Search

Background and Aims. Men who have sex with men (MSM) are at high risk of HIV infection. The nonhomologous end joining (NHEJ) pathway is the main way of double-stranded DNA break (DSB) repair in the higher eukaryotes and can repair the DSB timely at any time in cell cycle. It is also indicated that the NHEJ pathway is associated with HIV-1 infection since the DSB in host genome DNA occurs in the process of HIV-1 integration. The aim of the present investigation was to evaluate associations of single-nucleotide polymorphisms (SNPs) in NHEJ pathway genes with susceptibility to HIV-1 infection and AIDS progression among MSM residing in northern China. Methods. A total of 481 HIV-1 seropositive men and 493 HIV-1 seronegative men were included in this case-control study. Genotyping of 22 SNPs in NHEJ pathway genes was performed using the SNPscan™ Kit. Results. Positive associations were observed between XRCC6 rs132770 and XRCC4 rs1056503 genotypes and the susceptibility to HIV-1 infection. In gene-gene interaction analysis, significant SNP-SNP interactions of XRCC6 and XRCC4 genetic variations were found to play a potential role in the risk of HIV-1 infection. In stratified analysis, XRCC5 rs16855458 was significantly associated with CD4+ T cell counts in AIDS patients, whereas LIG4 rs1805388 was linked to the clinical phases of AIDS patients. Conclusions. NHEJ gene polymorphisms can be considered to be risk factors of HIV-1 infection and AIDS progression in the northern Chinese MSM population. [ABSTRACT FROM AUTHOR]

Background: Polydactyly is a common congenital malformation characterized by the presence of supernumerary fingers or toes. In this case study, we sought to identify the causative pathogenic factor in a family from a northern region of China affected by non‐syndromic postaxial polydactyly (PAP). Methods: After recruiting a three‐generation family with PAP, whole‐exome sequencing was performed to identify the causative variant. In silico analysis and Sanger sequencing were used to validate the variant. Results: We identified a novel heterozygous frameshift variant (NM_000168.6:c.4540delG, p.Asp1514Thrfs*5) in the transcriptional activator (TA1) domain of the GLI3 gene. Conclusion: The novel frameshift variant identified in this study further confirms the relationship between non‐syndromic PAP and GLI3 and extends the previously established mutational and phenotypic spectra of GLI3. [ABSTRACT FROM AUTHOR]

Background: Some studies have shown that the base excision repair (BER) pathway has an effect on HIV-1 replication. APEX1 and XRCC1 as key BER genes may affect DNA repair capacity. However, the roles of single nucleotide polymorphisms (SNPs) in APEX1 and XRCC1 and their impact on HIV-1 infection and AIDS progression remain unclear. Methods: A custom-designed 48-Plex SNPscan Kit was used for detection of single nucleotide polymorphisms. 601 HIV-1-infected men who have sex with men (MSM) and 624 age-matched healthy individuals were recruited in northern China. Four SNPs (rs1130409, rs1760944, rs2307486 and rs3136817) in APEX1 gene and three SNPs (rs1001581, rs25487 and rs25489) in XRCC1 gene were genotyped. The generalized multifactor dimension reduction (GMDR) method was used to identify the SNP-SNP interactions. Results: In this study, rs1130409 G allele, rs1001581 C allele and rs25487 C allele were associated with a higher risk of HIV-1 infection susceptibility (p = 0.020, p = 0.007 and p = 0.032, respectively). The frequencies of APEX1 haplotype TT and XRCC1 haplotype CT showed significant differences between cases and controls (p = 0.0372 and p = 0.0189, respectively). Interestingly, stratified analysis showed that the frequency of rs1001581 C allele was significantly higher in AIDS patients with the CD4+ T-lymphocyte count <200 cells/μl than those with >200 cells/μl (p = 0.022). Moreover, significant gene-gene interactions among rs1130409, rs1001581 and rs25487 were identified by GMDR (p = 0.0107). Specially, individuals with five to six risk alleles have a higher susceptibility to HIV-1 infection than those with zero to two risk alleles (p < 0.001). Conclusion: APEX1 and XRCC1 gene polymorphisms were associated with the susceptibility to HIV-1 infection and AIDS progression in MSM populations in northern China. [ABSTRACT FROM AUTHOR]

Background: Heilongjiang Province located in northeast China is a multi-ethnic region with people who have lived in cold conditions for several generations. Fatty acids are important to people with cold resistance. CPT1A encodes a protein that imports long-chain fatty acids into the mitochondria for fatty-acid oxidation. FADS is an essential enzyme for the synthesis of long-chain polyunsaturated fatty acids. Results: In the present study, we investigated the distributions of three cold resistance-related SNPs (rs80356779 G > A in CPT1A, rs7115739 T > G in FADS3 and rs174570 C > T in FADS2) from six populations that included 1093 individuals who have lived in Heilongjiang Province for at least three generations. The frequencies of rs174570 and rs7115739 were different in our six north minorities compared to the Chinese Dai in Xishuangbanna (CDX) in southern China. All the SNPs in Hezhen were significantly different from other five studied populations. In addition, the genetic distribution of rs174570 in Daur was significantly different from Manchu and Korea, and the frequency of rs7115739 in Ewenki was significantly different from the other populations. The results also showed that the frequencies of the three SNPs in the six minorities were different from those of Greenlandic Inuit and Siberian population. Conclusions: Our results showed the distributions of the three cold resistance-related SNPs from six populations that included 1093 individuals in northern China. Distributions of the allele frequencies for the cold resistance-related SNPs in northern China were statistically different from those in southern China. These data help to establish the DNA genome database for the six populations and fully preserve existing minority genetic information. [ABSTRACT FROM AUTHOR]

Abstract Psoriasis is a chronic immune-mediated disease with a complex etiology involving various genetic and immunological factors as well as environmental factors. Psoriasis is thought to be mediated by T-cells polarized to a Th17 fate. PTPN2 encodes the T-cell protein tyrosine phosphatase, which acts as a negative regulator of the JAK/STAT signaling pathways downstream of cytokines and plays a prominent role in T-cell activation, signaling and/or effector function. To evaluate the association between PTPN2 gene polymorphisms and psoriasis in the Northeastern Chinese population. A case-control study was conducted, and 398 patients with psoriasis and 397 healthy controls were genotyped for thirteen genetic polymorphisms in PTPN2. Allele analysis revealed that rs2847297, rs657555 and rs482160 polymorphisms were significantly associated with psoriasis (p = 0.0018, p = 0.0017 and p = 0.0086, respectively). Genotype analysis also revealed that these polymorphisms were significantly associated with psoriasis under different models (codominant, dominant and recessive models) (p < 0.05). In this study, three haplotypes (H1, H7 and H11) were also found to be associated with psoriasis (p = 0.0015, p = 0.0094, and p = 0.0124, respectively). These results indicate that PTPN2 genetic polymorphisms are associated with psoriasis in the Northeastern Chinese population. [ABSTRACT FROM AUTHOR]

Background: Prenatal intake of folic acid is important for prevention of NSCL/P (nonsyndromic cleft lip with or without cleft palate). Associated genes in folate pathway are major enzymes of folic acid metabolism that is crucial for preventing birth defects. The present meta-analysis aims to investigate the association between four SNPs in folate pathway genes and the risk of NSCL/P., Methods: Comprehensive bioinformatics analysis was used to predict the functional pathogenicity of genetic variation. The PubMed, Embase database and Google Scholar were searched by two researchers. Stata 11.0 software was used to analyze the results. Subgroup analysis was carried out to assess the influence of genetic background. Sensitivity analysis, regression analysis and publication analysis were also conducted to enhance the strength of our results., Results: It is estimated that the probability of two missense mutation rs1801133 in MTHFR and rs1801394 in MTRR are more likely to be damaging by bioinformatics analysis. A significant association between rs1801133 and risk of NSCL/P in two genetic models: TT genotype vs CC genotype (OR = 1.333 95%CI = 1.062-1.674, P = 0.013), and recessive model (OR = 1.325 95%CI = 1.075-1.634, P = 0.008). A significant protective association between rs1801394 GG genotype and NSCL/P in Asian (GG vs AA, OR = 0.520 95%CI = 0.321-0.841, P = 0.008) was observed. Meta-regression, sensitivity analysis, and publication bias analysis confirmed that the results of the present study were statistically significant., Conclusions: The present study identified that rs1801133 in MTHFR is associated with the risk of NSCL/P, and rs1801394 GG genotype in MTRR play a protective role in Asian. Further, larger studies should be performed to confirm these findings., (© 2020 The Author(s).)

Lynch syndrome (LS) is the most common hereditary colorectal cancer (CRCs) inherited in an autosomal-dominant manner. Here, we reported a multigeneration Chinese family clinically diagnosed with LS according to the Amsterdam II criteria. To identify the underlying causative gene for LS in this family, whole-exome sequencing (WES) was performed. A germline missense variant (c.2054C>T:p.S685F) in exon 18 of MLH1 was successfully identified by WES. Sanger sequencing verified the results of WES and also confirmed the cosegregation of the MLH1 missense variant in all affected members of the family including two unaffected family members. Bioinformatic tools predicted the identified MLH1 variant as deleterious. Immunohistochemistry (IHC) staining showed loss of MLH1 and PMS2 protein expression. In vitro expression analysis also revealed that the identified MLH1 missense variant (c.2054C>T:p.S685F) results in reduced expression of both MLH1 and PMS2 proteins. Based on the American College of Medical Genetics and Genomics (ACMG) guidelines, the missense mutation c.2054C>T in MLH1 was classified as a "pathogenic" variant. Two unaffected family members were later recommended for colonoscopy and other important cancer diagnostic inspections every 1-2 years as both were at higher risk of LS. In conclusion, our findings widen the genotypic spectrum of MLH1 mutations responsible for LS. This study increases the phenotypic spectrum of LS which will certainly help the clinicians in diagnosing LS in multigeneration families. This study also puts emphasis on the importance of genetic counselling for the benefit of asymptomatic carriers of MMR gene variants who are at higher risk of LS., Competing Interests: The authors declare that they have no competing interests., (Copyright © 2020 Tahir Zaib et al.)

Background: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family., Methods: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines., Results: Our results showed the mutation of 24-base pair duplication (c.183&#95;206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family., Conclusion: Based on our mutation analysis of variant c.183&#95;206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.