Search

A maize-infecting polerovirus, variously named maize yellow dwarf virus RMV2 (MYDV RMV2), MYDV-like, and maize yellow mosaic virus (MaYMV), is frequently found in mixed infections in plants also infected with maize chlorotic mottle virus (MCMV) and sugarcane mosaic virus (SCMV), known to synergistically cause maize lethal necrosis (MLN). MaYMV was discovered in deep sequencing studies precipitated by recent MLN emergence and is prevalent at global locations with MLN, but its role in or contribution to disease was not known. We examined how MaYMV impacted disease development in mixed infections with MCMV, SCMV, and both MCMV and SCMV compared with mock-inoculated plants. Results demonstrated that MaYMV symptoms included stunting as well as leaf reddening in single and mixed infections. MaYMV did not recapitulate MLN synergistic disease in double infections in which either MCMV or SCMV was missing (MaYMV + MCMV or MaYMV + SCMV), but did significantly enhance stunting in mixed infections and suppressed titers of both MCMV and SCMV in double infections. Interestingly, MaYMV strongly suppressed the SCMV-induced titer increase of MCMV in triple infections, but MLN symptoms still occurred with the reduced MCMV titer. These data indicate the potential disease impact of this newly discovered ubiquitous maize virus, alone and in the context of MLN.

Turnip yellows virus (TuYV; family Solemoviridae, genus Polerovirus) is the most widespread and economically damaging virus of canola (Brassica napus L.) production in Australia. However, no Australian commercial seed companies market TuYV-resistant canola cultivars, and little information is available on the susceptibility of those available. To identify potential sources of TuYV resistance, 100 B. napus accessions from the ERANET ASSYST diversity set were screened in the field and five of these were selected for further phenotyping via aphid inoculation. Furthermore, 43 Australian canola cultivars, six B. napus genotypes with previously reported resistance, and 33 B. oleracea and B. rapa cultivars were phenotyped. All Australian cultivars were susceptible except for ‘ATR Stingray’. Stronger resistance to systemic TuYV infection (IR) was identified in diversity set accessions ‘Liraspa-A’, ‘SWU Chinese 3’, and ‘SWU Chinese 5’. As indicated by lower relative enzyme-linked immunosorbent assay absorbance values (R-E405) in infected plants, resistance to TuYV accumulation (AR) often accompanied IR. Moderate IR was identified in four B. oleracea cultivars and one B. rapa cultivar. Very strong AR was identified in four B. oleracea cultivars and AR of some degree was common across many cultivars of this species tested. The impact of temperature during the inoculation access period or post-inoculation incubation on the resistance identified was examined. Infection rates were significantly higher in resistant B. napus genotypes when inoculated at 16°C than at 26°C, suggesting an increase in aphid transmission efficiency. IR in B. napus genotypes was strong when incubated at 16°C, but weakened at elevated temperatures with almost total breakdown in most genotypes at 30°C. However, infected plants of B. napus and B. oleracea genotypes with AR maintained lower R-E405 values than susceptible controls at all temperatures tested. Novel sources of resistance identified in this study offer potential as breeding material in Australia and abroad.

Maize yellow mosaic virus (MaYMV) hosted in various gramineous plants was assigned to the genus Polerovirus (family Luteoviridae) in 2018. However, little is known about its genetic diversity and population structure. In this study, 509 sugarcane leaf samples with mosaic symptoms were collected in 2017 to 2019 from eight sugarcane-growing provinces in China. Reverse-transcription PCR results revealed that four positive-sense RNA viruses were found to infect sugarcane, and the incidence of MaYMV among samples from Fujian, Sichuan, and Guangxi Provinces was 52.1, 9.8, and 2.5%, respectively. Based on 82 partial MaYMV sequences and 46 whole-genome sequences from different host plants, phylogenetic analysis revealed that MaYMV populations are very closely associated with their source geographical regions (China, Africa, and South America). Pairwise identity analysis showed significant variability in genome sequences among MaYMV isolates with genomic nucleotide identities of 91.1 to 99.9%. In addition to codon mutations, insertions or deletions also contributed to genetic variability in individual coding regions, especially in the readthrough protein (P3-P5 fusion protein). Low gene flow and significant genetic differentiation of MaYMV were observed among the three geographical populations, suggesting that environmental adaptation is an important evolutionary force that shapes the genetic structure of MaYMV. Genes in the MaYMV genome were subject to strong negative or purification selection during evolution, except for the movement protein (MP), which was under positive selection pressure. This finding suggests that the MP may play an important role in MaYMV evolution. Taken together, our findings provide basic information for the development of an integrated disease management strategy against MaYMV.

A maize-infecting polerovirus variously named maize yellow dwarf virus RMV2 (MYDV-RMV2) and maize yellow mosaic virus (MaYMV) has been discovered and previously described in East Africa, Asia, and South America. It was identified in virus surveys in these locations instigated by outbreaks of maize lethal necrosis (MLN), known to be caused by coinfections of unrelated maize chlorotic mottle virus (MCMV) and any of several maize-infecting potyviruses, and was often found in coinfections with MLN viruses. Although sequenced in many locations globally and named for symptoms of related or coinfecting viruses, and with an infectious clone reported that experimentally infects Nicotiana benthamiana, rudimentary biological characterization of MaYMV in maize, including insect vector(s) and symptoms in single infections, has not been reported until now. We report isolation from other viruses and leaf tip reddening symptoms in several maize genotypes, along with transmission by two aphids, Rhopalosiphum padi and Rhopalosiphum maidis. This is important information distinguishing this virus and demonstrating that in single infections it causes symptoms distinct from those of potyviruses or MCMV in maize, and identification of vectors provides an important framework for determination of potential disease impact and management.

Watermelon (Citrullus lanatus) is one of the most popular crops in Korea, with over 100 million units produced annually. As watermelon cultivation increases, the damage caused by plant viruses in watermelon farms is also increasing. In July 2020, some watermelons cultivated on farms in Uiryeong showed typical viral symptoms, such as yellowing and necrosis. In previous studies, two plant viruses, cucurbit aphid-borne yellows virus (CABYV) and cucurbit chlorotic yellows virus (CCYV), have been reported as causal agents of yellowing disease in the cucurbitaceae plant in Korea. To identify the virus(es) associated with the symptomatic watermelon plants, 11 samples were collected. Total RNA was extracted from each sample using the Plant RNA Prep kit (Biocube System, Gwacheon, Korea). RT-PCR was performed using primer sets specific to CABYV and CCYV to detect each virus (Kwak et al. 2018, Wintermantel et al. 2019). CABYV was detected in one sample, and CCYV was detected in 8 samples. Every sample presented similar yellowing symptoms; however, neither virus was detected in the remaining two samples. To investigate unknown viruses, a transcriptome library was constructed using total RNA of the watermelons and sequenced using a NovaSeq 6000 sequencer (Illumina, San Diego, CA). The reads were de novo assembled and annotated using the KEGG virus genome database with the NCBI BLAST utility. All procedures of next generation sequencing were performed by Macrogen (Seoul, Korea). Three large viral contigs were identified, and additional BLAST analyses for nucleotides (nt) and proteins indicated that they were CABYV, CCYV, and melon aphid-borne yellows virus (MAYBV). A total of 247,198 reads were mapped to reference MABYV sequence (GenBank Accession Number NC_010809), and the sequencing depth was 6,575X. The contig (MW505927) had a size of 5,677 nt and showed 100% coverage and 96% identity with known complete MABYV sequences (JQ700307 and EU000534). To confirm the presence of MABYV, RT-PCR was performed using specific primer sets targeting MABYV (MABYV-262-F, 5'-GAACCGTCGACGCACTTCAAAGAGTA-3' and Polero-uni-R, 5'-GATYTTATAYTCATGGTAGGCCTTGAG-3'; Knierim et al. 2010). The expected size of 262 bp was obtained from 5 out of 11 samples, including the two samples mentioned above. MABYV belongs to the genus Polerovirus and has been reported in cucurbit crops in China, Taiwan, and Thailand (Xiang et al. 2008, Knierim et al. 2010, Cheewachaiwit et al. 2017). According to the farmer, outbreak of aphids had previously occurred and were controlled with pesticides. Since aphids are known to be vectors of poleroviruses, we surmise that the watermelons were infected with MABYV by the aphids at that time. To monitor the outbreak of MABYV, watermelon farms in Uiryeong will be continuously investigated. To our knowledge, this is the first report of MABYV in Korea.

Barley (Hordeum vulgare) is a valuable annual cereal crop grown widely throughout the United States and the world. The majority of barley grown commercially in California and throughout the U.S. is used for livestock feed, with the remainder being used by the malting industry and, to a lesser extent, direct food consumption; it is also often employed as a cover crop (Lazicki et al. 2016). Yellow dwarf viruses (YDVs), in the family Luteoviridae, that infect barley and other cereal crops are common and widely distributed throughout California and the U.S. (Griesbach et al. 1989; Seabloom et al. 2009). In April 2018, five barley samples exhibiting typical symptoms of YDV infection (primarily yellowing of leaf margins and tips) collected from fields in Yolo county planted with cultivar Butta 12 , were tested for viruses. Total RNA was extracted from leaf tissue using Trizol reagent, according to the manufacturer's protocol. RNA was used as template in a multiplexed RT-PCR assay designed for the generic detection of barley and cereal infecting YDVs, using the protocol established by Malmstrom and Shu (2004). A 372 basepair amplicon indicative of Polerovirus infection was amplified from two of the samples and sequenced (Quintara Biosciences), and the resulting data analyzed via a BLASTn search. No further testing or work was done with the three samples that tested negative. Not unexpectedly, the top result returned for one of the positive samples was Cereal yellow dwarf virus-RPV (CYDV-RPV; 98% identity), a virus common to cereals in California and the U.S.. Unexpectedly, however, the top result returned for the other sample was Barley virus G (BVG), sharing 98.43% identity with the Uiseong BVG isolate (GenBank accession LC259081). To further confirm the presence of BVG in the sample, the full-length viral genome was amplified using two-step RT-PCR with primers targeting the extreme 5' and 3' ends of the viral genome, using the PrimeScript RT and PrimeSTAR GXL DNA Polymerase kits (Takara Bio), cloned into the binary vector pJL89 and a BLAST search of the resulting 5621 nucleotide full-length sequence (100% query coverage) once again returned results showing the YDV to be BVG. The full-length sequence was deposited into GenBank (MW853785). Nucleotide sequence comparisons showed that the CA BVG isolate shares 96.62%, 96.57%, and 96.02% identity with the sequences of the BVG-Gimje (KT962089), BVG-Uiseong (LC259081), and BVG-Aus8 (LC500836) isolates, respectively. To our knowledge, this is the first report of barley virus G in California and in the United states. Currently the prevalence, host range and mode and timing of introduction of BVG in California and the U.S. are unknown; its impact on cereal production and yield in any location in which it has been identified thus far is also unknown and may warrant further investigation.

During the growing seasons of 2014 through 2016, a total of 336 leaf samples from bell pepper (showing leafroll and interveinal yellowing) and arable weeds were collected from Riyadh region, Saudi Arabia. The use of a polerovirus generic reverse transcription (RT)-PCR assay confirmed their presence in the bell pepper samples. Sequencing of the generic amplicon revealed high similarity (87.6 to 98.1% in nt) with four poleroviruses; Tobacco vein distorting virus, Pepper vein yellows virus, Pepper yellows virus, and Pepper yellow leaf curl virus. To further characterize one of these isolates (105D), a larger part of the genome (∼1,300 nt) spanning approximately from the 3′ end of ORF2 to the middle of ORF3, was amplified and sequenced. Blasting the resulting sequence revealed the low amino acid and nucleotide identity percentages in the coat protein and movement protein partial genes with viruses deposited in GenBank. Next-generation sequence was used to acquire a larger part of the genome, which resulted in the reconstruction of isolate 105D’s partial genome (5,496 nt). Sequence similarity analysis revealed the presence of a divergent polerovirus isolate belonging to a new species that was tentatively named Pepper leafroll chlorosis virus (PeLRCV). Using a specific RT-PCR assay for this isolate confirmed the presence of this new viral species in the symptomatic peppers. Aphid transmission experiments showed that PeLRCV is vectored by Aphis gossypii and that it can infect at least five out of the 15 different plants species tested. Based on our findings, PeLRCV is a new member of genus Polerovirus in the family Luteoviridae.

In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus, fam. Closteroviridae, have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, fam. Luteoviridae) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies (B. tabaci) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F - 5' AAGAGCGGCAGCTACAATAC 3', CABYV RdRp-R - 5' TGCCACATTCCGGTTCATAG 3'), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.

Virus-like disease symptoms consisting of leaf cupping, shortened internodes, and overall stunting were observed in commercial cotton fields in Alabama in 2017 to 2018. To determine the complete genome sequence of the suspected causal polerovirus, symptomatic leaf samples were collected in Macon County, Alabama, and subjected to Illumina RNA sequencing. Based on BLASTn analysis, the Illumina contig of 5,771 nt shared the highest nucleotide identity (approximately 95%) with members of the species Cotton leafroll dwarf virus (CLRDV) (genus Polerovirus; family Luteoviridae) from Argentina and Brazil. The full-length viral genome sequence was verified by reverse transcription (RT)-PCR amplification, cloning, and Sanger sequencing. The complete CLRDV genome of 5,865 nt in length shared 94.8 to 95.2% nucleotide identity with six previously reported CLRDV isolates. The genome of the CLRDV isolate amplified from Alabama samples (CLRDV-AL) has seven predicted open reading frames (ORFs). Viral proteins 1 to 5 (P1 to P5) shared 91.9 to 99.5% amino acid identity with the six CLRDV isolates from Argentina and Brazil. However, P0, the suppressor of host gene silencing, shared 82.4 to 88.5% pairwise amino acid identity with the latter CLRDV isolates. Phylogenetic analysis of the seven full-length CLRDV genomes resolved three sister clades: CLRDV-AL, CLRDV-typical, and CLRDV-atypical, respectively. Three recombination events were detected by the recombination detection program among the seven CLRDV isolates with breakpoints occurring along the genome. Pairwise nucleotide identity comparisons of ORF0 sequences for the three CLRDV-AL field isolates indicated that they were >99% identical, suggesting that this previously unknown CLRDV genotype represents a single introduction to Alabama.

In Costa Rica, sugarcane plants with symptoms similar to those described for yellow leaf syndrome (YLS) (1,2) were first observed in 1994 in research plots of imported material in the midland areas of San Carlos and Turrialba. Recently, the same symptoms have been observed in commercial plantations in Turrialba. Symptomatic plants were characterized by yellowing of the leaves and central veins, the yellowing being more intense near the leaf tips. In severe cases, veins became reddish, and necrosis developed along the leaf edges, beginning at the leaf tip and extending to the base of the leaf. Growth of stems and roots was also reduced in infected plants. Minipurifications of six plants of four different varieties were examined by immunospecific electron microscopy (ISEM) using polyclonal antibodies (1). They were: one symptomatic plant each of the varieties H782313 and H608521; two symptomatic plants of H657052, and one asymptomatic plant each of H608521 and H827318. Isometric particles of approximately 28 nm were observed in the asymptomatic H827318 plant and in all symptomatic plants, with the exception of one plant of H657052. The size and morphology of the particles was similar to those reported for Sugarcane yellow leaf virus (ScYLV) (2). The presence of ScYLV was verified by indirect enzyme-linked immunosorbent assay (ELISA) using polyclonal antibodies (1). Twenty-two of 24 symptomatic plants and five of 13 asymptomatic plants were positive for ScYLV. These findings confirm the association of ScYLV with the yellows syndrome of sugarcane observed in Costa Rica. However, as was also reported by Scaglusi and Lockhart (1), ScYLV was not detected in several symptomatic plants, and research is continuing to determine whether other pathogens are associated with this syndrome in Costa Rica. References: (1) S. Scagliusi and B. E. L. Lockhart. Phytopathology 90:120, 2000; (2) J. Vega et al. Plant Dis. 81:21, 1997.

Potato leafroll virus (PLRV) (genus Polerovirus, family Luteoviridae) is of great economic importance. It has a very narrow host range consisting of only 21 known species, 14 of which are Solanaceae. Ten aphid species transmit PLRV in a persistent manner, but the green peach aphid (Myzus persicae Sulzer) is by far the most important vector and the only important vector in the Columbia Basin of the Pacific Northwest (3). Solanum sarrachoides (Sendtner) may be especially important in the epidemiology of PLRV because it is a predominant weed in potatoes (S. tuberosum L.), other annual crops, and waste areas of the Columbia Basin (1), and herbicides available for potato are relatively ineffective against this weed (2). Since our research began in 1974, we have routinely observed many S. sarrachoides plants throughout the Columbia Basin that acquired an abnormal erect stiff appearance in middle to late summer. Their leaflets curled upward at the margins and expressed interveinal chlorosis and necrosis and a reddened or purple color on abaxial surfaces. The presence of PLRV in symptomatic plants was routinely detected by double-antibody sandwich enzyme-linked immunosorbent assay and by density gradient sedimentation and light absorbance properties of the purified virus when we evaluated the host as a source of purified PLRV in 1980. A systematic study to satisfy the requirements of Koch's postulates to prove that PLRV causes the disease in S. sarrachoides was conducted in 1998. The virus produced typical PLRV symptoms on three young Physalis floridana, Datura stramonium, and potato plants when transmitted by the green peach aphid from each of four symptomatic S. sarrachoides collected from widely spaced potato fields in the Columbia Basin and from purified virus preparations from these plants. Back-transmission from each of these hosts and from purified preparations to S. sarrachoides plants observed the same symptoms. The green peach aphid readily colonized S. sarrachoides in the field, and populations on this host were typically higher than on adjacent potato plants in potato fields. The concentration of PLRV was approximately equal in infected S. sarrachoides and P. floridana plants, as was the efficiency of virus transmission from these hosts by individual green peach aphids. The aphids used in transmission efficacy assays were all the same clone and were reared on the host species assayed. The incidence of PLRV infection among S. sarrachoides in potato fields was typically higher than in the potato crop. Only two other summer annual hosts of PLRV, Amaranthus caudatus and S. nigrum, occur sporadically in potato fields of the Columbia Basin (1). The virus rarely infected these species. To our knowledge, this is the first report that S. sarrachoides is highly susceptible to PLRV and may play an important role in PLRV epidemiology in the Columbia Basin. References: (1) A. G. Ogg, Jr. and B. S. Rogers. Rev. Weed Sci. 4:25, 1989. (2) L. S. Quakenbush and R. N. Anderson. Weed Sci. 33:386, 1985. (3) P. E. Thomas et al. Plant Dis. 81:1311, 1997.

In autumn 2001, severe yellowing symptoms were observed on greenhouse-grown cucumbers near Perpignan (southern France). Leaf samples were collected from two sites where plants displayed symptoms ranging from limited yellowing of the older leaves to severe, complete yellowing of the whole plant. Cucurbit aphid-borne yellows virus, a polerovirus that causes similar symptoms was not detected in doubleantibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) using a specific antiserum. Total RNA was extracted from fresh leaf tissues and used in reverse transcription-polymerase chain reaction (1) with primers specific for two whitefly-borne viruses also inducing yellows and occurring in the Mediterranean basin (1): Beet pseudo yellows virus (BPYV, genus Closterovirus) transmitted by Trialeurodes vaporariorum (West.) and Cucurbit yellow stunting disorder virus (CYSDV, genus Crinivirus) transmitted by Bemisia tabaci (Genn.). No BPYV was detected in this survey, but CYSDV was present in all samples. In subsequent surveys conducted in the spring and summer of 2002, BPYV and CYSDV were detected, sometimes in mixed infections, in samples collected from the same region. The complete CYSDV coat protein gene was amplified by PCR using specific primers (2), yielding the expected-size fragment of 756 bp. The French isolate (GenBank Accession No. AY204220) shared 99.6 to 100% nucleotide sequence identity in the sequenced CP fragments (700 nt) with isolates of the most common, highly homogenous subgroup of CYSDV that has emerged recently in the Middle East, southwestern Europe (Spain and Portugal), United States, and Morocco (2). To our knowledge, this is the first report of CYSDV in France and it shows the threat represented by the current emergence of B. tabaci-transmitted viruses. References: (1) I. C. Livieratos et al. Plant Pathol. 47:362, 1998. (2) L. Rubio et al. J. Gen. Virol. 82:929, 2001.

Viruses, distributed worldwide on cucurbits, cause severe damage to crops. Virus surveys in 2003 and 2004 were made in all the major cucurbit-growing areas in Tunisia. Large populations of aphids (Aphis gossypii Glover) and severe yellowing symptoms of older leaves of cucurbits were observed in outdoor and under plastic-tunnel cultivation, suggesting the presence of Cucurbit aphid-borne yellows virus (CABYV, genus Polerovirus, family Luteoviridae). Leaf samples collected from symptomatic and asymptomatic plants of melon (Cucumis melo L.), cucumber (C. sativus L.), squash (Cucurbita pepo L.), watermelon (Citrullus lanatus L.), and ware cucurbit (Ecballium elaterium L. T. Richard) were screened for the presence of CABYV using enzyme-linked immunosorbent assay (ELISA) and reverse transcription-polymerase chain reaction (RT-PCR). Reference isolate, CABYV-N (GenBank Accession No. X76931) was provided by H. Lecoq (INRA-Monfavet Cedex, France). Sample extracts from fresh leaf tissues were tested using ELISA with an antiserum prepared against this isolate. In addition, total RNA was extracted from fresh leaf tissues according to the technique of Celix et al. (2) using the Titan RT-PCR kit from Roche Diagnostics (Penzberg, Germany). Forward primer (5′-GAGGCGAAGGCGAAGAAATC-3′) and reverse primer (5′-TCTGGACCTGGCACTTGATG-3′) were designed with the available sequence of the reference isolate. ELISA tests demonstrated that 91 plants were positive among 160 plants tested with severe yellowing symptoms. All asymptomatic plants were negative. RT-PCR results yielded an expected 550-bp product that was amplified from the reference isolate. Of the 160 plants tested using ELISA, 106 plants were screened with RT-PCR including the 91 plants that were positive in ELISA. These 91 plants also were positive after RT-PCR amplification as were 12 more plants. This demonstrated that the RT-PCR test is more sensitive. No amplicons were produced from extracts of asymptomatic plants, RNA preparations of Cucurbit yellow stunting disorder virus (CYSDV), or Beet pseudo yellows virus (BPYV) positive controls provided by B. Falk (University of California, Davis). CYSDV and BPYV can induce similar yellowing symptoms in cucurbits. The results of the ELISA and RT-PCR tests showed that CABYV is widely distributed on five cucurbit species in the major growing areas of Tunisia including the northern, Sahel, central, and southern regions where it was detected, respectively, in 10 of 25, 11 of 21, 24 of 37, and 58 of 77 samples tested. CABYV was detected at the rates of 63 of 72 on melon, 10 of 21 on cucumber, 17 of 24 on squash, 10 of 25 on watermelon, and 3 of 18 on ware cucurbit. CABYV also seems to be widespread throughout the Mediterranean Basin (1,3,4), but to our knowledge, this is the first report of the occurrence of CABYV in Tunisia on different species of cucurbit and ware cucurbit. References: (1) Y. Abou-Jawdah et al. Crop Prot. 19:217, 2000. (2) A. Celix et al. Phytopathology 86:1370, 1996. (3) M. Juarez et al. Plant Dis. 88:907, 2004. (4) H. Lecoq et al. Plant Pathol. 41:749, 1992.

Yellowing symptoms on sugar beet (Beta vulgaris L.) are caused by several viruses, especially those belonging to the genus Polerovirus of the family Luteoviridae, including Beet mild yellowing virus (BMYV) and Beet western yellows virus (BWYV), and recently, a new species, Beet chlorosis virus (BChV), was reported (2). To identify Polerovirus species occurring in beet crops in Poland and determine their molecular variability, field surveys were performed in the summer and autumn of 2005. Leaves from symptomatic beet plants were collected at 26 localities in the main commercial sugar-beet-growing areas in Poland that included the Bydgoszcz, Kutno, Lublin, Poznań, Olsztyn, and Warszawa regions. Enzyme-linked immunosorbent assay (ELISA) tests (Loewe Biochemica GmbH, Sauerlach, Germany) detected poleroviruses in 23 of 160 samples (approximately 20 samples from each field). Multiplex reverse-transcription polymerase chain reaction (RT-PCR) (1) (GE Healthcare S.A.-Amersham Velizy, France) confirmed the presence of poleroviruses in 13 of 23 samples. Nine of twenty sugar beet plants gave positive reactions with BChV-specific primers and three with primers specific to the BMYV P0 protein. Two isolates reacted only with primer sets CP+/CP, sequences that are highly conserved for all beet poleroviruses. Leaf samples collected from three plants infected with BChV were used as inoculum sources for Myzus persicae in transmission tests to suitable indicator plants including sugar beet, red beet (Beta vulgaris L. var. conditiva Alef.), and Chenopodium capitatum. All C. capitatum and beet plants were successfully infected with BChV after a 48-h acquisition access period and an inoculation access period of 3 days. Transmission was confirmed by the presence of characteristic symptoms and by ELISA. Amino acid sequences obtained from each of four purified (QIAquick PCR Purification kit, Qiagen S.A., Courtaboeuf, France) RT-PCR products (550 and 750 bp for CP and P0, respectively) were 100% identical with the CP region (GenBank Accession No. AAF89621) and 98% identical with the P0 region (GenBank Accession No. NP114360) of the French isolate of BChV. To our knowledge, this is the first report of BChV in Poland. References: (1) S. Hauser et al. J. Virol. Methods 89:11, 2000. (2) M. Stevens et al. Mol. Plant Pathol. 6:1, 2005.

A survey of six potato viruses, Potato virus A (PVA), Potato virus M (PVM), Potato virus S(PVS), Potato virus X (PVX), Potato virus Y (PVY), and Potato leafroll virus (PLRV), was conducted in New York and Maine during 2002 and 2003. Leaf samples were tested by enzyme-linked immunosorbent assay and PVY-positive samples were further tested to determine whether a necrotic strain of PVY (PVYN) or a strain able to induce necrosis in tobacco and in potato tubers (PVYNTN) were present. In both years, PVY and PVS were identified in a majority of the samples, and mixed infections predominated in 83% of the symptomatic leaves in 2002. Of the total 394 PVY-positive samples, 3 reacted with monoclonal antibody (MAb) 1F5 and caused veinal necrosis (VN) in tobacco. Two of these isolates caused tuber necrosis in the potato cv. Yukon Gold. Three PVY isolates reacted with MAb 1F5 but did not cause VN in tobacco, and two caused VN but did not react with MAb 1F5. None of these eight isolates were able to overcome the Ry resistance gene in the potato cultivar Eva, but several were able to overcome the Ny resistance gene found in Allegany. PVYN isolates were not widespread in the northeastern United States; however, several PVY isolates differed from both PVYN and the ordinary strain of PVY and may represent strain recombinants.

Carrot motley dwarf (CMD) affects carrot and other apiaceous plants by causing leaf yellowing or reddening as well as plant stunting and leads often to serious economic losses wherever these crops are grown (2). CMD has been reported from Australia, Europe, Japan, Israel, and North America and is known to result from a mixed infection by at least two viruses, the polerovirus, Carrot red leaf virus (CtRLV), and one of the umbraviruses, Carrot mottle virus (CMoV) or Carrot mottle mimic virus (CMoMV). The viruses are transmitted in a circulative persistent manner by aphid species (Cavariella spp.). In November of 2008, symptoms typical of CMD were observed in carrot (Daucus carota) and coriander (Coriandrum sativum) plantations in the region of Henrietta in the central part of Mauritius. Carrot cultivars affected were Victoria, Sigma, and Namdhari. Incidences of up to 50% were recorded in some fields. Symptoms were observed mainly on plants near the edges of fields and were initially attributed to physiological factors. However, following RNA extraction from affected carrot plants and reverse transcription (RT)-PCR, fragments of the expected sizes (CtRLV; 377 bp: CMoV; 549 bp) were obtained. For CtRLV, a pair of degenerate primers (S2/AS3 [1]) for poleroviruses, and for the above mentioned umbraviruses, a universal primer pair (UmbraCS: CTTTGGAGTACACAACAACTCC and UmbraCAS: GCA/GTCIAGICCIACACAA/GACTGG, I = Inosin; unpublished) was used. Direct sequencing of one PCR product for each virus (Eurofins MWG Operon GmbH, Martinsried, Germany) and comparison with sequences retrieved from GenBank resulted in nucleotide and amino acid sequence identities of 93 and 90% (coat protein) to the CtRLV strain UK-1 (Accession No. AY695933) and 86 and 96% (replicase) to the German CMoV isolate (Accession No. FJ188473), respectively. Carrot samples also tested CtRLV-positive in triple-antibody sandwich-ELISA using polyclonal IgGs to CtRLV for trapping and a mixture of two CtRLV-specific monoclonal antibodies (CtRLV-2-3A9 and CtRLV 3-4B9) as detecting antibodies (all from the stock of the Julius Kuehn Institute; H. J. Vetten, Braunschweig, Germany). The presence of CMoV was confirmed by sap transmission to Nicotiana benthamiana and N. occidentalis ‘P1’, which resulted in vein yellowing/etching symptoms. In addition, agarose gel electrophoresis of the dsRNA extract of a primary infected carrot sample revealed major dsRNAs of approximately 4.2 and 1.4 kbp, which represent the genomic and subgenomic RNAs of an umbravirus. Thus, sequence analysis, as well as serological and biological data, demonstrates that CMD-affected carrot plants from Mauritius were infected with CtRLV and CMoV isolates closely related to those from Europe. The sequences obtained in this study for CtRLV and CMoV have been deposited in GenBank under Accession Nos. FJ969849 and FJ969848, respectively. To our knowledge, this is the first report of CMD in Mauritius and the Indian Ocean Region. Future works comprise an island wide survey across carrot-growing regions to determine the incidence of the virus complex and the natural host range of the viruses in Mauritius. References: (1) A. D. Abraham et al. Plant Dis. 91:1059, 2007. (2) A. F. Murant. No 137 in: Descriptions of Plant Viruses. Assoc. Appl. Biol. Kew, England, 1974.

During a survey of legume crops in the northeast and northwest regions of Tunisia in April 2010, plants showing yellowing, reddening, and stunting symptoms were observed. A total of 281 symptomatic samples were collected: 142 plants from 10 chickpea (Cicer arietinum L.) fields, 84 plants from six faba bean (Vicia faba L.) fields, and 55 plants from six pea (Pisum sativum L.) fields. All samples were tested by the tissue-blot immunoassay procedure with the following monoclonal antibodies (MAbs): a broad-spectrum legume-luteovirus MAb (5G4), Faba bean necrotic yellows virus (FBNYV; genus Nanovirus, family Nanovirudae) (3-2E9; provided by J. Vetten, BBA, Braunschweig, Germany), Beet western yellows virus (BWYV; genus Polerovirus, family Luteoviridae) (A5977; Agdia, Elkhart, IN), Bean leafroll virus (BLRV; genus Luteovirus, family Luteoviridae) (4B10), Soybean dwarf virus (SbDV; genus Luteovirus, family Luteoviridae) (ATCC PVAS-650; American Type Culture Collection ATCC, Rockville, MD,), and a mixture of three MAbs (5-2B8, -3D5, and -5B8) to a Syrian isolate of Chickpea chlorotic stunt virus (CpCSV) (1). Serological tests showed that CpCSV was detected in 121 samples (43.06%) (62 chickpea, 57 faba bean, and 2 pea), followed by FBNYV (detected in three faba bean and three pea), BWYV (detected in three chickpea and one faba bean), and BLRV (detected in one pea sample). FBNYV, BLRV, and BWYV have been previously detected in faba bean and chickpea in Tunisia (4), but to our knowledge, this is the first report of CpCSV affecting legumes in Tunisia, which was found in seven chickpea, seven faba bean, and two pea fields. CpCSV has been reported to naturally infect legume crops such as chickpea, lentil, field pea, and faba bean as well as some leguminous weeds and a few wild non-legume plants species in many countries in West Asia and North Africa and causes economic losses on chickpea in Eritrea, Ethiopia, and Syria (1–3). Serological results of CpCSV was confirmed in four (two pea, one faba bean, and one chickpea) samples by reverse transcription (RT)-PCR using CpCSV specific primers (F:5′-TAGGCGTACTGTTCAGCGGG-3′ and R:5′-TCCTTTGTCCATTCGAGGTGA-3′) (3), which produced an amplicon of expected size (413 bp). No amplification was observed from healthy plant extracts. Sequence analysis revealed that the four Tunisian isolates (TuV 258-201 collected from faba bean [GenBank Accession No. HQ199310], TuC 215-201 collected from chickpea [HQ199307], and TuP 163-201 [HQ199308] and TuP 166-201 collected from pea [HQ199309]) were most similar to each other with a high sequence identity (99%) and clustered with isolates of CpCSV from Syria (GenBank Accession No. EU541270), Egypt (EU541269), and Morocco (EU541267), to which they were most closely related (98%). The Tunisian isolates also showed high sequence identity (96%) in the coat protein region with Ethiopian (GenBank Accession No. EU541257) and Sudanese (EU541263) isolates. However, all isolates are distinct from BWYV, BLRV, and SbDV (less than 70% sequence identity). Since CpCSV is transmitted by aphids only, additional studies are needed to identify the host range of the virus and the efficient aphid vectors to better understand the epidemiology of this virus under Tunisian conditions References: (1) A. D. Abraham et al. Arch.Virol. 154:791; 2009. (2) N. Y. Asaad et al. J. Phytopathol. 157:756, 2009. (3) S. G. Kumari et al. Phytopathol. Mediterr. 47:42, 2008. (4) A. Najar et al. Phytopathol. Mediterr. 39:423, 2000.

During surveys for common bean viruses in Central Province of Zambia in April 2018, symptoms of bushy top, deep green curled branches and patchy leaf chlorosis were observed on five plants in a 2-ha farmer's field. Total RNA was isolated from symptomatic leaf samples using the CTAB method (Chang et al. 1993). The RNA from one sample (CP414-1) was used to construct a cDNA library with the Illumina TruSeq RNA Library Prep Kit (Illumina, San Diego, CA), followed by high-throughput sequencing (HTS) on the Illumina MiSeq platform that generated ~3.1M single-end raw reads of ~300 nucleotides (nt) each. A total of 355,885 reads showed hits to Ethiopian tobacco bushy top virus (ETBTV; Umbravirus), ETBTV satellite RNA (satRNA) and peanut mottle virus (PeMoV, Potyvirus) based on BLASTn analysis. The full-length genomes of ETBTV (4239-nt; MT225089), its satRNA (521-nt; MT225092) and PeMoV (9,643-nt) were assembled from the HTS reads using Geneious R11.1.2 (Biomatters, Auckland, New Zealand). The obtained complete genome sequences of ETBTV (MT225089) and ETBTV satRNA (MT225092) shared 88% and 95% nt identities, respectively with the corresponding viral (KJ918748) and satRNA (KJ918747) sequences of isolate 18-2 (Abraham et al. 2014). The near complete PeMoV genome was 89% identical to isolate Liaoning (MH270528). The HTS results were validated by two-step RT-PCR analyses of the five field-collected samples using newly designed primer pairs (data not shown). All five samples gave the expected 988-bp ETBTV-specific and 521-bp satRNA-specific DNA bands while three samples produced the expected 2100-bp PeMoV-specific fragment. The virus specificities of the agent specific PCR fragments were ascertained by Sanger sequencing (ETBTV: MT225090-91; ETBTV satRNA: MT225093-94; PeMoV: MT900843-44) and they shared 98-100% identities with their corresponding HTS-derived sequences. To further probe for the presence of an ETBTV helper virus, the samples were screened by RT-PCR with the degenerate primer pair Lu1-mod-F/C2R3 that was modified from Robertson et al. (1991). The expected 245-bp DNA bands was obtained from all five samples, indicating the presence of a possible luteovirus or polerovirus target in these samples. The BLASTn analyses of the two Sanger sequenced gel-eluted products (MT900845-46) showed that they shared 100% identity with each other and 96% nt identity with cowpea polerovirus 1 (CPPV1, KX599163). Leaf tissue extracts from a common bean plant that was confirmed by RT-PCR to be positive for all four agents were rub-inoculated onto Nicotiana occidentalis and common bean (Sutter Pink) plants (n=5 each) at the three fully expanded leaf stage, with a buffer inoculation as control. Systemic foliar symptoms consisting of leaf deformation, stunting and leaf bushy top were observed on all ten plants, 10 days post-inoculation whereas the control plants remained symptomless. All the test plants were screened by RT-PCR as described above. The results showed that all five N. occidentalis plants were positive for ETBTV+ETBTVsatRNA, the five common bean plants tested positive for ETBTV+satRNA+PeMoV, and all 10 plants of both species were negative for CPPV1. To the best of our knowledge, this is the first report of ETBTV, ETBTV satRNA and CPPV1 infecting common bean in Zambia, and the first molecular based confirmation of PeMoV occurrence in the country. Ongoing studies are focused on determining the extent of the disease spread and assessment of its economic impact.

Chickpea (Cicer arietinum L.; family Fabaceae) plants with symptoms typical of virus infection (chlorosis, stunting, necrosis, yellowing, and reddening) were collected during disease surveys in June 2012 (386 samples from 23 fields) and May to June 2013 (288 samples from 19 fields) from the major chickpea-growing regions (Tashkent, Sirdarya, Jizzah, Samarkand, and Surkhandarya) of Uzbekistan. All samples were tested first by tissue-blot immunoassay (TBIA) (Makkouk and Kumari 1996) with a broad-spectrum legume luteovirus monoclonal antibody (MAb) (5G4; Katul 1992). For comparison of relative reactions, blots from positive legume luteoviruses (bean leafroll virus [BLRV], beet western yellows virus [BWYV], and chickpea chlorotic stunt virus [CpCSV]) and heathy plants were included for each TBIA. To identify the individual legume luteoviruses, the samples with positive reaction to MAb 5G4 were retested further using specific MAbs to BWYV (A5977 from Agdia, U.S.A.), BLRV (4B10; Katul 1992), a mixture of three MAbs (1-1G5, 1-3H4, and 1-4B12) to an Ethiopian isolate of CpCSV, and a mixture of three MAbs (5-2B8, 5-3D5, and 5-5B8) to a Syrian isolate of CpCSV (Abraham et al. 2009). Total RNA was extracted from 35 chickpea samples that showed positive reaction to 5G4 MAb only, or to 5G4 and other MAbs. Reverse transcription-polymerase chain reaction (RT-PCR) was performed using polerovirus group-specific primers AS3 (5′-CACGCGTCIACCTATTTIGGRTTITG-3′) (Abraham et al. 2008) and Pol3870F (5′-ATCACBTTCGGGCCGWSTYTWTCAGA-3′), as described by Sharman et al. (2015), except with the use of MyTaq Red DNA Polymerase (Bioline, U.K.). RT-PCR amplicons of the partial coat protein gene of the expected size (376 bp) were directly sequenced. Four out of 35 tested samples had 96 to 97% nucleotide (nt) sequence identity with the Brazilian (GQ401140 and KP176644) and Argentinean (KF359947) isolates of cotton leafroll dwarf virus (CLRDV, genus Polerovirus, family Luteoviridae). To confirm CLRDV infection in these chickpea samples, they were tested by RT-PCR using CLRDV-specific primer CLRDV3675F (5′-CCACGTAGRCGCAACAGGCGT-3′) and Pol3982R (5′-CGAGGCCTCGGAGATGAACT-3′) (Sharman et al. 2015). Amplicons of the expected size (310 bp) were obtained from all four samples and were sequenced in both directions. These four samples (UzCp137-13, UzCp148-13, UzCp149-13, and UzCp154-13) were collected in 2013 from one field in the Surkhandarya region, and their nucleotide sequences were deposited in GenBank under accession numbers MK461134, MK461135, MK461136, and MK461137, respectively. After removal of primers, the resulting consensus sequences were 268 nucleotides in length and shared greater than 99% nt identity among them, and as such further analysis was done for sample UzCp137-13, for which the closest match by BLAST was 98% nt identity to a CLRDV isolate from Argentina (KF359947). To our knowledge, this is the first report of CLRDV in chickpea from Uzbekistan. Mukherjee et al. (2016) studied the genetic similarity between CLRDV and chickpea stunt disease associated virus (CpSDaV) in India and found the coat protein gene sequences of both viruses to be almost identical (89.4 to 100% depending on the virus isolates), suggesting that CpSDaV is likely a strain of CLRDV. Chickpea stunt is a major disease of chickpeas in India, and thus CLRDV will be of huge concern to both chickpea and cotton production in Uzbekistan.

Cotton leafroll dwarf virus (CLRDV, family Luteoviridae, genus Polerovirus) was recently reported in cotton (Gossypium hirsutum L.) plants affected by cotton leafroll dwarf disease (CLRDD) in the United States (Alabama, Georgia, Kansas, Mississippi, and Texas) (Aboughanem-Sabanadzovic et al. 2019; Alabi et al. 2020; Ali and Mokhtari 2020; Avelar et al. 2019; Tabassum et al. 2019). From July to September 2019, a CLRDV survey was conducted in 10 counties (Aiken, Anderson, Barnwell, Calhoun, Chester, Clarendon, Darlington, Florence, Sumter, and York) representing the cotton-growing areas in South Carolina. The CLRDD-like symptoms observed in the fields included pronounced rugosity, curling, and distortion of leaves, reddening of the petioles and leaves, brittle leaves when handled, shortened internodes and stunting, and a reduction in boll set. The disease incidence across 17 fields was estimated to range from 5 to 25% based on visual assessment of symptoms. From each county, leaf/petiole samples from two to four cotton plants showing CLRDD-like symptoms were collected from one to two fields and tested in the lab for the presence of CLRDV by RT-PCR. RNA was extracted from each plant sample using Qiagen RNeasy Plant Mini kits (Qiagen, Germantown, MD) following the manufacturer’s recommendations. The cDNA was synthesized using a SuperScript IV first-strand synthesis system (ThermoFisher Scientific, Waltham, MA) and amplified with CLRDV-specific PCR primers CLRDV3675F/Pol3982R (Sharman et al. 2015) targeting a 310-bp segment of ORF3 to ORF5. Positive (cDNA of CLRDV, Elmore County, AL) and negative (nontemplate) controls were included in each run, and PCR products were examined by gel electrophoresis. Twenty-six samples (78.8%) out of 33 tested produced the expected PCR bands. The positive samples were derived from cultivars DeltaPine 1646 B2XF and Phytogen 430 W3FE, and they spanned all 10 surveyed counties. All positive samples were further amplified with three additional primer pairs specifically designed to detect CLRDV: CLRDV-RdRpF2/CLRDV-RdRpR1 (Aboughanem-Sabanadzovic et al. 2019), amplifying a 770-bp region of ORF1 to ORF2; AL674F/AL1407R (Avelar et al. 2019), amplifying a 733-bp portion of ORF0 to ORF1; and CLPOF/CLPOR (Cascardo et al. 2015), amplifying a 783-bp fragment spanning ORF0. DNA bands of the expected sizes were obtained with each primer pair as examined by agarose gel electrophoresis. The PCR products for one Barnwell County sample (all four primer pairs) and the CLPOF/CLPOR-specific products from one sample each from Anderson and Sumter Counties were directly sequenced. After removing the primer sequences, the partial CLRDV sequences from the three samples were deposited in GenBank (MN651102 to MN651107). All six sequences showed very high nucleotide identities (98.9 to 100%; 98 to 100% query coverage) to corresponding sequences of CLRDV isolates from Alabama (MN071395 and MN883237) based on BLASTn analysis. To our knowledge, this is the first report of CLRDV infecting cotton in South Carolina. CLRDD could negatively impact the cotton industry in South Carolina and other cotton-producing states due to its potential to reduce yield. Future research is needed to quantify the impact of the virus on cotton production in the United States and to identify strategies for minimizing the potential economic losses.

In the United States, cotton leafroll dwarf disease, caused by cotton leafroll dwarf virus (CLRDV, Polerovirus, Luteoviridae), was first reported from cotton (Gossypium hirsutum L.) fields in Alabama (Avelar et al. 2019) and later Mississippi (Aboughanem-Sabanadzovic et al. 2019) and Georgia (Tabassum et al. 2019). During a survey of cotton fields in Barber County, Kansas, in the 2019 growing season, cotton plants showed virus-like symptoms including leaf yellowing, discoloration, reddening, and short internodes with reduced or small boll sets. Disease incidence based on virus-like symptoms was ∼1 to 15% depending on the affected fields. Eleven symptomatic and seven apparently asymptomatic leaf samples from 18 independent cotton plants (cv. PhytoGen 210) were collected in commercial cotton fields and tested for the presence of the virus in the Plant Virology Lab at the University of Tulsa, Oklahoma. Total RNA was extracted from all 18 samples by the Spectrum Plant Total RNA Kit (Sigma-Aldrich) and was synthesized into complementary DNA (cDNA) using the Superscript IV Reverse Transcription Kit (ThermoFisher Scientific) according to the manufacturer’s instructions. The polymerase chain reaction (PCR) was performed with primers CLRDV3675F and Pol3982R as described previously (Sharman et al. 2015) to amplify a specific PCR product of 310 bp of the ORF3-5 fragment of the CLRDV. cDNA of CLRDV for the specific fragment was obtained from the Plant Disease Diagnostic Lab at Auburn University and was used as a positive control. A PCR product of the predicted size (310 bp) was obtained from seven symptomatic cotton samples and the positive control, whereas no bands were present in four symptomatic and seven asymptomatic samples, as well as the PCR negative control. RT-PCR was repeated twice with these samples and obtained the same results as above. The PCR products of all positive samples were directly sequenced, and sequence comparison showed 97 to 99% identity with the CLRDV-Alabama isolate (MN071395). To further confirm the presence of CLRDV in these samples, two additional pair of primers—AL674F and AL1407R for partial P0/P1 (Avelar et al. 2019) and RdRpF2 and RdRpR1 for partial RdRp (Aboughanem-Sabanadzovic et al. 2019)—were used to amplify the 694- and 770-bp product of the CLRDV genome, respectively. The expected PCR bands were obtained from all seven symptomatic cotton plants but none from asymptomatic samples. PCR products of 694 and 770 bp from two samples (KS-7 and KS-10 isolates) were purified, cloned into pGEM-T Easy vector (Promega), and transformed into Escherichia coli DH5α cells (New England Bio Labs). At least three clones were sequenced using the Applied Biosystem 3130 Genetic Analyzer at the University of Tulsa. Sequences obtained in this study for partial P0/P1and RdRP genes of KS-7 and KS-10 isolates were deposited in GenBank (MN809925 to 28). Nucleotide sequence comparisons and BLASTn analysis of partial P1/P0 (MN809927 to 28) showed 98 to 99% identity with corresponding sequences of Alabama isolates (MH883237 and MN071395) and 92 to 93% identity with typical and 91 to 92% identity with atypical CLRDV isolates from Argentina and Brazil. Similarly, partial RdRP genes (MN809925 to 26) showed 94 to 98% identity with the corresponding sequences of available CLRDV isolates from Mississippi (MK512759, MK512762 to 64) and Alabama (MN071395) and 93 to 96% identity with typical and 92 to 95% identity with atypical CLRDV isolates from Argentina and Brazil. This is the first report of CLRDV infection and occurrence in cotton fields in Kansas. Cotton acreage in Kansas has increased since 2018 by 40% (NASS 2018), and the presence of CLRDV could be a detrimental disease for cotton production. Therefore, further studies are needed, including other cotton-growing counties in Kansas, to determine the distribution, epidemiology, vector transmission, and population structure of this virus, which would be helpful in the management of CLRDV.

Maize yellow mosaic virus (MaYMV) is a novel putative polerovirus recently found in maize (Zea mays) in China and has been detected not only in Asia but also in Africa and South America (Chen et al. 2016; Goncalves et al. 2017; Palanga et al. 2017). In addition, MaYMV infection has also been reported in sugarcane (Saccharum spp.) and itch grass (Rottboellia cochinchinensis) (Yahaya et al. 2017). Recently, the first occurrence of MaYMV in South Korea has been reported from Panicum miliaceum and Sorghum bicolor using high-throughput RNA sequencing (Lim et al. 2018). Therefore, to confirm whether MaYMV exists in maize in South Korea, a total of 26 maize samples with yellowing, yellow stripe, and chlorosis symptoms were collected from three provinces (Chungcheongbuk-do, Gangwon-do, and Gyeongsangnam-do) in August and September 2017. Total RNA was extracted from all samples using the easy-spin Total RNA Extraction Kit (iNtRON Biotechnology, Seongnam, Korea). Reverse transcription polymerase chain reaction (RT-PCR) was conducted using SuPrimeScript RT-PCR Premix (GeNet Bio, Daejeon, Korea) and MaYMV-specific primers (Chen et al. 2016), producing an amplicon with expected size of 753 bp, using protocols described previously (Lim et al. 2018). Five out of six samples collected from Chungcheongbuk-do, five out of 10 samples collected from Gangwon-do, and one out of 10 samples collected from Gyeongsangnam-do were confirmed to be infected with MaYMV. One RT-PCR fragment of MaYMV from each region (Gangwon-do, Chungcheongbuk-do, and Gyeongsangnam-do) was directly sequenced (Macrogen, Daejeon, Korea), and the sequences were deposited in GenBank under accession numbers MG020517, MG020518, and MG020519, respectively. The partial nucleotide sequences of MaYMV determined in each sample collected from Chungcheongbuk-do and Gyeongsangnam-do were identical, and these nucleotide sequences differed by one nucleotide from that identified in the sample collected from Gangwon-do. The NCBI BLAST search showed that the three MaYMV isolates shared high nucleotide sequence homology (99 to 100%) with isolates Yunnan3 (KU291099) and Yunnan4 (KU291100) from maize in China. The MaYMV-infected samples showed yellow stripe and chlorosis symptoms, which tend to first appear on the tip and edge of the leaves and become worse. However, further studies are needed, because it is uncertain whether the symptoms were caused by a single infection with MaYMV. To the best of our knowledge, this is the first report of MaYMV on Z. mays in South Korea.

During the 2018 growing season, cotton plants in several fields in Georgia were observed with symptoms that included leaf curling, reddening and drooping of leaves, subsequent distortion of leaf growth above the nodes where reddened leaves were first observed, and shortening of upper internodes and their discoloration to deep green. These symptoms were visible in the upper portion of the plants, resembling “cotton blue” disease caused by cotton leafroll dwarf virus (CLRDV) (family Luteoviridae, genus Polerovirus). The symptoms were observed sporadically with less than 10% disease incidence within affected fields. CLRDV is a phloem-limited virus with single-stranded, positive-sense RNA genome, transmitted by aphids (Aphis gossypii) in a persistent, circulative, nonpropagative manner (Distefano et al. 2010; Sharman et al. 2015). A total of 93 symptomatic and asymptomatic leaves and petioles were collected from several different commercial cotton fields in the southern part of the state. Total RNA was extracted using the modified cetyltrimethylammonium bromide method (Sharman et al. 2015). Complementary DNA (cDNA) was synthesized from 2.5 µg of total RNA using Superscript III reverse transcription (Invitrogen, U.S.A.) and specific reverse primers targeting different open reading frames (ORFs) of the virus genome. The cDNA was used for polymerase chain reaction (PCR) with primers CLRDV3675F and Pol3982R targeting ORF 3 of the virus (310-bp product, Sharman et al. 2015) and primers 17 and 18 targeting ORF 5 (1,065-bp product, Distefano et al. 2010). A new set of primers, SB11F (5′-AGGTTTTCTGGTAGCAGTACCAATATCAACGTTA-3′) and SB11R (5′-TATCTTGCATTGTGGATTTCCCTCATAA-3′), was developed to amplify the 803-bp fragment spanning complete ORF 3 and ORF 4, encoding virus coat protein and movement protein genes. Using the three different sets of primers, products of predicted sizes were amplified from the symptomatic tissues, but not from asymptomatic tissues collected from fields and negative controls including asymptomatic leaves from plants grown in an insect-free controlled growth chamber and DNase/RNase free water (Invitrogen). Reverse transcription PCR products were gel purified, cloned into TOPO-TA cloning vector (Invitrogen), and sequenced using Sanger sequencing (GeneScript, NJ). The consensus sequence of three clones for ORF 3 and 4 from this study (MK290759 and MK290760) when analyzed using NCBI-BLASTn showed 97% sequence identity with the Brazilian and Argentinean isolates (KF906261.1 and KF359947.1, respectively) and many other isolates from South American and Asian countries. ORF 3 and 4 sequences from Georgia shared 98 to 99% identity among themselves. The partial sequences for ORF 5 (MK513938 and MK513939) shared 95% identity with the isolate from Argentina (KF359946.1 and KF359947.1). The presence of the virus was detected in all the symptomatic samples collected from 14 counties in Georgia, covering the entire cotton growing region of the state. To the best of our knowledge, this is the first report of CLRDV in Georgia, U.S.A. CLRDV infection of cotton has been reported in other cotton-growing regions in Africa, Asia, South America, and, more recently, in Alabama, U.S.A. (Avelar et al. 2018; Correa et al. 2005; Distefano et al. 2010; Mukherjee et al. 2012). With its rapid spread, this virus could pose an imminent threat and cause severe economic losses to the cotton industry. Further research is needed to elucidate epidemiology, symptomatology, vector transmission, and crop losses owing to CLRDV in the United States.

Cotton leafroll dwarf virus (CLRDV), associated with “cotton blue disease” known to occur in Africa, Asia-Pacific, and South America (Correa et al. 2005; Distefano et al. 2010; Ray et al. 2016), has been recently reported from Alabama (Avelar et al. 2019), which prompted a survey of the Mississippi (MS) cotton production area during late October and early November 2018. During the survey, 60 samples of healthy-looking and CLRDV-suspect plants were collected from 17 counties and tested for the presence of the virus. Diseased plants expressed a range of symptoms including leaf curling, reddening and distortion, unusual secondary plant growth characterized by shortened internodes, and a general reduction in boll set. Cotton aphids (Aphis gossypii Glover) were also present on some of the collected plant material. Disease incidence in individual fields, estimated visually, ranged from 20% with the greater values occurring in southeast MS. Thirteen samples were initially tested at the Plant Disease Diagnostic Lab at Auburn University with a two-step RT-PCR protocol (Sharman et al. 2015), while the remainder were examined in the Plant Virology Lab at Mississippi State University with two independent single-tube RT-PCR tests originally designed in this study. To prepare samples for virus-specific tests, total RNAs were purified from petioles using the manufacturer’s protocol for the Qiagen Plant RNA Easy kit. A single-tube RT-PCR test was performed using a set of primers (CLRDV-CPF1 5′ ACGACGAAGACGAGGAGGTC′ and CLRDV-CPR1 5′ GAACCGGAGGATGTTGAAGAGG 3′) designed to amplify a 249-nt-long segment of the viral coat protein (CP) gene. A specific PCR product of predicted size was present in 38 samples collected from 13 counties indicating relatively high virus incidence (63%) and prevalence (76%). No visible bands were present in negative and water/blank controls. No discrepancies in results were observed when 10 randomly selected samples tested in one-tube tests with CP primers were verified by the protocol of Sharman et al. (2015) and with another set of primers designed in this study targeting a 770-nt-long portion of viral RdRp gene (CLRDV-RdRpF2 5′GGAGCCGCACAAACAAGCTAA 3′and CLRDV-RdRpR1 5′ AACAGGCGTTCAGGTAGTTGGA 3′). Both amplicons (249 bp and 770 bp) from six samples collected from four counties (Bolivar, Grenada, Tallahatchie, and Washington) were cloned and custom sequenced. Pair-wise and BLASTn analyses revealed that they share highly conserved nucleotide content (95 to 100%) with each other and with the recent record from Alabama (GenBank MH883236), as well as with CLRDV isolates from Brazil and Argentina available in the NCBI/GenBank (December 2018). Nucleotide sequences of two genomic regions (RdRp and CP) for six virus isolates from Mississippi have been deposited in GenBank under accession nos. MK512759 to MK512770. This is the first report of polerovirus infections of cotton in MS. Results from this study, along with recent report of the same virus from Alabama, call for multidisciplinary research to understand population structure, epidemiology and ecology of the virus, and its potential impact on the United States cotton industry.

The recent reports of the Polerovirus, Maize yellow mosaic virus (MaYMV) infecting sugarcane (Saccharum spp.) and itch grass (Rottboellia cochinchinensis) in Nigeria (Yahaya et al. 2017) and maize in Burkina Faso (Palanga et al. 2017) provided the motivation for this study. To determine the presence of MaYMV or other poleroviruses, we explored a collection of maize samples of local cultivars taken during virus surveys in August 2015 and July 2016 to assess the distribution of maize lethal necrosis disease (MLND) in three major maize cultivation regions of Ethiopia including Benishangul-Gumuz, Oromia, and South Nations, Nationalities, and People (SNNP). The collection comprised 47 leaf samples from symptomatic maize plants showing yellowing, whitish to yellowish stripes, and mosaic symptoms maintained as dried tissues over anhydrous calcium chloride. Total RNA was extracted using an RNA miniprep kit (Epoch Life Science) following the manufacturer’s instructions. RNA from each sample was screened by one-step RT-PCR with the universal polerovirus primer pair Gen 1 and Gen 2, comprising 322 nucleotides of the coat protein gene (Afouda et al. 2017). By RT-PCR, 78 and 71% of the samples collected in 2015 and 2016, respectively, tested positive for MaYMV. Direct sequencing of the amplified DNA fragments in both directions confirmed near identity (≥99% nt identity) of all Ethiopian sequences and shared 98 to 99% identity to the reference sequence of MaYMV (KU248489). The shared identity to another maize infecting polerovirus species, Maize yellow dwarf virus RMV (MYDV-RMV, NC_021484), ranged from 80 to 81%. To assess the genome variability of the Ethiopian MaYMV isolates, three isolates from three different provinces were selected to perform a deep sequencing analysis. Three independent Illumina libraries were prepared from the respective total RNA and were run on an Illumina MiSeq platform as described by Afouda et al. (2017). De novo and mapped based genome assembly was performed with Geneious v 10.2.3 (Biomatters LTD, NZ). The complete genome sequence of MaYMV isolate MV115 from Basha province was determined with 5,642 nt (MF684369), which was assembled from 36,673 of 2,003,892 reads with an average coverage of 1,141.7. Two near full-length genome sequences were determined, one for isolate MV32 from Wolenchiti Province (5,498 nt, MF684367, 1,820 reads of 2,517,898, mean coverage was 61.3) and for isolate MV90 from Dugda Bora Province (5,504 nt, MF684368, 878 reads of 1,925,886, mean coverage was 33.1). All three determined sequences of MaYMV shared 99.6% identity to each other. The complete MaYMV genome sequence (5,642 nt) of the Ethiopian isolate (MF684369) shared 96.8% nt identity with the Chinese isolate (KU248489), 98.2% with the Nigerian isolate (KY684356), and 95.4% with the isolate from Ecuador (KY052793). This first report of MaYMV in Ethiopia provides evidence for its nationwide distribution and the prevalence of a virus that may have occurred in Ethiopia for some time but was overlooked in targeted surveys focusing on MLND and other prominent maize diseases.

A survey of cucurbit fields was conducted in the September 2017 growing season in Oklahoma. A total of 121 symptomatic leaf samples (103 from pumpkin and 18 from squash) showing mosaic, mottling, and chlorosis and 10 asymptomatic samples from pumpkin (Cucurbita pepo) were collected from grower’s fields located in various counties. All samples were tested against the polyclonal antisera (AC Diagnostics, Fayetteville, AR) of 10 known cucurbit-infecting viruses including Papaya ringspot virus (PRSV), Watermelon mosaic virus (WMV), Zucchini mosaic virus (ZYMV), and Cucurbit aphid-borne yellows virus (CABYV, genus Polerovirus, family Luteoviridae) by dot-immunobinding assay (DIBA) as described previously (Ali et al. 2012). Eleven out of 121 symptomatic samples (eight samples from Blaine County and three from Payne County) of pumpkin reacted positively against the antisera of CABYV by DIBA, and the remaining samples were positive to WMV, PRSV, and ZYMV. None of the asymptomatic samples were positive against the 10 viruses in the DIBA. To further confirm the CABYV infection in these pumpkin samples, four of the eleven CABYV-DIBA-positive pumpkin samples (one from Payne County and three from Blaine County) were randomly selected, and total RNA was extracted using TRI reagent (Molecular Research). Reverse transcription polymerase chain reaction (PCR) was carried out using a pair of primers (CABYV-CP-F, 5′-ATGAATACGGCCGCGGCTAGAAATC-3′; CABYV-CP-R, 5′-CTATTTCGGGTTCTGGACCTGGCA-3′) that are specific to the coat protein (CP) gene of CABYV (Choi et al. 2015). Expected PCR products of approximately 600 bp were observed in all four Oklahoma samples (designated as isolates BL-4, BL-8, BL-45, and PY-46) when PCR products were analyzed on 1% agarose gel electrophoresis. An aliquot (5 µl) of PCR product from each sample was cleaned with 2 µl of ExoSAP-IT (Affymetrix). The cleaned PCR products were directly sequenced using ABI sequencer (3130XL genetic analyzer, Hitachi) at the core facility in the Department of Biological Science, University of Tulsa. The complete sequence of the CP gene of all four Oklahoma CABYV isolates (accession nos. MG590258, MG590259, MG590260, and MG590261) showed sequence identities from 98.0 to 98.3% with CABYV isolates from China (accession no. EU636992) and South Korea (accession no. KR231959) using the BLASTn algorithm, and the sequence identity among the four Oklahoma CABYV isolates ranged from 99.6 to 99.8%. Our results indicate the first report of CABYV infecting cucurbits in Oklahoma. CABYV was first described in France in 1992 (Lecoq et al. 1992), and in the United States it was first reported in California in 1993 (Lemaire et al. 1993). Cucurbits are economically important cash crops worldwide; therefore, the presence of CABYV poses a threat for cucurbit production in Oklahoma.

Maize yellow mosaic virus (MaYMV) is a tentative new Polerovirus, which was recently identified from maize (Zea mays) in China (Chen et al. 2016). MaYMV has also been reported to infect sugarcane (Saccharum spp.) and itch grass (Rottboellia cochinchinensis), and it has been reported in Asia, Africa and South America (Goncalves et al. 2017; Palanga et al. 2017; Yahaya et al. 2017). In this study, MaYMV was detected in Panicum miliaceum and Sorghum bicolor using Illumina HiSeq2500 system by Theragen Etex Bio Institute (Suwon, Korea) and SG-VIPdb by SeqGenesis (Daejeon, Korea), as described by Lim et al. (2015). Twenty samples of P. miliaceum and sixty three samples of S. bicolor were collected from July to September and from June to October, 2016, respectively, in South Korea. The high-throughput RNA sequencing of the samples mixed into one pool resulted in a single large contig (5606-nt) with nearly complete MaYMV genome coverage. The contig was assembled from a total of 234,537 reads; the maximum, minimum...

Epiphyllum spp. (orchid cactus) is a group of epiphytic plants in the cactus family grown as flowering ornamentals. Symptoms of virus infections are frequently observed in them (Chessin and Hammond 2002). In 2015, an Epiphyllum hybrid with chlorotic spots was found in California. Twelve more Epiphyllum hybrids (six with chlorotic ring spots, mottle, or mosaic and six asymptomatic) were obtained from a commercial nursery in New York. These plants were tested by RT-PCR/PCR using specific primers for Cactus mild mottle virus, Cactus virus X (CVX), Impatiens necrotic spot virus, Saguaro cactus virus, Zygocactus virus X (ZVX), or group primers for badnaviruses and potyviruses. Two potexviruses, CVX and ZVX, were detected from three and one symptomatic hybrids, respectively. The California hybrid and seven New York hybrids (two symptomatic and five asymptomatic) tested positive for a badnavirus. However, no target viruses were detected in two of the seven symptomatic hybrids. To further investigate these observations, total RNAs were extracted from stem tissue of four symptomatic hybrids (one CVX-positive, one ZVX-positive, and two PCR-negative plants) and one asymptomatic hybrid (cv. Professor Ebert) using RNeasy Plant Mini Kit (Qiagen). A pooled extract from the five samples was subjected to high-throughput RNA sequencing (SeqMatic). Analysis of the RNA reads revealed the presence of Alternanthera mosaic virus, Beet western yellows virus (BWYV), and five new viruses (one ampelovirus, one badnavirus, two distinct carlaviruses, and one caulimovirus) in addition to CVX and ZVX. Virus infections in all 13 cacti were further tested for the seven viruses (two known and five new viruses identified in this study) by RT-PCR/PCR using virus-specific primers. Results showed that the symptomless hybrid Professor Ebert was infected with five viruses (BWYV, an ampelovirus, two carlaviruses, and a caulimovirus), the most among the all hybrids. BWYV was detected by RT-PCR using primers BWYVf4972 (5′-TCTGAAGGTCGGTGAAGGAGG-3′) and BWYVr5665 (5′-ACAATGGGTAACACTCGTTGC-3′) only in Professor Ebert. To obtain the genomic sequence of this BWYV isolate, RT-PCR was conducted using seven overlapping primer pairs designed according to the alignment of the BWYV type species (GenBank no. NC_004756) and the contig obtained in this study. The RT-PCR amplicons were cloned into pGEM-T easy vector (Promega) and sequenced (MCLAB). A nearly full genomic sequence of 5,458 nt (MF543022) was assembled from seven overlapped amplicon sequences. BLAST search showed that this isolate had the highest nt sequence identity of 93% with a BWYV isolate infecting Nepenthes mirabilis (KU521325) (Miguel et al. 2016). Stem tips from the Professor Ebert plant were grafted onto four plants of hybrid King’s Ransom, which tested negative for the nine viruses included in this study. Three plants showed mild chlorotic speckling 6 months after grafting. BWYV was detected in new growth of the two grafted plants, indicating the virus was graft transmissible. Twenty additional Epiphyllum hybrids were tested by RT-PCR, and BWYV was detected from hybrids Tele Ann with mottle symptom and Vista Sun without symptoms. Thus, BWYV was detected in three different hybrids of Epiphyllum spp., an observation validated by RT-PCR, sequencing, and graft transmission. BWYV is an aphid-transmitted species of the genus Polerovirus in the family Luteoviridae. It has an extremely wide host range including legumes, crucifers, lettuce, and many weed species and can cause diseases in several crops worldwide (Duffus 1972). To our knowledge, this is the first report of BWYV in orchid cactus. It remains unclear whether BWYV causes symptoms in either single or mixed infections in other species and hybrids of Epiphyllum spp. However, these hosts can serve as a reservoir for the virus. We are currently characterizing the novel viruses detected in the hybrid Professor Ebert.

Experiments were undertaken to determine soybean aphid (i) landing rates in potato fields, (ii) population dynamics on potato, (iii) feeding behavior compared with green peach aphid on potato using the electrical penetration graph technique (EPG), (iv) acquisition, retention, and transmission of Potato leafroll virus (PLRV), and (v) if soybean aphid–infested crop borders could increase PLRV spread in seed potato. Soybean aphid (Aphis glycines) landed on potato but failed to establish colonies. EPG showed no significant differences between the aphid species in preprobe, xylem phase, sieve element salivation, and phloem sap ingestion durations on potato. Soybean aphid acquired PLRV 78% of the time, and 75 and 70% of individual aphids retained infectivity after 72 and 144 h, respectively. Soybean aphid transmitted PLRV to susceptible potato with 6 to 9% efficiency. Prior to the invasion of this exotic pest, soybean borders were commonly used in Minnesota and North Dakota to protect seed potato against spread of Potato virus Y. In 2002 and 2004, PLRV incidence was not different in potatoes with soybean borders whether treated with insecticide or not. In 2005, with extreme soybean aphid pressure, potatoes with untreated (no insecticide) borders had significantly greater PLRV spread. This is the first report of soybean aphid transmitting PLRV.

Maize (Zea mays) is a staple crop for human consumption and widely used as a livestock feed worldwide. Therefore, potential new diseases affecting this crop are of major concern. In May 2013, yellow mosaic and dwarfing symptoms were observed in several maize plants in a field located in the rural area of Casa Branca (21° 46′ 26″ S, 47° 5′ 9″ W), Sao Paulo state (Southeastern Brazil). Symptomatic leaves were sampled, and total RNA was isolated using Trizol™ reagent and further purified with PureLink™ RNA Mini Kit spin columns (Invitrogen, USA). A library was prepared with an Illumina TruSeq Stranded Total RNA sample preparation kit with Ribo-Zero Plant and sequenced on an Illumina Hiseq2500 platform at Macrogen Inc, South Korea. De novo assembly using Abyss 1.9 with K-mer = 64 yieldeda contig of 1183 nt with high similarities (92-93%) to several isolates sequences of Maize yellow mosaic virus (MaYMV), a putative new member of the genus Polerovirus, family Luteoviridae, recently reported in China (Chen et a...