Search

Yu Chen Xu,1,&ast; Qiu Qin Wang,1,&ast; Meng Yuan Chen,1 Yu Jie Gao,1 Jia Yi Wang,1 Hao Tian Ge,1 Heng Weng,1 Ju Ping Chen,2 Gui Hua Xu1 1School of Nursing, Nanjing University of Chinese Medicine, Nanjing, 210023, People’s Republic of China; 2Department of Neurology, Changshu Hospital of Traditional Chinese Medicine, Suzhou, 215500, People’s Republic of China&ast;These authors contributed equally to this workCorrespondence: Gui Hua Xu, School of Nursing, Nanjing University of Chinese Medicine, Nanjing, 210023, People’s Republic of China, Email 7115@njucm.edu.cn Ju Ping Chen, Department of Neurology, Changshu Hospital of Traditional Chinese Medicine, Suzhou, 215500, People’s Republic of China, Email 1523515573@qq.comPurpose: Pain is a common yet undertreated symptom of Parkinson’s disease (PD). This study investigated the effect of Gua Sha therapy on pain in patients with PD.Patients and Methods: A total of 56 PD patients with pain were randomized into either the experimental group (n=28), receiving 12 sessions of Gua Sha therapy, or the control group (n=28) without additional treatment. Participants underwent assessment at baseline, after the twelfth invention, and at the 2-month follow-up timepoints. The primary outcome was KPPS and VAS. Secondary outcomes included UPDRS I–III, PDSS-2, HADS, PDQ-39, and blood biomarkers (5-HT, IL-8, IL-10).Results: The experimental group reported a significant improvement in pain severity, motor functions, affective disorder, and sleep quality (P < 0.05). Furthermore, increasing trends in both 5-HT and IL-10, as well as decreasing trends in IL-8 were observed. No serious adverse events occurred.Conclusion: The preliminary findings suggest that Gua Sha therapy may be effective and safe for alleviating pain and improving other disease-related symptoms in PD patients.Keywords: Parkinson’s disease, pain, Gua Sha therapy, randomized controlled trial

Xiang Wang,1,&ast; Jing Yu,2,&ast; Chong-Fang Han,3 Jian-Dong He,3 Wen-Qu Yang,3 Qi Wang,1 Jian-Ping Chen1 1Department of Pain Medicine, Shanxi Bethune Hospital, Shanxi Academy of Medical Sciences, Tongji Shanxi Hospital, Third Hospital of Shanxi Medical University, Taiyuan, People’s Republic of China; 2Department of Anesthesiology, Shanghai Pulmonary Hospital, School of Medicine, Tongji University, Shanghai, People’s Republic of China; 3Department of Anesthesiology Medicine, Shanxi Bethune Hospital, Shanxi Academy of Medical Sciences, Tongji Shanxi Hospital, Third Hospital of Shanxi Medical University, Taiyuan, People’s Republic of China&ast;These authors contributed equally to this workCorrespondence: Chong-Fang Han, Department of Anesthesiology Medicine, Shanxi Bethune Hospital, Shanxi Academy of Medical Sciences, Tongji Shanxi Hospital, Third Hospital of Shanxi Medical University, 99 Longcheng street, Xiaodian District Taiyuan, Shanxi, 030032, People’s Republic of China, Email 2590127710@qq.com; Hanchongfang2003@126.comPurpose: Globally, the incidence of herpes zoster (HZ) is increasing, and the resulting zoster-associated pain (ZAP) severely affects the quality of life of patients. Therefore, active treatment of ZAP and prevention of postherpetic neuralgia (PHN) are very important for patients in the early stage of the disease. This retrospective observational study aimed to evaluate the effect of CT-guided pulsed radiofrequency (PRF) combined with ozone injection on zoster-associated pain.Patients and Methods: From 2018 to 2020, 84 patients with AHN (n=28), SHN (n=32), or PHN (n=24) underwent PRF combined with ozone injection treatment after pharmacologic and conservative therapies failed. The visual analogue scale (VAS), the Pittsburgh Sleep Quality Index (PSQI), and pregabalin consumption were recorded at baseline, post-PRF, and at 1, 3, 6, and 12 months after treatment. The number of remediations performed and adverse reactions were recorded, and treatment inefficiency was calculated using a VAS score greater than 3 as the criterion.Results: The pooled results demonstrated statistically significant decreases in VAS scores, PSQI scores and consumption of pregabalin post-PRF and at 1, 3, 6, and 12 months follow-up (P< 0.05). Compared with the PHN group, both the AHN and SHN groups showed clinical and statistical improvement in VAS scores and PSQI scores and in consumption of pregabalin (P< 0.05). At 1 year after the operation, the PHN group had a significantly greater number of remediation events and greater treatment inefficiency than the other two groups. No serious adverse events were observed during the procedure or during the follow-up period.Conclusion: CT-guided PRF combined with ozone injection is safe and effective for individuals with ZAP, and its short-term and long-term effects are significant. In a sense, early PRF combined with ozone injection is more effective.Keywords: herpes zoster, zoster-associated pain, postherpetic neuralgia, radiofrequency, ozone

Ming-Ying Lan,1,2 Yen-Bin Hsu,1,2 Ming-Chin Lan,3,4 Jyh-Ping Chen,5– 8 Yu-Jen Lu9 1Department of Otolaryngology-Head and Neck Surgery, Taipei Veterans General Hospital, Taipei, Taiwan; 2School of Medicine, National Yang-Ming University, Taipei, Taiwan; 3Department of Otolaryngology-Head and Neck Surgery, Taipei Tzu Chi Hospital, Buddhist Tzu Chi Medical Foundation, New Taipei City, Taiwan; 4School of Medicine, Tzu Chi University, Hualien, Taiwan; 5Department of Chemical and Materials Engineering, Chang Gung University, Taoyuan, Taiwan; 6Department of Plastic and Reconstructive Surgery and Craniofacial Research Center, Chang Gung Memorial Hospital, Taoyuan, Taiwan; 7Research Center for Food and Cosmetic Safety, Research Center for Chinese Herbal Medicine, College of Human Ecology, Chang Gung University of Science and Technology, Taoyuan, Taiwan; 8Department of Materials Engineering, Ming Chi University of Technology, Taipei, Taiwan; 9Department of Neurosurgery, Chang Gung Memorial Hospital Linkuo Medical Center and College of Medicine, Chang Gung University, Taoyuan, TaiwanCorrespondence: Yu-Jen LuDepartment of Neurosurgery, Chang Gung Memorial Hospital Linkuo Medical Center and College of Medicine, Chang Gung University, Taoyuan, TaiwanEmail alexlu0416@gmail.comJyh-Ping ChenDepartment of Chemical and Materials Engineering, Chang Gung University, Taoyuan, TaiwanEmail jpchen@mail.cgu.edu.twIntroduction: Nasopharyngeal carcinoma (NPC) is a common cancer in southern China and Taiwan, and radiation therapy combined with or without chemotherapy is its mainstay treatment. Although it is highly sensitive to radiotherapy, local recurrence and distant metastasis remain difficult unsolved problems. In recent years, graphene oxide (GO) has been found to be a promising novel anticancer drug carrier. Here, we present our designed functionalized GO, polyethylene glycol-coated GO (GO-PEG), as a drug carrier, which was loaded with erlotinib and showed promising anticancer effects on NPC cells.Methods: The effects of GO-PEG-erlotinib on the proliferation, migration, and invasion of NPC cells were investigated by WST-8 assay, wound healing assay, and invasion assay, respectively. RNA sequencing was conducted and analyzed to determine the molecular mechanisms by which GO-PEG-erlotinib affects NPC cells.Results: Our results showed that GO-PEG-erlotinib reduced NPC cell viability in a dose-dependent manner and also inhibited the migration and invasion of NPC cells. The RNA sequencing revealed several related molecular mechanisms.Conclusion: GO-PEG-erlotinib effectively suppressed NPC cell proliferation, migration, and invasion, likely by several mechanisms. GO-PEG-erlotinib may be a potential therapeutic agent for treating NPC in the future.Keywords: nasopharyngeal carcinoma, anti-cancer, graphene oxide, erlotinib, drug carrier

Cheng-Jie Mao,1 Fen Wang,2 Ju-Ping Chen,3 Ya-Ping Yang,1 Jing Chen,1 Juan-Ying Huang,1 Chun-Feng Liu1,21Department of Neurology and Suzhou Clinical Research Center of Neurological Disease, the Second Affiliated Hospital of Soochow University, 2Institute of Neuroscience, Soochow University, Suzhou, 3Department of Neurology, Hospital of Changshu Traditional Chinese Medicine, Changshu, People’s Republic of China Objective: Hyposmia is one of the earliest non-motor features of Parkinson’s disease (PD) and can precede the onset of motor symptoms by years. Most of the current olfactory detection tests are targeted at Western populations. The exact relationship between hyposmia and cognitive impairment is unknown. The purpose of the study was to find bromines that can effectively identify olfactory dysfunction and investigate the relationship between hyposmia and cognitive function in early, non-demented, drug-naïve patients with PD in the People’s Republic of China.Methods: Sixty-three early, non-demented, drug-naïve patients with PD and 55 healthy controls were enrolled in the study. The T&T olfactometer and a Chinese version of Montreal Cognitive Assessment (MoCA) were applied to assess subjects’ olfactory and cognitive functions. Patients with PD also completed the Modified Unified Parkinson’s disease-rating scale (UPDRS) and Hoehn and Yahr (H&Y) scale.Results: Patients with PD had lower scores of visuospatial and executive function (p=0.000), attention (p=0.03), and delayed recall (p=0.001) than controls. β-phenylethyl alcohol (floral smell, smell of rose petals) and isovaleric acid (smell of sweat, stuffy socks) were more sensitive for identifying hyposmia in patients with PD than three other odors. Multivariate logistic regression analysis showed that impaired visuospatial and executive function was associated with hyposmia (p=0.013), but was independent of other PD-associated variables.Conclusion: Hyposmia was common in early, non-demented, drug-naïve PD patients. β-Phenylethyl alcohol and isovaleric acid were more superior for identifying hyposmia in early non-demented Chinese patients with PD. Hyposmia was associated with impaired visuospatial and executive function in patients with PD. Further prospective studies that apply a series of neuropsychological tests and functional magnetic resonance imaging methods in large samples in multicenter studies are needed to confirm our findings and to investigate the relationship between hyposmia and cognitive function with disease progression in patients with PD. Keywords: Parkinson’s disease, hyposmia, cognitive dysfunction

Guo-Jyun Lai,1,* KT Shalumon,1,* Jyh-Ping Chen1,2 1Department of Chemical and Materials Engineering, 2Research Center for Industry of Human Ecology, Chang Gung University of Science and Technology, Taoyuan, Taiwan, Republic of China *These authors contributed equally to this work Abstract: Incorporation of nanohydroxyapatite (nHAP) within a chitosan (CS)/silk fibroin (SF) nanofibrous membrane scaffold (NMS) may provide a favorable microenvironment that more closely mimics the natural bone tissue physiology and facilitates enhanced osteogensis of the implanted cell population. In this study, we prepared pristine CS/SF NMS, composite CS/SF/nHAP NMS containing intrafibrillar nHAP by in situ blending of 10% or 30% nHAP before the electrospinning step, and composite CS/SF/nHAP NMS containing extrafibrillar nHAP by depositing 30% nHAP through alternative soaking surface mineralization. We investigated the effect of the incorporation of HAP nanoparticles on the physicochemical properties of pristine and composite NMS. We confirmed the presence of ~30 nm nHAP in the composite nanofibrous membranes by thermogravimetry analysis (TGA), X-ray diffraction (XRD), and scanning electron microscopy (SEM), either embedded in or exposed on the nanofiber. Nonetheless, the alternative soaking surface mineralization method drastically influenced the mechanical properties of the NMS with 88% and 94% drop in Young’s modulus and ultimate maximum stress. Using in vitro cell culture experiments, we investigated the effects of nHAP content and location on proliferation and osteogenic differentiation of human bone marrow mesenchymal stem cells (hMSCs). The proliferation of hMSCs showed no significant difference among pristine and composite NMS. However, the extent of osteogenic differentiation of hMSCs was found to be positively correlated with the content of nHAP in the NMS, while its location within the nanofiber played a less significant role. In vivo experiments were carried out with hMSCs seeded in CS/SF/30%nHAP NMS prepared by in situ blending and subcutaneous implantation in nude mice. Micro-computed tomography images as well as histological and immunohistochemical analysis of the retrieved hMSCs/NMS construct 1 and 2 months postimplantation indicated that NMS had the potential for bone regeneration and can be suggested as a promising scaffold for bone tissue engineering. Keywords: chitosan, silk fibroin, hydroxyapatite, electrospinning, nanofibers, human bone marrow stem cells, bone tissue engineering

Shih-Hsien Chen,1 Chih-Hao Chen,1,2 KT Shalumon,1 Jyh-Ping Chen1,3 1Department of Chemical and Materials Engineering, 2Department of Plastic and Reconstructive Surgery, Chang Gung Memorial Hospital, College of Medicine, Chang Gung University, 3Research Center for Industry of Human Ecology, Chang Gung University of Science and Technology, Taoyuan, Taiwan, Republic of China Abstract: Peritendinous adhesion is one of the common complications encountered after tendon injury and subsequent surgery, and it can be minimized by introducing a physical barrier between the injured site and the surrounding tissue. An electrospun hyaluronic acid-grafted poly(caprolactone) (PCL-g-HA) nanofibrous membrane (NFM) is proposed as an alternative to current antiadhesion barrier films. HA is covalently grafted to surface-aminolyzed PCL nanofibers, using carbodiimide as the coupling agent. Pristine PCL and PCL-g-HA NFMs were characterized by scanning electron microscopy, thermogravimetric analysis, X-ray photoelectron spectroscopy, Fourier-transform infrared spectroscopy, and mechanical testing. In vitro cell culture with fibroblasts showed that PCL-g-HA NFMs reduced cellular adhesion on the membrane surface while maintaining cell proliferation. Animal experiments using a rabbit flexor digitorum profundus tendon model confirmed the efficacy of PCL-g-HA in reducing peritendinous adhesion, based on gross observation, histology, joint flexion-angle measurements, gliding tests, and biomechanical evaluation. Keywords: peritendinous adhesion, hyaluronic acid, polycaprolactone, antiadhesion, nanofibrous membranes, barrier film, surface grafting

Jyh-Ping Chen,1 Pei-Ching Yang,1 Yunn-Hwa Ma,2 Su-Ju Tu,3 Yu-Jen Lu1,41Department of Chemical and Materials Engineering, 2Department of Physiology and Pharmacology, 3Department of Medical Imaging and Radiological Sciences, Chang Gung University, Kwei-San, Taoyuan, Taiwan, Republic of China; 4Department of Neurosurgery, Chang Gung Memorial Hospital, Kwei-San, Taoyuan, Taiwan, Republic of ChinaBackground and methods: Silica-coated magnetic nanoparticle (SiO2-MNP) prepared by the sol-gel method was studied as a nanocarrier for targeted delivery of tissue plasminogen activator (tPA). The nanocarrier consists of a superparamagnetic iron oxide core and an SiO2 shell and is characterized by transmission electron microscopy, Fourier transform infrared spectroscopy, X-ray diffraction, superconducting quantum interference device, and thermogravimetric analysis. An amine-terminated surface silanizing agent (3-aminopropyltrimethoxysilane) was used to functionalize the SiO2 surface, which provides abundant —NH2 functional groups for conjugating with tPA.Results: The optimum drug loading is reached when 0.5 mg/mL tPA is conjugated with 5 mg SiO2-MNP where 94% tPA is attached to the carrier with 86% retention of amidolytic activity and full retention of fibrinolytic activity. In vitro biocompatibility determined by lactate dehydrogenase release and cell proliferation indicated that SiO2-MNP does not elicit cytotoxicity. Hematological analysis of blood samples withdrawn from mice after venous administration indicates that tPA-conjugated SiO2-MNP (SiO2-MNP-tPA) did not alter blood component concentrations. After conjugating to SiO2-MNP, tPA showed enhanced storage stability in buffer and operation stability in whole blood up to 9.5 and 2.8-fold, respectively. Effective thrombolysis with SiO2-MNP-tPA under magnetic guidance is demonstrated in an ex vivo thrombolysis model where 34% and 40% reductions in blood clot lysis time were observed compared with runs without magnetic targeting and with free tPA, respectively, using the same drug dosage. Enhanced penetration of SiO2-MNP-tPA into blood clots under magnetic guidance was confirmed from microcomputed tomography analysis.Conclusion: Biocompatible SiO2-MNP developed in this study will be useful as a magnetic targeting drug carrier to improve clinical thrombolytic therapy.Keywords: magnetic nanoparticles, drug delivery, thrombolysis, tissue plasminogen activator, silica

Yu-Jen Lu1,2,#, Hung-Wei Yang1,#, Sheng-Che Hung3, Chiung-Yin Huang2, Shin-Ming Li4, Chen-Chi M Ma4, Pin-Yuan Chen2, Hong-Chieh Tsai2, Kuo-Chen Wei2, Jyh-Ping Chen1 1Department of Chemical and Materials Engineering, Chang Gung University, Kwei-San, Taoyuan, Taiwan; 2Department of Neurosurgery, Chang Gung Memorial Hospital, Kwei-San, Taoyuan, Taiwan; 3Department of Radiology, Taipei Veterans General Hospital, Taipei, Taiwan; 4Department of Chemical Engineering, National Tsing Hua University, Hsinchu, Taiwan#These authors contributed equally to this workBackground: 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU), a commercial chemotherapeutic drug for treating malignant brain tumors, has poor thermal stability and a short half-life. Immobilization of BCNU on a nanocarrier might increase the thermal stability of BCNU and extend its half-life.Methods: Nanosized graphene oxide (GO) could be modified by polyacrylic acid (PAA) to improve the aqueous solubility and increase the cell penetration efficacy of the nanocarrier. PAA–GO intended as a drug carrier for BCNU was prepared and characterized in this study. The size and thickness of PAA–GO was investigated by transmission electron microscopy and atomic force microscopy, and the presence of PAA functional groups was confirmed by electron spectroscopy for chemical analysis and thermogravimetric analysis. BCNU was conjugated to PAA–GO by covalent binding for specific killing of cancer cells, which could also enhance the thermal stability of the drug.Results: Single layer PAA–GO (about 1.9 nm) with a lateral width as small as 36 nm was successfully prepared. The optimum drug immobilization condition was by reacting 0.5 mg PAA–GO with 0.4 mg BCNU, and the drug-loading capacity and residual drug activity were 198 µg BCNU/mg PAA–GO and 70%, respectively. This nanocarrier significantly prolonged the half-life of bound BCNU from 19 to 43 hours compared with free drug and showed efficient intracellular uptake by GL261 cancer cells. The in vitro anticancer efficacy of PAA–GO–BCNU was demonstrated by a 30% increase in DNA interstrand cross-linking and a 77% decrease in the IC50 value toward GL261 compared with the same dosage of free drug.Conclusion: Nanosized PAA–GO serves as an efficient BCNU nanocarrier by covalent binding. This nanocarrier will be a promising new vehicle for an advanced drug delivery system in cancer therapy.Keywords: graphene oxide, BCNU, glioma cells, drug delivery, thermal stability

Microplastics (MPs) are ubiquitous in the environment, and can adsorb organic contaminants (OCs) and be taken by various microorganisms and organisms, which could eventually lead to risk to humans. In this study, the phenotypic changes and metabolic profile alternations of zebrafish in the single- and co-exposure of MPs and phenanthrene (Phe) were investigated. The results showed that significantly higher tail malformation rate and edema rate in zebrafish induced by MPs can be enhanced due to the co-existence of Phe. The metabolomic analysis revealed that both synergistic and antagonistic effects of MPs and Phe on the metabolic alternation of zebrafish larvae exist, since unique perturbations of metabolites or pathways were found in all of the three exposure scenarios. Based on Partial least squares-discriminant analysis, porphine, ribose, and L-glutamic acid were the most important metabolites resulting in the difference between the treated and control groups in the MP exposure, Phe exposure and co-exposure, respectively. Two dysregulated pathways namely d-glutamine and D-glutamate metabolism, and alanine, aspartate and glutamate metabolism were significantly affected in the co-exposure while not in either of the single exposure. These findings provide new insights into the toxic effects of MPs on aquatic organisms, and further studies on combined effects of MPs and OCs are suggested to be conducted., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Background and Objectives: NOTCH3 pathologic variants cause cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL), which presents with stroke and dementia and is characterized by white matter hyperintensities (WMHs) on brain MRI. The R544C variant is a common pathologic variant in Taiwan, but not all carriers exhibit significant symptoms. We investigated whether WMHs occur before clinical symptoms in carriers with pathogenic variants, examined factors associated with WMHs, and explored their relationship with cognitive functions., Methods: We enrolled 63 R544C carriers without overt clinical disease (WOCD) and 37 age-matched and sex-matched noncarriers as controls from the Taiwan Precision Medicine Initiative data set. All participants underwent clinical interviews, comprehensive neuropsychological assessments, and brain MRI. We calculated total and regional WMH volumes, determined the age at which WMHs began increasing in carriers, and examined the relationship between WMHs and neuropsychological performance. Factors associated with WMH volumes were analyzed using multivariable linear regression models., Results: Compared with controls, R544C carriers WOCD had increased WMH volume, except in the occipital and midbrain areas, and showed a rapid increase in WMHs starting at age 48. They scored lower on the Mini-Mental State Examination (median = 28.4 vs 29.0, p = 0.048), Montreal Cognitive Assessment (MoCA) (median = 28.3 vs 29.0, p = 0.013), and memory and executive function tests than controls. After adjusting for age, sex, and education, MoCA scores were associated with whole-brain (r = -0.387, p adj = 0.008) and regional WMHs (all p adj < 0.05) except in the midbrain area. Age (β = 0.034, 95% CI 0.021-0.046, p < 0.001), hypercholesterolemia (β = 0.375, 95% CI 0.097-0.653, p = 0.009), and the vascular risk factor (VRF) index (β = 0.132, 95% CI 0.032-0.242, p = 0.019) were associated with the WMH severity in carriers., Discussion: Our study revealed that WMHs are extensively distributed in R544C carriers WOCD. They exhibited a rapid increase in WMHs beginning at age 48, approximately 7 years earlier than the reported age at symptomatic onset. Age was the strongest predictive factor of WMHs, and VRF, particularly hypercholesterolemia, might be modifying factors of WMHs.

Glioma poses a serious threat to human health and has a high mortality rate. Therefore, developing natural anti-tumour drugs for cancer treatment is an urgent priority. Schizophyllum commune is an edible and medicinal fungus, with polysaccharides as its main active components, which may have anti-tumour properties. Herein, we characterised S. commune fruiting body polysaccharides (SCFP) structure and evaluated its anti-glioma activity in vitro and in vivo. UV and FTIR spectra, high-performance gel chromatography, and monosaccharide composition analyses demonstrated that SCFP was a heteropolysaccharide with a molecular weight of 290.92 kDa. Among the monosaccharide compositions, mannose, galactose, and glucose were the most abundant. SCFP significantly inhibited the survival of the glioma cell lines U251 and U-87MG. U251 xenograft tumours treated with SCFP via gavage showed a 47.39 % inhibition, with no significant toxic side effects observed. SCFP upregulated aplasia Ras homologue member I (ARHI) expression, thereby regulating PI3K/AKT signalling, inhibiting tumour migration, and inducing apoptosis, to inhibit tumour growth. Furthermore, SCFP treatment increased the relative abundance of beneficial bacteria, including Akkermansia muciniphila, Ligilactobacillus murinus, and Parabacteroides goldsteinii, in tumour-bearing mice and restored the gut microbiota structure to that of the normal group (NG group) mice without tumours. Thus, SCFP has the potential for application as a natural anticancer drug., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. We declare that we do not have any commercial or related interests that conflict with our work., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Aim: To prospectively assess the value of a test bolus of diluted contrast medium (CM) combined with a personalized contrast protocol in craniocervical computed tomography angiography (cc-CTA) with low radiation and CM doses., Materials and Methods: Eighty-six consecutive subjects were divided into two groups at random (43 in each one): group A: 100/Sn140 kVp, filtered back-projection reconstruction, iopromide (370 mgI/ml) 50 ml; group B: 80/Sn140 kVp, iterative reconstruction, iodixanol (270 mgI/ml). In group B, the test bolus contained 27 ml of diluted CM, a personalized protocol with low-concentration CM was used for angiography, and the test bolus injection duration in angiography remained the same. Artery values over 200 Hounsfield units were considered significant., Results: Image quality for all cases was found to be diagnostic. No significant differences were found in the arterial densities of the ascending aorta or basilar artery between the groups. The values of the common carotid artery, internal carotid artery, and middle cerebral artery in group B were significantly lower. The effective dose and average iodine uptake were significantly lower in group B., Conclusion: With double-low-dose cc-CTA, test bolus scanning based on diluted CM combined with a personalized contrast protocol can yield diagnostic-quality images and significantly reduce the radiation and CM doses., (Copyright © 2024 The Authors. Published by Elsevier Ltd.. All rights reserved.)

Aim: To investigate parenting and mother-child interactions in unaffected siblings of autistic children., Method: This cross-sectional study enrolled 274 probands with a DSM-5 diagnosis of autism spectrum disorder (ASD) (87.4% male; mean [SD] age = 11 years 4 months [3 years 2 months]), their unaffected siblings (n = 274, 46.72% male; mean [SD] age = 11 years 3 months [3 years 4 months]), and 296 age-balanced and sex-balanced typically developing children (82.77% male; mean [SD] age = 11 years 3 months [2 years 8 months]). Maternal parenting styles and mother-child interactions were assessed using maternal reporting., Results: Regardless of the child's age, maternal educational level, or presence of attention-deficit/hyperactivity disorder, autistic children received more overprotective and controlling parental behaviour than unaffected children. Correlates for parenting, mother-child interactions, and behavioural problems in the home setting in children with ASD and typically developing children were autistic traits, maternal anxiety and depressive symptoms, and maternal autistic characteristics; those in unaffected siblings were age, autistic traits, maternal educational level, and maternal autistic characteristics., Interpretation: The diagnosis of ASD in a child can significantly influence maternal parenting behaviours, mother-child interactions, and the child's behavioural problems in the home setting. Furthermore, maternal anxiety or depressive symptoms, along with autistic characteristics in both mother and child, might shape parenting practices and exacerbate behavioural difficulties in autistic children., What This Paper Adds: Autistic children received more overprotective and controlling parenting. In children with autism spectrum disorder and typically developing children, autistic traits, maternal anxiety and depression, and maternal autistic characteristics were correlated. In unaffected siblings, age, autistic traits, maternal education, and maternal autistic characteristics were correlated., (© 2024 Mac Keith Press.)

Objective: Omega-3 polyunsaturated fatty acids ( n -3 PUFAs) have demonstrated protective effects in major depressive disorder (MDD) patients receiving antidepressant treatment. However, there have been a few double-blind randomized controlled trials focused on n -3 PUFAs as monotherapy in MDD, and the outcomes have been mixed. This study aimed to assess the clinical effects of n -3 PUFAs monotherapy in patients with MDD., Methods: A total of 60 patients with MDD participated in this 12-week double-blind randomized controlled trial. They were randomized to either the n -3 PUFAs group (n = 30; 3.2 g of eicosapentaenoic acid, EPA and docosahexaenoic acid, DHA per day) or the placebo group (n = 30; 3.2 g of soybean oil per day). The severity of depression was evaluated using the Hamilton Rating Scale for Depression (HRSD)., Results: The n -3 PUFAs group had a significantly lower HRSD score compared with the placebo group at week 4 ( p = 0.004), week 6 ( p = 0.006), week 8 ( p = 0.004), and week 12 ( p = 0.01). The n -3 PUFAs group showed slightly higher rates for both remission (26.7% vs. 10%, p = 0.095) and response (23.3% vs. 6.7%, p = 0.145) compared with the placebo group at week 12, but these differences did not reach statistical significance., Conclusions: These findings suggested that monotherapy of n -3 PUFAs could improve depression and potentially serve as an alternative option for MDD patients.

Major Depressive Disorder (MDD) is a prevalent mental health condition with a complex pathophysiology involving neuroinflammation, neurodegeneration, and disruptions in neuronal and glial cell function. Microglia, the innate immune cells of the central nervous system, release inflammatory cytokines in response to pathological changes associated with MDD. Damage-associated molecular patterns (DAMPs) act as alarms, triggering microglial activation and subsequent inflammatory cytokine release. This review examines the cellular mechanisms underlying MDD pathophysiology, focusing on the lipid-mediated modulation of neuroinflammation. We explore the intricate roles of microglia and astrocytes in propagating inflammatory cascades and discuss how these processes affect neuronal integrity at the cellular level. Central to our analysis are three key molecules: High Mobility Group Box 1 (HMGB1) and S100 Calcium Binding Protein β (S100β) as alarmins, and Neuron-Specific Enolase (NSE) as an indicator of neuronal stress. We present evidence from in vitro and ex vivo studies demonstrating how these molecules reflect and contribute to the neuroinflammatory milieu characteristic of MDD. The review then explores the potential of omega-3 polyunsaturated fatty acids (ω-3 PUFAs) as neuroinflammation modulators, examining their effects on microglial activation, cytokine production, and neuronal resilience in cellular models of depression. We critically analyze experimental data on how ω-3 PUFA supplementation influences the expression and release of HMGB1, S100β, and NSE in neuronal and glial cultures. By integrating findings from lipidomic and cellular neurobiology, this review aims to elucidate the mechanisms by which ω-3 PUFAs may exert their antidepressant effects through modulation of neuroinflammatory markers. These insights contribute to our understanding of lipid-mediated neuroprotection in MDD and may inform the development of targeted, lipid-based therapies for both depression and neurodegenerative disorders.

To entrap sparingly water-soluble drugs like CPT-11 (irinotecan), the poly(lactic-co-glycolic acid) (PLGA) nanoparticle (NP) is highly favored due to its low cytotoxicity and approval for clinical use. On the other hand, entrapping hydrophobic oleic acid-coated iron oxide magnetic nanoparticles (OMNP) in PLGA NP can provide a nanovehicle for magnetically targeted drug delivery. Our goal in this study is to develop a new dual-targeted magnetic lipid-polymer NP for the delivery of CPT-11. We first co-entrap OMNP and CPT-11 in self-assembled lipid-PLGA NP to prepare OLNP@CPT-11. The OLNP@CPT-11 surface was modified with an epidermal growth factor receptor (EGFR) antibody Cetuximab (CET), which can actively target the overexpressed EGFR on the U87 glioblastoma cell surface. The OLNP-CET@CPT-11 enables dual targeting through both external magnetic guidance and CET-mediated active targeting. The NP was characterized for physicochemical properties using various analytical techniques. In vitro study confirms ligand-receptor interaction results in enhanced endocytosis of OLNP-CET@CPT-11 by U87 cells, which offers increased cytotoxicity and elevated cell apoptosis rates. Furthermore, magnetic guidance of OLNP-CET@CPT-11 to U87 cells can induce cell death exclusively in the magnetically targeted zone. The dual-targeted strategy also provides the best therapeutic efficacy against subcutaneously implanted U87 tumors in nude mice with intravenously delivered OLNP-CET@CPT-11., Competing Interests: Declaration of competing interest The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: [Jyh-Ping Chen reports financial support was provided by Chang Gung Memorial Hospital Linkou. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper]., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Ultrasmall gold nanoparticles (1.5 nm) were covalently conjugated with doxorubicin (AuDox) and AlexaFluor647 (AuAF647) to assess their biodistribution and their efficiency toward brain tumors (glioblastoma). A thorough characterization by transmission electron microscopy, small-angle X-ray scattering, and differential centrifugal sedimentation confirmed their uniform ultrasmall nature which makes them very mobile in the body. Each nanoparticle carried either 13 doxorubicin molecules (AuDox) or 2.7 AlexaFluor-647 molecules (AuAF647). The firm attachment of the ligands to the nanoparticles was demonstrated by their resilience to extensive washing, followed by centrifugation. The particles easily entered mammalian cells (HeLa, T98-G, brain endothelial cells, and human astrocytes) due to their small size. The intravenously delivered fluorescing AuAF647 nanoparticles crossed the blood-brain barrier with ∼23% accumulation in the brain tumor in an orthotopic U87 brain tumor model in nude mice. This was confirmed by elemental analysis (gold; inductively coupled plasma optical emission spectroscopy) in various organs. The doxorubicin-loaded AuDox nanoparticles inhibited brain tumor growth and prolonged animal survival without adverse side effects. Most of the nanoparticles (84%) had been excreted from the animal after 24 h, indicating a high mobility in the body.

We fabricated three-dimensional (3D)-printed polycaprolactone (PCL) and PCL/graphene oxide (GO) (PGO) scaffolds for bone tissue engineering. An anti-inflammatory and pro-osteogenesis drug dexamethasone (DEX) was adsorbed onto GO and a 3D-printed PGO/DEX (PGOD) scaffold successfully improved drug delivery with a sustained release of DEX from the scaffold up to 1 month. The physicochemical properties of the PCL, PGO, and PGOD scaffolds were characterized by various analytical techniques. The biological response of these scaffolds was studied for adherence, proliferation, and osteogenic differentiation of seeded rabbit adipose-derived stem cells (ASCs) from DNA assays, alkaline phosphatase (ALP) production, calcium quantification, osteogenic gene expression, and immunofluorescence staining of osteogenic marker proteins. The PGOD scaffold was demonstrated to be the best scaffold for maintaining cell viability, cell proliferation, and osteogenic differentiation of ASCs in vitro. In vivo biocompatibility of PGOD was confirmed from subcutaneous implantation in nude mice where ASC-seeded PGOD can form ectopic bones, demonstrated by microcomputed tomography (micro-CT) analysis and immunofluorescence staining. Furthermore, implantation of PGOD/ASCs constructs into critical-sized cranial bone defects in rabbits form tissue-engineered bones at the defect site, observed using micro-CT and histological analysis.

Purpose: Establishing an immunosuppressive premetastatic niche (PMN) in distant organs is crucial for breast cancer metastasis. Vascular endothelial cells (VECs) act as barriers to transendothelial cell migration. However, the immune functions of PMNs remain unclear. Tumour cell-released autophagosomes (TRAPs) are critical modulators of antitumour immune responses. Herein, we investigated the mechanism through which TRAPs modulate the immune function of pulmonary VECs in lung PMN in breast cancer., Methods: Immortalised mouse pulmonary microvascular endothelial cells were incubated with TRAPs in vitro. RNA sequencing, flow cytometry, and western blotting were employed to assess immunosuppressive function and mechanism. In vivo, TRAP-trained and autophagy-deficient tumour mice were used to detect immunosuppression, and high-mobility group box 1 (HMGB1)-deficient TRAP-trained and TLR4 knockout mice were utilised to investigate the underlying mechanisms of pulmonary VECs. Additionally, the efficacy of anti-programmed cell death ligand-1 (PD-L1) immunotherapy was evaluated in early tumour-bearing mice., Results: HMGB1 on TRAPs surfaces stimulated VECs to upregulate PD-L1 via a TLR4-MyD88-p38/STAT3 signalling cascade that depended on the cytoskeletal movement of VECs. Importantly, PD-L1 on TRAP-induced VECs can inhibit T cell function, promote lung PMN immunosuppression, and result in more pronounced lung metastasis. Treatment with anti-PD-L1 reduces lung metastasis in early stage tumour-bearing mice., Conclusions: These findings revealed a novel role and mechanism of TRAP-induced immunosuppression of pulmonary VECs in lung PMN. TRAPs and their surface HMGB1 are important therapeutic targets for reversing immunosuppression, providing a new theoretical basis for the treatment of early stage breast cancer using an anti-PD-L1 antibody., (© 2024. Springer Nature Switzerland AG.)

Background: In recent years, the addition of cetuximab to chemotherapy has improved treatment outcomes for patients with recurrent/metastatic head and neck squamous cell carcinoma (R/M HNSCC). In this study, we present the real-world survival data of R/M HNSCC patients who received cetuximab-containing regimens from thirteen medical centers in Taiwan, as well as a three-level risk stratification model for this patient population., Methods: This study enrolled R/M HNSCC patients from thirteen medical centers in Taiwan who received cetuximab-containing regimens from January 1, 2017 to June 6, 2022. The cases were divided into a training cohort and a validation cohort based on the start of treatment. Overall survival (OS) was evaluated in both cohorts and exploratory analysis was performed to identify associated adverse clinical and laboratory factors. The results of the exploratory analysis were used to construct a three-level risk stratification prediction model for OS., Results: A total of 1434 patients with R/M HNSCC were enrolled in this study and received cetuximab-containing regimens. The overall population had a median OS of 8.57 months (95% CI: 8.07 - 9.08). Multivariate analysis of the training cohort identified poor ECOG performance status, heavy alcohol consumption, and prior adjuvant CCRT or lack of prior RT as adverse prognostic factors. Comparison of laboratory data between patients with OS≦6 and OS > 6 also revealed unfavorable factors, including increased white blood cell count, decreased hemoglobin level, increased platelet count, increased absolute neutrophil count, decreased absolute lymphocyte count, and increased neutrophil-to-lymphocyte ratio. Using forward prediction, a three-level risk stratification prediction model was constructed using the variables of ECOG performance status, alcohol consumption, skin metastasis, modality of radiation therapy, hemoglobin level, and neutrophil-to-lymphocyte ratio. The median OS in the low-risk, intermediate-risk, and high-risk groups were 12.02 months (95% CI 10.44-13.61), 7.5 months (95% CI 7.33-8.17), and 4.01 months (95% CI 3.94-4.08), respectively, with a log-rank test p-value < 0.001., Conclusion: This study presents a three-level risk stratification model with strong prediction ability for OS in R/M HNSCC patients who received cetuximab-containing regimens. The results are based on real-world data and may provide valuable information for clinicians in treatment planning and future drug development., (© 2024. The Author(s).)

Since the advent of Hi-C in 2009, a plethora of high-throughput sequencing methods have emerged to profile the three-dimensional (3D) organization of eukaryotic genomes, igniting the era of 3D genomics. In recent years, the genomic resolution achievable by these approaches has dramatically increased and several single-cell versions of Hi-C have been developed. Moreover, a new repertoire of tools not based on proximity ligation of digested chromatin has emerged, enabling the investigation of the higher-order organization of chromatin in the nucleus. In this review, we summarize the expanding portfolio of 3D genomic technologies, highlighting recent developments and applications from the past three years. Lastly, we present an outlook of where this technology-driven field might be headed., Competing Interests: Declaration of competing interest The authors declare no conflict of interest., (Copyright © 2024 The Authors. Published by Elsevier Ltd.. All rights reserved.)

Purpose: To investigate the factors affecting footplate position and its influence on vault characteristics after implantable collamer lens (ICL) implantation., Setting: Hunan Provincial People's Hospital, Changsha, China., Design: Retrospective case series., Methods: This study included 124 patients (124 eyes). Ultrasound biomicroscopy (UBM) was performed to assess the iris and ciliary body morphologies and observe the footplate position. Using multiple linear regression, the relationship between various ocular and ICL parameters and the vault as well as the factors affecting the footplate distance (FD) were analyzed. Based on the FD, 3 groups were formed: group 1 (<500 μm), group 2 (500 to 1000 μm), and group 3 (>1000 μm). The distribution of the vault range postoperatively was observed for the 3 groups., Results: Ciliary sulcus angle and FD significantly affected the vault (adjusted R2 = 0.190, F = 6.763, P < .001), with FD being the most important factor influencing the vault (β = -0.383, P < .001). Postoperative UBM revealed that the footplate was located at different positions in the posterior chamber, with the majority (52%) being located on the ciliary body. The mean size of the 4 footplate orientations was 0.88 ± 0.24 mm. Multiple linear regression analysis revealed that ciliary body thickness (CBT), iris curvature (IC), and ICL iris contact length (IRCL) significantly influenced the FD (adjusted R2 = 0.373, F = 11.432, P < .001). The vault range differed significantly among the 3 groups (X 2 = 32.33, P < .001)., Conclusions: Different postoperative ICL footplate positions significantly affect the vault. CBT, IC, and IRCL can alter the position of the footplate from the expected position. This study provides reference for ICL size selection and vault prediction., (Copyright © 2024 Published by Wolters Kluwer on behalf of ASCRS and ESCRS.)

Major depressive disorder (MDD), affecting over 264 million individuals globally, is associated with immune system dysregulation and chronic neuroinflammation, potentially linked to neurodegenerative processes. This review examines blood-brain barrier (BBB) dysfunction in MDD, focusing on key regulators like matrix metalloproteinase 9 (MMP9), aquaporin-4 (AQP4), and ATP-binding cassette subfamily B member 1 (ABCB1). We explore potential mechanisms by which compromised BBB integrity in MDD may contribute to neuroinflammation and discuss the therapeutic potential of omega-3 polyunsaturated fatty acids (n-3 PUFAs). n-3 PUFAs have demonstrated anti-inflammatory and neuroprotective effects, and potential ability to modulate MMP9, AQP4, and ABCB1, thereby restoring BBB integrity in MDD. This review aims to elucidate these potential mechanisms and evaluate the evidence for n-3 PUFAs as a strategy to mitigate BBB dysfunction and neuroinflammation in MDD., (Copyright ©2024, Yale Journal of Biology and Medicine.)

To repair damaged mesothelium tissue, which lines internal organs and cavities, a tissue engineering approach with mesothelial cells seeded to a functional nanostructured scaffold is a promising approach. Therefore, this study explored the uses of electrospun nanofiber membrane scaffolds (NMSs) as scaffolds for mesothelial cell culture and transplantation. We fabricated a composite NMS through electrospinning by blending polycaprolactone (PCL) with gelatin. The addition of gelatin enhanced the membrane's hydrophilicity while maintaining its mechanical strength and promoted cell attachment. The in vitro study demonstrated enhanced adhesion of mesothelial cells to the scaffold with improved morphology and increased phenotypic expression of key marker proteins calretinin and E-cadherin in PCL/gelatin compared to pure PCL NMSs. In vivo studies in rats revealed that only cell-seeded PCL/gelatin NMS constructs fostered mesothelial healing. Implantation of these constructs leads to the regeneration of new mesothelium tissue. The neo-mesothelium is similar to native mesothelium from hematoxylin and eosin (H&E) and immunohistochemical staining. Taken together, the PCL/gelatin NMSs can be a promising scaffold for mesothelial cell attachment, proliferation, and differentiation, and the cell/scaffold construct can be used in therapeutic applications to reconstruct a mesothelium layer.

Tomatoes ( Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids ( Myzus persicae ) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol ® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10 -5 . As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum . To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.

Background: The clinical challenge of unexpected positive intraoperative cultures (UPICs) persists in 2-stage resection arthroplasty for managing periprosthetic joint infections (PJIs) following total knee arthroplasty.(TKA). This study aimed to investigate the incidence of UPICs during the definitive reimplantation phase of 2-stage resection arthroplasty of the knee and to assess both the infection-free and revision-free survivorship of the implanted prosthesis., Methods: This retrospective study included 450 2-stage resection arthroplasties of primary knee prostheses performed between January 2012 and April 2017. Patients were excluded if they: (1) underwent three or more staged resections, (2) had ambiguous clinical documentation or deviated from the 2-stage protocol, or (3) underwent revision arthroplasty prior to the PJI. Additionally, patients presumed aseptic before the second-stage reimplantation were excluded if they lacked joint aspiration or met the 2011 Musculoskeletal Infection Society criteria for PJI before implantation., Results: After exclusions, 300 patients were analyzed. Among them, 14% had UPIC during the second-stage reimplantation. The follow-up time was 2,316 (range, 1,888 to 3,737) days and 2,531 (range, 1,947 to 3,349) days for UPIC and negative intraoperative culture (NIC) groups, respectively. Rerevision due to subsequent PJI occurred in 26.2% of UPIC patients and 15.1% of NIC patients. The 2-year infection-free survival rates for the NIC, one UPIC, and ≥ two UPIC cohorts were 99.5, 98.2, and 94.3%, respectively, while the 5-year survival rates were 92.1, 91.1, and 54.3%, respectively. The unfavorable survivorship was significantly different in multiple UPIC cases (P < 0.001). Multiple UPICs with pathogens consistent with the first-stage findings were strongly associated with the risk of reinfection (P < 0.001)., Conclusions: An UPIC was identified in 14% of second-stage reimplantations. Patients who had multiple UPICs demonstrated truncated survivorship and suboptimal outcomes relative to the NIC and single UPIC cohorts, especially with pathogen consistency to the first-stage surgery., Level of Evidence: III., (Copyright © 2024 The Author(s). Published by Elsevier Inc. All rights reserved.)

Background: DEAD-box protein (DDX) is a member of the DDX RNA helicase family that exerts multiple functions in RNA metabolism, cell cycle, tumorigenesis, signal pathway, and fertility, particularly in mammals. Nevertheless, the biological functions of DDXs in insects have not been fully resolved and attracted increasing attention these years. Laodelphax striatellus (Hemiptera) is a notorious rice pest through feeding on rice sap and transmitting plant viruses. In this study, we aim to elucidate the functional characterization of DDXs in L. striatellus, and to exploit potential target genes for the development of pest control strategies., Results: In this study, we characterized the expression patterns of LsDDX6, LsDDX47, and LsDDX51 in planthoppers and analyzed their conserved motifs. These genes were found to be expressed in all tissues and developmental stages examined, with significantly higher transcript levels observed in the ovary. Knockdown of LsDDX6, LsDDX47, and LsDDX51 resulted in an obvious lethal phenotype in nymphs and abnormal ovarian development in adults. Furthermore, a total of 27 DDXs were identified in L. striatellus, and most DDXs were highly expressed in ovary and structure analysis result revealed that all of the DDXs possessed nine motifs that were unique to the DDX family., Conclusion: The three DDX RNA helicases (LsDDX6, LsDDX47, and LsDDX51) are essential for both survivorship and reproduction in L. striatellus. Considering a total number of 27 DDXs identified in L. striatellus, they might serve as promising candidates for application in RNAi-based control of this destructive pest. © 2024 Society of Chemical Industry., (© 2024 Society of Chemical Industry.)

This study aimed to investigate and analyze the medication use, fasting blood glucose control, and associated risk factors among residents with type 2 diabetes at the grassroots level in Xinjiang Production and Construction Corps. A multi-stage cluster sampling method was employed to conduct a questionnaire survey among residents aged 45 and above in battalions (communities) as the smallest unit. The medication use was recorded, and fasting blood glucose control was considered as the dependent variable. Logistic regression analysis was performed to identify the risk factors influencing fasting blood glucose control among different population characteristics. A total of 2316 participants were included in the study, of which 1072 were male (45.12%), 1418 were aged 65 and above (61.23%), 2031 were Han Chinese (87.69%), and 1551 were from the surrounding areas of Urumqi (66.97%). The main medications used among the top three classes were metformin, insulin, and α-glucosidase inhibitors. The treatment rate for type 2 diabetes was 71.80%, and the fasting blood glucose control rate was 27.98%. Multivariate analysis identified living outside the Urumqi surrounding area, age 65 and above, body mass index ≥ 24, abnormal blood lipids, and untreated hypertension as independent risk factors for poor fasting blood glucose control, while treatment was a protective factor for achieving blood glucose control. The treatment rate and fasting blood glucose control rate among grassroots residents with type 2 diabetes in Xinjiang Production and Construction Corps need improvement. Efforts should be made to enhance patient medication adherence and health management awareness through education. Targeted interventions should be implemented for high-risk populations with identified risk factors to reduce or delay the occurrence of diabetes and its complications, ultimately aiming to reduce mortality rates and improve quality of life., Competing Interests: The authors have no conflicts of interest to disclose., (Copyright © 2024 the Author(s). Published by Wolters Kluwer Health, Inc.)

Herbivorous insects harbor a variety of insect-specific viruses (ISVs) some of which are considered to be valuable biological agents for potential applications in biological defense and control strategies. Leaf beetles with chewing mouthparts are particularly known for their capacity to disrupt plant tissue while feeding, often creating openings that can act as entry points for plant pathogens. In this study, we have identified two new negative-sense RNA viruses infecting the leaf beetle Aulacophora indica , an important member of the Chrysomelidae family. These recently discovered viruses belong to the viral families Nyamiviridae and Chuviridae and have been preliminarily named Aulacophora indica nyami-like virus 1 (AINlV1) and Aulacophora indica chu-like virus 1 (AIClV1), respectively. The complete genomic sequences of these viruses were obtained using rapid amplification of cDNA ends (RACE) techniques. Detailed analysis of their genomic structures has confirmed their similarity to other members within their respective families. Furthermore, analysis of virus-derived small interfering RNA (vsiRNA) demonstrated a high abundance and typical vsiRNA pattern of AINlV1 and AIClV1, offering substantial evidence to support their classification as ISVs. This research enhances our understanding of viral diversity within insects.

Glioblastoma multiforme (GBM) is the most severe form of brain cancer and presents unique challenges to developing novel treatments due to its immunosuppressive milieu where receptors like programmed death ligand 1 (PD-L1) are frequently elevated to prevent an effective anti-tumor immune response. To potentially shift the GBM environment from being immunosuppressive to immune-enhancing, we engineered a novel nanovehicle from reduced graphene oxide quantum dot (rGOQD), which are loaded with the immunomodulatory drug resiquimod (R848) and conjugated with an anti-PD-L1 antibody (aPD-L1). The immunomodulatory rGOQD/R8/aPDL1 nanoparticles can actively target the PD-L1 on the surface of ALTS1C1 murine glioblastoma cells and release R848 to enhance the T-cell-driven anti-tumor response. From in vitro experiments, the PD-L1-mediated intracellular uptake and the rGOQD-induced photothermal response after irradiation with near-infrared laser light led to the death of cancer cells and the release of damage-associated molecular patterns (DAMPs). The combinational effect of R848 and released DAMPs synergistically produces antigens to activate dendritic cells, which can prime T lymphocytes to infiltrate the tumor in vivo. As a result, T cells effectively target and attack the PD-L1-suppressed glioma cells and foster a robust photothermal therapy elicited anti-tumor immune response from a syngeneic mouse model of GBM with subcutaneously implanted ALTS1C1 cells.

Background: We introduced an adapted Lyman normal-tissue complication probability (NTCP) model, incorporating clinical risk factors and censored time-to-event data, to estimate the risk of major adverse cardiac events (MACE) following left breast cancer radiotherapy (RT)., Materials and Methods: Clinical characteristics and MACE data of 1100 women with left-side breast cancer receiving postoperative RT from 2005 to 2017 were retrospectively collected. A modified generalized Lyman NTCP model based on the individual left ventricle (LV) equivalent uniform dose (EUD), accounting for clinical risk factors and censored data, was developed using maximum likelihood estimation. Subgroup analysis was performed for low-comorbidity and high-comorbidity groups., Results: Over a median follow-up 7.8 years, 64 patients experienced MACE, with higher mean LV dose in affected individuals (4.1 Gy vs. 2.9 Gy). The full model accounting for clinical factors identified D 50  = 43.3 Gy, m = 0.59, and n = 0.78 as the best-fit parameters. The threshold dose causing a 50 % probability of MACE was lower in the high-comorbidity group (D 50  = 30 Gy) compared to the low-comorbidity group (D 50  = 45 Gy). Predictions indicated that restricting LV EUD below 5 Gy yielded a 10-year relative MACE risk less than 1.3 and 1.5 for high-comorbidity and low-comorbidity groups, respectively., Conclusion: Patients with comorbidities are more susceptible to cardiac events following breast RT. The proposed modified generalized Lyman model considers nondosimetric risk factors and addresses incomplete follow-up for late complications, offering comprehensive and individualized MACE risk estimates post-RT., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Authors. Published by Elsevier Ltd.. All rights reserved.)

Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae , was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato ( Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana , and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.

Competing Interests: The authors have no conflicts of interest to report.

Plant-sucking insects have intricate associations with a diverse array of microorganisms to facilitate their adaptation to specific ecological niches. The midgut of phytophagous true bugs is generally structured into four distinct compartments to accommodate their microbiota. Nevertheless, there is limited understanding regarding the origins of these gut microbiomes, the mechanisms behind microbial community assembly, and the interactions between gut microbiomes and their insect hosts. In this study, we conducted a comprehensive survey of microbial communities within the midgut compartments of a bean bug Riptortus pedestris, soybean plant, and bulk soil across 12 distinct geographical fields in China, utilizing high-throughput sequencing of the 16 S rRNA gene. Our findings illuminated that gut microbiota of the plant-sucking insects predominantly originated from the surrounding soil environment, and plants also play a subordinate role in mediating microbial acquisition for the insects. Furthermore, our investigation suggested that the composition of the insect gut microbiome was probably shaped by host selection and/or microbe-microbe interactions at the gut compartment level, with marginal influence from soil and geographical factors. Additionally, we had unveiled a noteworthy dynamic in the acquisition of core bacterial taxa, particularly Burkholderia, which were initially sourced from the environment and subsequently enriched within the insect midgut compartments. This bacterial enrichment played a significant role in enhancing insect host reproduction. These findings contribute to our evolving understanding of microbiomes within the insect-plant-soil ecosystem, shedding additional light on the intricate interactions between insects and their microbiomes that underpin the ecological significance of microbial partnerships in host adaptation., (© 2024. The Author(s).)