249 results on '"De la Torre, L."'
Search Results
2. Incidence of medullary thyroid carcinoma and Hirschsprung disease based on the cosmos database
3. Standardization of radiograph readings during bowel management week
4. Photovoltaic power resource at the Atacama Desert under climate change
5. Do adult patients with congenital colorectal conditions know their diagnosis?
6. An event-based adaptation of the relay feedback experiment for frequency response identification of stable processes
7. Acrylonitrile, an advantageous precursor to synthesize nitrogen doped carbon nanotubes
8. Experimental Energy Performance Assessment of a Simplified Building: Study of Robustness of Different Analysis Approaches under Different Test Conditions
9. Remote Control Laboratory Using EJS Applets and TwinCAT Programmable Logic Controllers
10. Sequence analysis of exons 30 and 31 of LAMA3 gene variants and its association with human papillomavirus infection predisposition: no evidence was found.
11. Two Web-Based Laboratories of the FisL@bs Network: Hooke's and Snell's Laws
12. Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha0-thalassemia deletions - -Mex1 and - -Mex2
13. Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2: 2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients
14. Incisional Hernia: Plastic Aspects, Component Separation, Technical Details & Pediatrics
15. EasyJava Simulations meets TwinCAT: Remote Real-Time Control Experiments using Programmable Logic Controllers
16. Enhancing Virtual and Remote Labs to Perform Automatic Evaluation
17. Annular versus Nonannular Variability of the Northern Hemisphere Atmospheric Circulation
18. Social determinants in the access to health care for Chagas disease: A qualitative research on family life in the 'Valle Alto' of Cochabamba, Bolivia
19. Fetal hemoglobin regulating genetic variants identified in homozygous (HbSS) and heterozygous (HbSA) subjects from South Mexico.
20. Decrease in Nuclear Feulgen-Positive Material (DNA) upon Aging in in Vitro Storage of Bovine Spermatozoa
21. Baroclinic Rossby wave forcing and barotropic Rossby wave response to stratospheric vortex variability
22. Mutational spectrum of the iduronate-2-sulfatase gene in Mexican patients with Hunter syndrome.
23. Analysis of the precipitation and cloudiness associated with COLs occurrence in the Iberian Peninsula
24. Interannual variability of cut-off low systems over the European sector: The role of blocking and the Northern Hemisphere circulation modes
25. Wave energy associated with the variability of the stratospheric polar vortex
26. Interannual Variability of the Annual Cycle of Temperature over Northern Africa
27. Two Approaches for Determining Extreme Years of Global Atmospheric Temperature
28. The Use of Equivalent Temperature to Analyse Climate Variability
29. Guidelines for the management of postoperative soiling in children with Hirschsprung disease.
30. Error traps and culture of safety in Hirschsprung disease.
31. Las razones geológicas de la minería del cobre.
32. Factors influencing metal price selection in mining feasibility studies
33. Follicular Development and Secretion of Ovarian Hormones during the Juvenile and Adult Reproductive Lives of the Myelin Mutant taiep Rat: An Animal Model of Demyelinating Diseases.
34. Corrigendum to 'Increase of upper troposphere/lower stratosphere wave baroclinicity during the second half of the 20th century'
35. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 -20 bp), and c.315+2T>G ( IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
36. Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha0-thalassemia deletions - -Mex1 and - -Mex2.
37. The differential of the strong product graphs.
38. A Comparison of Two Master-Worker Scheduling Methods.
39. PCN12 - Cost/Benefit Analysis of First Line Chronic Lymphocytic Leukemia (CLL) Treatments in Mexico
40. PCN110 - The Cost-Effectiveness of Bendamustine-Rituximab Versus Fludarabine-Rituximab for Patients with Indolent Non-Hodgkin’s Lymphoma (INHL) Who Have Progressed Following Treatment with Rituximab or a Rituximab-Containing Regimen in Mexico
41. PCN99 - The Cost-Effectiveness of Bendamustine Versus Fludarabine for the First-Line Treatment of Chronic Lymphocytic Leukemia (CLL) in Mexico
42. Changes in methadone maintenance therapy during and after pregnancy.
43. Increase of upper troposphere/lower stratosphere wave baroclinicity during the second half of the 20th century.
44. Quasi-biennial modulation of the Northern Hemisphere tropopause height and temperature.
45. Solar influence on Northern Annular Mode spatial structure and QBO modulation
46. Factors influencing metal price selection in mining feasibility studies.
47. PCN99 The Cost-Effectiveness of Bendamustine Versus Fludarabine for the First-Line Treatment of Chronic Lymphocytic Leukemia (CLL) in Mexico
48. PCN12 Cost/Benefit Analysis of First Line Chronic Lymphocytic Leukemia (CLL) Treatments in Mexico
49. Physics Experiments at the UNEDLabs Portal.
50. Techniques to enable FPGA based reconfigurable fault tolerant space computing.
Catalog
Books, media, physical & digital resources
Discovery Service for Jio Institute Digital Library
For full access to our library's resources, please sign in.