Search

Ethiopia is one of the most ethnically and culturally diverse countries. Here, the authors look at genetic and cultural variation in 1,214 Ethiopians to unravel the relationship between genetic admixture and cultural factors.

Plant micropropagation research in Ethiopia requires concerted efforts to meet desired levels of application for sustainable utilization of the country's diverse plant genetic resources. The purpose of the present review is to provide an update on the results of plant micropropagation conducted so far in Ethiopia. It assessed their strengths and identified gaps in order to standardize research methods and indicate future research directions. Two cereals, three oil crops, three spices, five medicinal plants, two high-value crops, six fruit plants, nine root crops, and one endangered multipurpose shrub were reviewed. The assessment of previously published research was carried out in terms of methods used in the selection of ex plants and their disinfestations, culture vessels, and media used with a variety of combinations and concentrations of plant growth regulators, macro- and micronutrient requirements, culture environments, and genetic stability of regenerated plantlets. Further assessments include the utilization of plant growth-promoting microbes and applications of “omics” research in order to establish standardized, efficient, and cost-effective micropropagation techniques. The findings of the assessments are summarized and current advances are highlighted, along with recommendations for future plant micropropagation studies in the country.

Abstract Background Korarima (Aframomum corrorima) is a perennial and aromatic herb native and widely distributed in southwestern Ethiopia. It is known for its fine flavor as a spice in various Ethiopian traditional dishes. Few molecular studies have been performed on this species so far. In the present paper, the ISSR technique was employed to study the genetic diversity in populations of cultivated A. corrorima. Results Seven ISSR primers produced a total of 86 clearly scorable DNA bands. High levels of genetic diversity were detected in cultivated A. corrorima (percentage of polymorphic bands = 97.67%, gene diversity = 0.35, Shannon’s information index = 0.52). Analysis of molecular variance (AMOVA) showed that 27.47% of the variation is attributed to the variation among populations and 72.53% to the variation within populations. The Fst (0.28) value showed a significant (p

Abstract Background Korarima [Aframomum corrorima (Braun) P.C.M. Jansen] is a spice crop native to Ethiopia. Understanding the extent and partitioning of diversity within and among crop landraces and their wild relatives is among the first steps in conserving and measuring their genetic potential. The present study is aimed at characterizing the population genetic structure and relationships between cultivated and wild korarima in the southwestern part of Ethiopia. Results We analyzed a total of 195 individuals representing seven wild and fourteen cultivated populations. Eleven polymorphic simple sequence repeat (SSR) markers were used. We observed a total of 53 alleles across the eleven loci and individuals. In total, 32 alleles were detected in the cultivated populations, whereas 49 alleles were detected in the wild populations. We found higher genetic diversity in wild populations than in the cultivated counterpart. This result implies the potential of wild korarima as a possible source for novel alleles contributing to the improvement of cultivated korarima. Analysis of molecular variance (AMOVA) showed significant but low differentiation between cultivated and wild korarima populations. Similarly, neighbour-joining and STRUCTURE analyses did not group cultivated and wild populations into two distinct clusters. The lack of clear differentiation between cultivated and wild populations could be explained by historical and contemporary gene flow between the two gene pools. Conclusion The 11 SSR loci developed in this study could be employed to examine genetic diversity and population structure of korarima in other countries as well as other Aframomum species. From the five administrative zones considered in this study, the Bench-Magi and Sheka zone showed populations with high genetic diversity, and these populations could be used as a potential starting point for in-situ and ex-situ germplasm conservation and korarima improvement through breeding programs after proper agronomic evaluation.

The aim of this study was to evaluate the potential of noug as a source for human nutrition. Diverse noug genotypes were evaluated for their content and/or composition of total lipids, fatty acids, proteins, and minerals using standard methods. The total lipid content (32.5–45.7%) and the proportion of an essential fatty acid, linoleic acid (72.2–77.8%), were high in noug, compared to other oilseed crops. The proportion of oleic acid, a monounsaturated fatty acid, was low in noug (5.2–9.2%). The breeding objective of increasing the oleic acid level in the highland, where noug is mainly cultivated, was limited, as the content of this acid was low in this environment. The seed protein concentration (25.4–27.5%) and mineral content were mainly affected by the cultivation environment, as the high temperature increased the amount of protein, whereas the soil condition was a major factor in the variation of the mineral content. Thus, noug is a unique crop with a high seed oil content, of which a high proportion is linoleic acid. With the exception of the seed oleic acid content, when grown in low-altitude areas, the genotypic variation contributes less than the cultivation environment to the nutritional attributes of noug. Hence, high-oleic-acid noug for lowland production can be targeted as a breeding goal.

For hares (Lepus spp., Leporidae, Lagomorpha, Mammalia) from Ethiopia no conclusive molecular phylogenetic data are available. To provide a first molecular phylogenetic model for the Abyssinian Hare (Lepus habessinicus), the Ethiopian Hare (L. fagani), and the Ethiopian Highland Hare (L. starcki) and their evolutionary relationships to hares from Africa, Eurasia, and North America, we phylogenetically analysed mitochondrial ATPase subunit 6 (ATP6; n = 153 / 416bp) and nuclear transferrin (TF; n = 155 / 434bp) sequences of phenotypically determined individuals. For the hares from Ethiopia, genotype composition at twelve microsatellite loci (n = 107) was used to explore both interspecific gene pool separation and levels of current hybridization, as has been observed in some other Lepus species. For phylogenetic analyses ATP6 and TF sequences of Lepus species from South and North Africa (L. capensis, L. saxatilis), the Anatolian peninsula and Europe (L. europaeus, L. timidus) were also produced and additional TF sequences of 18 Lepus species retrieved from GenBank were included as well. Median joining networks, neighbour joining, maximum likelihood analyses, as well as Bayesian inference resulted in similar models of evolution of the three species from Ethiopia for the ATP6 and TF sequences, respectively. The Ethiopian species are, however, not monophyletic, with signatures of contemporary uni- and bidirectional mitochondrial introgression and/ or shared ancestral polymorphism. Lepus habessinicus carries mtDNA distinct from South African L. capensis and North African L. capensis sensu lato; that finding is not in line with earlier suggestions of its conspecificity with L. capensis. Lepus starcki has mtDNA distinct from L. capensis and L. europaeus, which is not in line with earlier suggestions to include it either in L. capensis or L. europaeus. Lepus fagani shares mitochondrial haplotypes with the other two species from Ethiopia, despite its distinct phenotypic and microsatellite differences; moreover, it is not represented by a species-specific mitochondrial haplogroup, suggesting considerable mitochondrial capture by the other species from Ethiopia or species from other parts of Africa. Both mitochondrial and nuclear sequences indicate close phylogenetic relationships among all three Lepus species from Ethiopia, with L. fagani being surprisingly tightly connected to L. habessinicus. TF sequences suggest close evolutionary relationships between the three Ethiopian species and Cape hares from South and North Africa; they further suggest that hares from Ethiopia hold a position ancestral to many Eurasian and North American species.

The human FMO2 (flavin-containing monooxygenase 2) gene has been shown to be involved in innate immunity against microbial infections, including tuberculosis (TB), via the modulation of oxidative stress levels. It has also been found to possess a curious loss-of-function mutation (FMO2*1/FMO2*2) that demonstrates a distinctive differentiation in expression, function and ethno-geographic distribution. However, despite evidences of ethnic-specific genetic associations in the inflammatory profile of TB, no studies were done to investigate whether these patterns of variations correlate with evidences for the involvement of FMO2 in antimicrobial immune responses and ethnic differences in the distribution of FMO2 polymorphisms except for some pharmacogenetic data that suggest a potentially deleterious role for the functional variant (FMO2*1). This genetic epidemiological study was designed to investigate whether there is an association between FMO2 polymorphisms and TB, an ancient malady that remains a modern global health concern, in a sub-Saharan Africa setting where there is not only a relatively high co-prevalence of the disease and the ancestral FMO2*1 variant but also where both Mycobcaterium and Homo sapiens are considered to have originated and co-evolved. Blood samples and TB related clinical data were collected from ascertained TB cases and unrelated household controls (n = 292) from 3 different ethnic groups in Ethiopia. Latent Mtb infection was determined using Quantiferon to develop reliable TB progression phenotypes. We sequenced exonic regions of FMO2.We identified for the first time an association between FMO2 and TB both at the SNP and haplotype level. Two novel SNPs achieved a study-wide significance [chr1:171181877(A), p = 3.15E-07, OR = 4.644 and chr1:171165749(T), p = 3.32E-06, OR = 6.825] while multiple SNPs (22) showed nominal signals. The pattern of association suggested a protective effect of FMO2 against both active and latent TB with distinct genetic variants underlying the TB-progression pathway. The results were robust for population stratification. Haplotype-based tests confirmed the SNP-based results with a single haplotype bearing the ancestral-and-functional FMO2*1 "C" allele ("AGCTCTACAATCCCCTCGTTGCGC") explaining the overall association (haplotype-specific-p = 0.000103). Strikingly, not only was FMO2*1 nominally associated with reduced risk to "Active TB" (p = 0.0118, OR = 0.496) but it also does not co-segregate with the 5'-3' flanking top high-TB-risk alleles. The study provides an evidence for the existence of an evolutionary adaptation to an ancient disease based on an ancestral genetic variant acting in a haplotypic framework in Ethiopian populations.

The Ari peoples of Ethiopia are comprised of different occupational groups that can be distinguished genetically, with Ari Cultivators and the socially marginalised Ari Blacksmiths recently shown to have a similar level of genetic differentiation between them (FST ≈ 0.023 - 0.04) as that observed among multiple ethnic groups sampled throughout Ethiopia. Anthropologists have proposed two competing theories to explain the origins of the Ari Blacksmiths as (i) remnants of a population that inhabited Ethiopia prior to the arrival of agriculturists (e.g. Cultivators), or (ii) relatively recently related to the Cultivators but presently marginalized in the community due to their trade. Two recent studies by different groups analysed genome-wide DNA from samples of Ari Blacksmiths and Cultivators and suggested that genetic patterns between the two groups were more consistent with model (i) and subsequent assimilation of the indigenous peoples into the expanding agriculturalist community. We analysed the same samples using approaches designed to attenuate signals of genetic differentiation that are attributable to allelic drift within a population. By doing so, we provide evidence that the genetic differences between Ari Blacksmiths and Cultivators can be entirely explained by bottleneck effects consistent with hypothesis (ii). This finding serves as both a cautionary tale about interpreting results from unsupervised clustering algorithms, and suggests that social constructions are contributing directly to genetic differentiation over a relatively short time period among previously genetically similar groups.

The manifestation of ethnic, blood type, & gender-wise population variations regarding Dermatoglyphic manifestations are of interest to assess intra-group diversity and differentiation. The present study reports on the analysis of qualitaive and quantitative finger Dermatoglyphic traits of 382 individuals cross-sectionally sampled from an administrative region of Ethiopia, consisting of five ethnic cohorts from the Afro-Asiatic & Nilo-Saharan affiliations. These Dermatoglyphic parameters were then applied in the assessment of diversity & differentiation, including Heterozygosity, Fixation, Panmixia, Wahlund's variance, Nei's measure of genetic diversity, and thumb & finger pattern genotypes, which were inturn used in homology inferences as summarized by a Neighbour-Joining tree constructed from Nei's standard genetic distance. Results revealed significant correlation between Dermatoglyphics & population parameters that were further found to be in concordance with the historical accounts of the ethnic groups. Such inductions as the ancient north-eastern presence and subsequent admixure events of the Oromos (PII= 15.01), the high diversity of the Amharas (H= 0.1978, F= 0.6453, and P= 0.4144), and the Nilo-Saharan origin of the Berta group (PII= 10.66) are evidences to this. The study has further tested the possibility of applying Dermatoglyphics in population genetic & anthropologic research, highlighting on the prospect of developing a method to trace back population origins & ancient movement patterns. Additionally, linguistic clustering was deemed significant for the Ethiopian population, coinciding with recent genome wide studies that have ascertained that linguistic clustering as to being more crucial than the geographical patterning in the Ethiopian context. Finally, Dermatoglyphic markers have been proven to be endowed with a strong potential as non-invasive preliminary tools applicable prior to genetic studies to analyze ethnically sub-divided populations and also to reveal the stratification mechanism in play.

Abstract  Complete sequences for the internal transcribed spacers of the 18s–26s nuclear ribosomal DNA were generated to establish phylogenetic relationships among five species of the genus Guizotia. Parsimony analysis and pairwise distance data produced a single tree with four clearly distinguished clades that accord with previously reported chromosomal data. The clades produced here have been discussed with reference to existing taxonomic treatments. It appears that Guizotia scabra ssp. scabra, G. scabra ssp. schimperi and Guizotia villosa have contributed to the origin of Guizotia abyssinica, the cultivated species of the genus. The present composition of the species of genus Guizotia and the subtribe the genus presently placed in are suggested to be redefined. [ABSTRACT FROM AUTHOR]

Wheat (Triticum spp.) landrace populations in Ethiopia are mostly species mixtures. However, no quantitative data is available with regard to their species components. We studied here 32 wheat landrace populations originating from two regions (Bale and Wello). A total of 2559 individual plants, 45–110 plants representing each population, were classified into their species components. Five tetraploid (2n = 4x = 28) and one hexaploid (2n = 6x = 42) wheat species were found in mixtures of varying proportions. These included the tetraploids Triticum durum Desf., Triticum turgidum L., Triticum aethiopicum Jakubz., Triticum polonicum L., Triticum dicoccon Schrank and the hexaploid Triticum aestivum L. Also found, however in a rare frequency, in two populations from Wollo was T. durum Desf. convar. durocompactoides Flaksb. (Triticum pyramidale Percival), which is a very dense spiked durum. Discriminant analysis using seven qualitative traits revealed 91.5% correct classification of the wheat species, beak awn and awn length with the most significant importance. Single species were found in eight of the populations; six were for T. durum and two for T. aethiopicum. Two to three species-combinations were the most frequent; a maximum of four species was recorded in one population. The highest diversity index (H′) observed was 0.44. T. durum was the most predominant species. The hexaploid T. aestivum was found in nine of the Wollo populations and, in one population, its frequency reached up to 35.5%. On altitudinal basis, no clear trend of clinal variation was observed both from the frequency distributions and H′ estimates. The results confirmed that Ethiopian wheats, despite the morphological overlaps, could be classified into their species components with high degree of certainty. For the future, therefore, genetic diversity estimations should be dissolved into their species components for more expeditious utilization and conservation of this important genetic resource. [ABSTRACT FROM AUTHOR]

Fifty grass pea (Lathyrus sativus L.) populations collected from different administrative regions and altitude classes in Ethiopia, were evaluated for variations of five morphological traits. Shannon-Weaver diversity index was calculated for traits, populations and altitude classes. Monomorphism was recorded in flower color (blue) for most of the populations. Olive seed colour was dominantly distributed in all regions with mean frequency of 50% while black seed colour is rare with mean frequency of 4% in Ethiopia. Much variability was observed within populations. High diversity values for pattern of testa colour and leaflet size were recorded in populations of highland origin (>2550 m.a.s.l.). Shannon's diversity index is highest in Gondar (H' = 0.65) followed by Tigray region (H' = 0.64) even though there was no significant variation in H' values between regions. These regions with high diversity are recommended for immediate in situ and ex situ conservation. [ABSTRACT FROM AUTHOR]