Search

Your search keyword '"De la Torre, L."' showing total 249 results

Search Constraints

Start Over You searched for: Author "De la Torre, L." Remove constraint Author: "De la Torre, L." Language english Remove constraint Language: english
249 results on '"De la Torre, L."'

Search Results

9. Remote Control Laboratory Using EJS Applets and TwinCAT Programmable Logic Controllers

10. Sequence analysis of exons 30 and 31 of LAMA3 gene variants and its association with human papillomavirus infection predisposition: no evidence was found.

11. Two Web-Based Laboratories of the FisL@bs Network: Hooke's and Snell's Laws

14. Incisional Hernia: Plastic Aspects, Component Separation, Technical Details & Pediatrics

18. Social determinants in the access to health care for Chagas disease: A qualitative research on family life in the 'Valle Alto' of Cochabamba, Bolivia

19. Fetal hemoglobin regulating genetic variants identified in homozygous (HbSS) and heterozygous (HbSA) subjects from South Mexico.

21. Baroclinic Rossby wave forcing and barotropic Rossby wave response to stratospheric vortex variability

22. Mutational spectrum of the iduronate-2-sulfatase gene in Mexican patients with Hunter syndrome.

25. Wave energy associated with the variability of the stratospheric polar vortex

29. Guidelines for the management of postoperative soiling in children with Hirschsprung disease.

30. Error traps and culture of safety in Hirschsprung disease.

31. Las razones geológicas de la minería del cobre.

32. Factors influencing metal price selection in mining feasibility studies

33. Follicular Development and Secretion of Ovarian Hormones during the Juvenile and Adult Reproductive Lives of the Myelin Mutant taiep Rat: An Animal Model of Demyelinating Diseases.

34. Corrigendum to 'Increase of upper troposphere/lower stratosphere wave baroclinicity during the second half of the 20th century'

35. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 -20 bp), and c.315+2T>G ( IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

36. Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha0-thalassemia deletions - -Mex1 and - -Mex2.

37. The differential of the strong product graphs.

42. Changes in methadone maintenance therapy during and after pregnancy.

43. Increase of upper troposphere/lower stratosphere wave baroclinicity during the second half of the 20th century.

45. Solar influence on Northern Annular Mode spatial structure and QBO modulation

46. Factors influencing metal price selection in mining feasibility studies.

49. Physics Experiments at the UNEDLabs Portal.

Catalog

Books, media, physical & digital resources