and their inter-relationships. This review highlights evidence that defines defects within two specific lipid (cholesterol/oxysterol and phosphatidylethanolamine) biosynthetic cascades as being centrally involved in MND, particularly hereditary spastic paraplegia. We also identify how other MND-associated molecules may impact these cascades, in particular through impaired organellar interfacing, to propose 'subcellular lipidome imbalance' as a likely common pathomolecular theme in MND. Further exploration of this mechanism has the potential to identify new therapeutic targets and management strategies for modulation of disease progression in hereditary spastic paraplegias and other MNDs.

Objective: We prospectively screened a large European cohort of patients presenting with hyperCKemia and/or limb-girdle muscular weakness (LGMW) for acid α-glucosidase (GAA) deficiency by dried blood spot (DBS) investigation. Methods: DBS were collected from 3,076 consecutive adult patients from 7 German and British neuromuscular centers. All specimens were investigated for GAA deficiency by fluorometry. Samples with reduced enzyme activity were subsequently investigated for GAA gene mutations. Results: Of 3,076 patients with DBS samples, 232 patients (7.6%) showed low GAA enzyme activity. Of these 232 patients, 55 (24%) presented with isolated hyperCKemia and 176 (76%) with hyperCKemia and LGMW. With both features present, 94% of the patients showed a low enzymatic activity. Mutational analysis found GAA gene mutations in 74 patients (2.4%); herein 70 patients were heterozygote for the common GAA gene splice-site mutation c.-32-13T>G. The most common clinical presentation in the confirmed Pompe cohort was a limb-girdle phenotype (85.3%) combined with ventilatory insufficiency (61%). Isolated hyperCKemia was found in 12%, while 2.7 had hyperCKemia and ventilatory insufficiency only. Conclusions: In a large cohort of unselected adult patients with hyperCKemia and/or LGMW, we found a prevalence of late-onset Pompe disease of 2.4%. Therefore, targeted screening of such a population should be encouraged in clinical practice.

Patients with late-onset Pompe disease receiving enzyme replacement therapy (ERT) usually develop IgG antibodies against algucosidase alpha (anti-rhGAA) within the first 3 months. The role of these antibodies in adults is not fully understood. Patel et al. recently published an article entitled: ‘The impact of antibodies in late-onset Pompe disease: a case series and literature review’, Mol. Genet. Metab. 106 (2012) 301-9 [1]. They describe three adult Pompe patients with high, sustained antibody titers (HSAT = anti-rhGAA IgG titer > 1: 51,200 on two or more occasions at or beyond 6 months on ERT) associated with deterioration under ERT.

To determine the frequency and impact of gastrointestinal symptoms, and bowel and urinary incontinence, as this is currently unknown in adults with Pompe disease.Adult German Pompe patients and age- and gender-matched controls were asked about symptoms in the upper and lower intestinal tract as well as urinary incontinence using the Gastrointestinal Symptoms Questionnaire and the International Consultation on Incontinence Questionnaires for Bowel Symptoms and Urinary Incontinence.The overall response rate was 78%; 57 patients and 57 controls participated. The mean age of the patients was 48.3 years ±14.7 (28 female, 29 male). 84% of patients were receiving enzyme replacement therapy. Stool urgency, diarrhoea, and urinary urge incontinence were reported significantly more frequently in patients compared to the age- and gender-matched controls (55%, 56%, 33% vs. 20%, 18%, 7%). 20% of Pompe patients used loperamide daily against diarrhoea. No other gastrointestinal tract-related symptoms were reported to occur more frequently in Pompe patients than in controls.Compared to age- and gender-matched controls, both urinary and bowel incontinence occur in a higher frequency in adults with Pompe disease and have a major impact on daily life.

Background Myofibrillar myopathies (MFM) are a group of phenotypically and genetically heterogeneous neuromuscular disorders, which are characterized by protein aggregations in muscle fibres and can be associated with multisystemic involvement. Methods We screened a large cohort of 38 index patients with MFM for mutations in the nine thus far known causative genes using Sanger and next generation sequencing (NGS). We studied the clinical and histopathological characteristics in 38 index patients and five additional relatives (n = 43) and particularly focused on the associated multisystemic symptoms. Results We identified 14 heterozygous mutations (diagnostic yield of 37%), among them the novel p.Pro209Gln mutation in the BAG3 gene, which was associated with onset in adulthood, a mild phenotype and an axonal sensorimotor polyneuropathy, in the absence of giant axons at the nerve biopsy. We revealed several novel clinical phenotypes and unusual multisystemic presentations with previously described mutations: hearing impairment with a FLNC mutation, dysphonia with a mutation in DES and the first patient with a FLNC mutation presenting respiratory insufficiency as the initial symptom. Moreover, we described for the first time respiratory insufficiency occurring in a patient with the p.Gly154Ser mutation in CRYAB. Interestingly, we detected a polyneuropathy in 28% of the MFM patients, including a BAG3 and a MYOT case, and hearing impairment in 13%, including one patient with a FLNC mutation and two with mutations in the DES gene. In four index patients with a mutation in one of the MFM genes, typical histological findings were only identified at the ultrastructural level (29%). Conclusions We conclude that extraskeletal symptoms frequently occur in MFM, particularly cardiac and respiratory involvement, polyneuropathy and/or deafness. BAG3 mutations should be considered even in cases with a mild phenotype or an adult onset. We identified a genetic defect in one of the known genes in less than half of the MFM patients, indicating that more causative genes are still to be found. Next generation sequencing techniques should be helpful in achieving this aim.

Background: Tubular aggregate myopathies (TAMs) are muscle disorders characterised by abnormal accumulations of densely packed single-walled or double-walled membrane tubules in muscle fibres. Recently, STIM1, encoding a major calcium sensor of the endoplasmic reticulum, was identified as a TAM gene. Methods: The present study aims to define the clinical, histological and ultrastructural phenotype of tubular aggregate myopathy and to assess the STIM1 mutation spectrum. Results: We describe six new TAM families harbouring one known and four novel STIM1 mutations. All identified mutations are heterozygous missense mutations affecting highly conserved amino acids in the calcium-binding EF-hand domains, demonstrating the presence of a mutation hot spot for TAM. We show that the mutations induce constitutive STIM1 clustering, strongly suggesting that calcium sensing and consequently calcium homoeostasis is impaired. Histological and ultrastructural analyses define a common picture with tubular aggregates labelled with Gomori trichrome and Nicotinamide adenine dinucleotide (NADH) tetrazolium reductase, substantiating their endoplasmic reticulum origin. The aggregates were observed in both fibre types and were often accompanied by nuclear internalisation and fibre size variability. The phenotypical spectrum ranged from childhood onset progressive muscle weakness and elevated creatine kinase levels to adult-onset myalgia without muscle weakness and normal CK levels. Conclusions: The present study expands the phenotypical spectrum of STIM1-related tubular aggregate myopathy. STIM1 should therefore be considered for patients with tubular aggregate myopathies involving either muscle weakness or myalgia as the first and predominant clinical sign.

In congenital myasthenic syndrome with DOK7 mutations ephedrine was reported to be beneficial in single patients. We carried out a small, open and prospective cohort study in eight European patients manifesting from birth to 12 years. Five patients showed limb-girdle and facial weakness, three a floppy infant syndrome with bulbar symptoms and/or respiratory distress. Ephedrine was started with 25 mg/day and slowly increased to 75-100 mg/day. Within weeks after starting therapy an improvement was observed in all patients and clinical follow-up disclosed positive effects more pronounced on proximal muscle weakness and strength using MRC scale. Effects on facial weakness were less pronounced. Vital capacity measurements and repetitive stimulation tests did not improve in the same way as clinical symptoms did. These investigations are appropriate to confirm the diagnosis in case of pathological results, but they might not be appropriate means to monitor patients under ephedrine therapy.

Pompe disease is an autosomal recessive disorder of glycogen metabolism caused by a deficiency of the lysosomal enzyme acid alpha-glucosidase (GAA). It presents at any age, with variable rates of progression ranging from a rapidly progressive course, often fatal by one-year of age, to a more slowly, but nevertheless relentlessly progressive course, resulting in significant morbidity and premature mortality. In infants, early initiation of enzyme replacement therapy is needed to gain the maximum therapeutic benefit, underscoring the need for early diagnosis. Several new methods for measuring GAA activity have been developed. The Pompe Disease Diagnostic Working Group met to review data generated using the new methods, and to establish a consensus regarding the application of the methods for the laboratory diagnosis of Pompe disease. Skin fibroblasts and muscle biopsy have traditionally been the samples of choice for measuring GAA activity. However, new methods using blood samples are rapidly becoming adopted because of their speed and convenience. Measuring GAA activity in blood samples should be performed under acidic conditions (pH 3.8-4.0), using up to 2 mM of the synthetic substrate 4-methylumbelliferyl-alpha-D-glucoside or glycogen (50 mg/mL), in the presence of acarbose (3-9 microM) to inhibit the isoenzyme maltase-glucoamylase. The activity of a reference enzyme should also be measured to confirm the quality of the sample. A second test should be done to support the diagnosis of Pompe disease until a program for external quality assurance and proficiency testing of the enzymatic diagnosis in blood is established.

Dok ('downstream-of-kinase') family of cytoplasmic proteins play a role in signalling downstream of receptor and non-receptor phosphotyrosine kinases. Recently, a skeletal muscle receptor tyrosine kinase (MuSK)-interacting cytoplasmic protein termed Dok-7 has been identified. Subsequently, we and others identified mutations in DOK7 as a cause of congenital myasthenic syndromes (CMS), providing evidence for a crucial role of Dok-7 in maintaining synaptic structure. Here we present clinical and molecular genetic data of 14 patients from 12 independent kinships with 13 different mutations in the DOK7 gene. The clinical picture of CMS with DOK7 mutations is highly variable. The age of onset may vary between birth and the third decade. However, most of the patients display a characteristic 'limb-girdle' pattern of weakness with a waddling gait and ptosis, but without ophthalmoparesis. Respiratory problems were frequent. Patients did not benefit from long-term therapy with esterase inhibitors; some of the patients even worsened. DOK7 mutations have emerged as one of the major genetic defects in CMS. The clinical picture differs significantly from CMS caused by mutations in other genes, such as the acetylcholine receptor (AChR) subunit genes. None of the patients with DOK7 mutations had tubular aggregates in the muscle biopsy, implying that 'limb-girdle myasthenia (LGM) with tubular aggregates' previously described in literature may be a pathogenic entity distinct from CMS caused by DOK7 mutations.

Summary Background Pathogenic mitochondrial DNA (mtDNA) mutations are found in at least one in 8000 individuals. No effective treatment for mtDNA disorders is available, making disease prevention important. Many patients with mtDNA disease harbour a single pathogenic mtDNA deletion, but the risk factors for new cases and disease recurrence are not known. Methods We did a multicentre study of 226 families in which a single mtDNA deletion had been identified in the proband, including patients with chronic progressive external ophthalmoplegia, Kearns Sayre syndrome, or Pearson's syndrome. We studied the relation between maternal age and the risk of unaffected mothers having an affected child, and determined the recurrence risks among the siblings and offspring of affected individuals. Findings We noted no relation between maternal age and the risk of unaffected mothers having children with an mtDNA deletion disorder. None of the 251 siblings of the index cases developed clinical features of mtDNA disease. Risk of recurrence among the offspring of affected women was 4·11% (95% CI 0·86–11·54, or one in 117 to one in nine births). Only one of the mothers who had an affected child had a duplication of mtDNA in skeletal muscle. Interpretation Unlike nuclear chromosomal rearrangements, incidence of mtDNA deletion disorders does not increase with maternal age, and unaffected mothers are unlikely to have more than one affected child. Affected women were previously thought to have a negligible chance of having clinically affected offspring, but the actual risk is, on average, about one in 24 births.

To the Editor: A dominant missense mutation p.P56S in the vesicle associated membrane protein associated protein B (VAPB) gene was described in eight Brazilian families of Portuguese descent showing a wide spectrum of motor neuron diseases (MNDs) including spinal muscular atrophy (SMA) and familial amyotrophic lateral sclerosis (ALS) (ALS8) (1, 2). Haplotype analysis indicated a common ancestor with a founding event 23 generations previously, when this ancestor was still living in Portugal (3). We report the first identification of the p.P56S mutation in the VAPB gene in a non-Brazilian patient. A 43-year-old man (III-1) showed slowly progressive muscular weakness for 2 years and a family history of autosomal dominant neuromuscular disease through at least three generations (Fig 1). The patient's mother (II-1) suffered from slowly progressive muscular weakness over 30 years. No pyramidal tract signs had been observed. She was wheelchair bound 20 years after onset and died at the age of 67. The maternal grandfather (I-1) had a history of progressive muscular weakness, had died aged 57 and had six siblings. Three (I-5, I-6, I-7) suffered from muscular weakness. One cousin of the patient's mother (II-2) was diagnosed with SMA. There was no family record of Portuguese or Brazilian ancestors in at least four previous generations. All family members originated from northern Germany. Fig. 1 Family tree. Family members who are deemed affected based upon family history are marked gray. It is not known if family members I-2, I-3, I-4, I-5, I-6, I-7, and II-2 are still alive. The index patient (III-1) showed paresis of the hip flexors and extensors (Medical Research Council (MRC) grade 4/5) and fasciculations in the proximal muscles of arms, legs on both sides. Deep tendon reflexes were normal except for absent Achilles tendon reflexes. There were no pyramidal tract signs. Needle electromyography showed fasciculations and signs of chronic denervation. Nerve conduction studies of tibial nerves revealed slightly reduced amplitudes on the left. Motor evoked potentials in both tibialis anterior muscles after magnetic stimulation of the motor cortex and the lumbar roots were normal. Genomic DNA of the index case was extracted from peripheral blood and amplified using primer pairs flanking all exons and exon/intron boundaries of the VAPB gene. Amplicons were purified and sequenced directly on an ABI PRISM 310 Genetic Analyzer (PE, Applied Biosystems). The p.P56S mutation was screened in 100 German healthy controls. Haplotype analysis was performed using microsatellite markers D20S100, D20S171 and D20S173 from the ABI Prism Linkage Mapping Set kit version 2 (Applied Biosystems, Foster City, CA) as reported previously (3). The forward 5′AAGACAAGCAAAACTAAAGAACTGC3′and reverse 5′TTCCCATTACCGGTTATCCA-3′ primers were used to amplify part of 3′ UTR sequence of the tubulin beta 1 (TUBB1) gene. A polymorphism in this region was used as intrafamilial marker. Polymerase chain reaction products were analyzed using a MegaBace 1000 DNA Sequencer (Amersham Bioscience, Little Chalfont, UK). DNA from the index patient was compared to three affected individuals from three different kindreds of the Brazilian families. Sequencing revealed a heterozygous p.P56S point mutation in exon 2 of the VAPB gene. This mutation was not present in 200 German control chromosomes. Haplotype analysis revealed that this patient had a different haplotype compared to the Brazilian families (Table 1). Table 1 Haplotype comparison of the German index patient and the patients from three different Brazilian families with the p.P56S vesicle associated membrane protein associated protein B (VAPB) gene mutationa The phenotype of our index case and his mother represented late onset SMA as observed in one-third of the Brazilian patients carrying the p.P56S VAPB mutation (1). Although we cannot entirely exclude the possibility of Brazilian or Portuguese ancestors, haplotype analysis showed that our patient's mutation is not due to the same founder as in the reported Brazilian patients. Therefore, we assume that the p.P56S mutation happened in at least two independent events. Several studies failed to identify VAPB mutations in cohorts of patients with ALS (4–6)]. Mutations in the VAPB gene seem to be rare in familial MNDs. However, our case report demonstrates that the p.P56S mutation can be observed outside Brazil, and should be considered as a rare differential diagnosis in familial MNDs.

BACKGROUND Muscle water T2 (T2w ) has been proposed as a biomarker to monitor disease activity and therapy effectiveness in patients with neuromuscular diseases (NMD). Multi-echo spin-echo (MESE) is known to be affected by fatty infiltration. A T2 -prepared 3D turbo spin echo (TSE) is an alternative method for T2 mapping, but has been only applied in healthy muscles. PURPOSE To examine the performance of T2 -prepared 3D TSE in combination with spectral adiabatic inversion recovery (SPAIR) in measuring T2w in fatty infiltrated muscles based on simulations and in vivo measurements in thigh muscles of patients with NMD. STUDY TYPE Prospective. SUBJECTS One healthy volunteer, 34 NMD patients. FIELD STRENGTH/SEQUENCE T2 -prepared stimulated echo acquisition mode (STEAM) magnetic resonance spectroscopy (MRS), SPAIR STEAM MRS, and SPAIR T2 -prepared STEAM MRS were performed in the subcutaneous fat of a healthy volunteer's thigh. T2 mapping based on SPAIR 2D MESE and SPAIR T2 -prepared 3D TSE was performed in the NMD patients' thigh region. Multi-TE STEAM MRS was performed for measuring a reference T2w at different thigh locations. ASSESSMENT The behavior of the fat spectrum in the SPAIR T2 -prepared 3D TSE was simulated using Bloch simulations. The in vivo T2 results of the imaging methods were compared to the in vivo T2w MRS results. STATISTICAL TESTS Pearson correlation coefficient with slope and intercept, relative error. RESULTS The simulated T2 for the SPAIR T2 -prepared 3D TSE sequence remained constant within a relative error of not more than 4% up to a fat fraction of 80%. In vivo T2 values of SPAIR T2 -prepared 3D TSE were in good agreement with the T2w values of STEAM MRS (R = 0.86; slope = 1.12; intercept = -1.41 ms). In vivo T2 values of SPAIR 2D MESE showed large deviations from the T2w values of STEAM MRS (R = 0.14; slope = 0.32; intercept = 38.83 ms). DATA CONCLUSION The proposed SPAIR T2 -prepared 3D TSE shows reduced sensitivity to fatty infiltration for T2w mapping in the thigh muscles of NMD patients. LEVEL OF EVIDENCE 1 Technical Efficacy: Stage 1 J. Magn. Reson. Imaging 2020;51:1727-1736.