Search

Cucumber green mottle mosaic virus (CGMMV), an emerging tobamovirus, has caused serious disease outbreaks to cucurbit crops in several countries, including the United States. Although CGMMV is seed-borne, the mechanism of its transmission from a contaminated seed to germinating seedling is still not fully understood, and the most suitable seed health assay method has not been well established. To evaluate the mechanism of seed transmissibility, using highly contaminated watermelon seeds collected from CGMMV-infected experimental plants, bioassays were conducted in a greenhouse through seedling grow-out and by mechanical inoculation. Through natural seedling grow-out, we did not observe seed transmission of CGMMV to germinating seedlings. However, efficient transmission of CGMMV was observed using bioassays on melon plants through mechanical inoculation of seed extract prepared from CGMMV-contaminated seeds. Understanding the seed-borne property and the ease of mechanical transmission of CGMMV from a contaminated seed to seedling is an important finding. In comparative evaluation of various laboratory techniques for seed health assays, we found that enzyme-linked immunosorbent assay and loop-mediated isothermal amplification were the most sensitive and reliable methods to detect CGMMV on cucurbit seeds. Because CGMMV is a seed-borne and highly contagious virus, a new infection might not result in a natural seedling grow-out; it could occur through mechanical transmission from contaminated seeds. Therefore, a sensitive seed health test is necessary to ensure CGMMV-free seed lots are used for planting.

Pea (Pisum sativum L.) is an economically important legume crop that is commonly used as dry beans, fresh peas, pods and shoots (Guo et al. 2009). Pea enation mosaic is an important virus disease of pea caused by two viruses in an obligate symbiosis, pea enation mosaic virus 1 (PEMV-1, Enamovirus, Luteoviridae) and pea enation mosaic virus 2 (PEMV-2, Umbravirus, Tombusviridae) (Hema et al. 2014). In November 2019, foliar yellow mosaic and vein enations symptoms were observed from pea plants in five fields of Honghe autonomous prefecture, Yunnan province, China. Incidence of symptomatic plants ranged from 20 to 40% and was distributed in both small and large fields. Leaves with typical virus-like symptoms were collected from five symptomatic pea plants in two fields and used for total RNA extraction. The five extracts of equimolar quantities were pooled into a sample and subjected to High Throughput Sequencing (HTS) by Illumina HiSeq system. Analyses of raw RNA reads were performed using CLC Genomics Workbench 12 (Qiagen). A total of 60,009,746 RNA reads were obtained from the sample, and de novo assembly of the reads using the CLC Genomics generated 88,105 contigs. BLASTN searches revealed the presence of contigs with high similarities to PEMV-1, PEMV-2, Pea seed-borne mosaic virus, and Bean yellow mosaic virus. To confirm the presence of PEMV-1 and PEMV-2 in the samples, two virus-specific primer pairs were designed based on the contig sequences obtained by HTS in this study. Primer pairs PEMV-1F/PEMV-1R (5'-ATGCCGACTAGATCGAAATC-3'/5'-TCAGAGGGAGGCATTCATTA-3') that flank the cp gene of PEMV-1 and PEMV-2F/PEMV-2R (5'-ATGACGATAATCATTAATG-3'/5'-TCACCCGTAGTGAGAGGCA-3') that target the ORF3 region of PEMV-2 were used to amplify the two viruses in RT-PCR. DNA fragments of the expected sizes (PEMV-1, 570 bp; PEMV-2, 693 bp) were amplified from all five samples. The RT-PCR products were cloned and sequenced. Sequence analysis showed that the 570-bp amplicon (MT481989) shared the highest nucleotide sequence identity of 98.95% with PEMV-1 (Z48507), while the 693-bp fragment (MT481990) had the highest nucleotide sequence identity of 97.4% with PEMV-2 isolate JKI (MK948534). One gram of the symptomatic leaves from each of the five plants was homogenized with 5 mL of 0.01 M phosphate-buffered saline (PBS buffer), pH 7.0. Each of the resulted saps was used to inoculate onto five healthy pea seedlings. A total of 25 healthy pea seedlings were inoculated, and 16 inoculated plants developed yellowing and mottling at 10 days post inoculation (dpi); no symptoms were observed on control plants inoculated only with PBS buffer. The formation of the typical enation was observed along the veins of lower side of the symptomatic leaves of the inoculated plants at 30 dpi. PEMV-1 and PEMV-2 infection were confirmed by RT-PCR assays using the specific primer pairs described above. Although the presence of the pea enation mosaic virus complex was suspected in China based on symptomatology (Brunt et al. 1997), to our knowledge, this is the first molecular confirmation of PEMV-1 and PEMV-2 occurrence in China. The co-infection of PEMV-1 and PEMV-2 usually cause severe yield losses; therefore, integration of detection and control measures is important in pea production regions where the two viruses occurred.

A polyclonal antiserum prepared against purified virions of tomato infectious chlorosis virus (TICV) was used to evaluate serological tests for its detection, to determine its distribution in infected plants, to study relationships among isolates of this virus, and to detect it in field samples. A cRNA probe representing TICV RNA 1 and RNA 2 was used in dot blot hybridization tests. A reverse transcriptase-polymerase chain reaction (RT-PCR) assay was also developed for detection of TICV isolates. The comparative study of these four techniques indicated that RT-PCR was 100-fold more sensitive than enzyme-linked immunosorbent assay (ELISA), Western blot, and dot blot hybridization assays for TICV detection. TICV was detected in leaf, stem, flower, and root tissues of the infected tomato plants. However, the virus was not uniformly distributed throughout the infected tomato plants, and the highest viral concentration was observed in fully developed young tomato leaves at the onset of yellowing symptoms. The virus was detected by indirect ELISA, Western blot, dot blot hybridization, and RT-PCR assays in laboratory-infected tomato, tomatillo, potato, and Nicotiana clevelandii and in naturally infected tomato, petunia, and Ranunculus sp. plants obtained from commercial sources. These tests indicate that there are apparently no detectable serological or nucleic acid differences among four TICV isolates obtained from Orange and Yolo Counties of California or from North Carolina or Italy.

Previous surveys for viruses in sweetpotatoes (Ipomoea batatas) in Africa did not assay for the presence of begomoviruses such as Sweet potato leaf curl virus (SPLCV), which have been found recently in the Americas and Asia. Symptomatic sweetpotato plants, including some with leaf curling symptoms similar to those observed in SPLCV-infected sweet-potato plants (2), were collected from a germplasm collection plot at Kakamega Research Station in Western Kenya during February 2005. Whiteflies, the vectors for begomoviruses, were observed in the same plots. Ipomoea setosa plants graft-inoculated with scions from the symptomatic sweetpotato developed leaf curl, leaf roll, interveinal chlorosis, and stunting symptoms similar to those caused by infection with SPLCV alone or in combination with Sweet potato feathery mottle virus. Total DNA was isolated from 10 I. setosa plants using the GenElute Plant Genomic DNA Kit (Sigma-Aldrich Inc., St. Louis, MO). Sweetpotato cuttings from 39 clones, selected from the Kenyan germplasm collection for their resistance or susceptibility to sweetpotato virus disease (SPVD), were sent to the Plant Germplasm Quarantine Office of USDA-ARS. The cuttings were planted in a greenhouse. Total DNA was extracted from sweetpotato leaves 1 month later using a cetyltrimethylammoniumbromide (CTAB) extraction method (1). Degenerate primers SPG1/SPG2, developed for PCR detection of begomoviruses (1), amplified a 912-bp DNA fragment from 3 of 10 DNA extracts from I. setosa and 5 of 39 sweetpotato plants held in quarantine. The primers anneal to regions of open reading frame (ORF) AC2 and ORF AC1 that are highly conserved in begomoviruses infecting sweetpotato. SPLCV-specific primers PW285-1/PW285-2 (2) amplified a 512-bp DNA fragment of ORF AC1 from seven samples (two from I. setosa and five from I. batatas). Amplicons from three independent PCR assays of two samples and single PCR assays of four additional samples were cloned into the pGEM-T Easy vector. Clone inserts were sequenced, and compared with sequences deposited in GenBank using the basic local alignment search tool (BLAST). Sequences were closely related to SPLCV (GenBank Accession No. AF104036) with nucleotide sequence identities varying from 93% (GenBank Accession No. DQ361004) to 97% (GenBank Accession No. DQ361005). The presence of the virus poses a challenge to the dissemination of planting materials in the region because begomovirus-infected plants often do not show symptoms. To our knowledge, this is the first report of a begomovirus infecting sweetpotato in Kenya or the East African Region. References: (1) R. Li et al. Plant Dis. 88:1347, 2004. (2) P. Lotrakul et al. Plant Dis. 82:1253, 1998.

Virus-like symptoms including deformation, discoloration, and necrotic ringspots on green and red fruits of tomato (Solanum lycopersicum L. cv. Big Dena) were observed in a 400 m2 commercial high tunnel in Wayne Co., Ohio, in July and August 2013. No symptoms were observed on leaves. Incidence of symptomatic fruits was approximately 15%. Tomato seedlings transplanted into the high tunnel were produced in a greenhouse containing ornamental plants. The grower observed high levels of thrips infestation in the tomato seedlings prior to transplanting. A tospovirus was suspected as a possible causal agent. Four symptomatic fruits were tested using immunostrip tests for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (Agdia, Inc., Elkhart, IN), a double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) for Groundnut ringspot virus (GRSV)/Tomato chlorotic spot virus (TCSV) (Agdia, Inc., Elkhart, IN), and DAS-ELISA for TCSV (AC Diagnostics Inc., Fayetteville, AR). All of the symptomatic fruits tested negative with Agdia immunostrips and positive with the Agdia and AC Diagnostics DAS-ELISAs. Total RNA was extracted from one ELISA-positive sample using TRIZOL Reagent (Life Technologies, Carlsbad, CA) and tested in RT-PCR using GRSV- or TCSV-specific primers (2). An expected RT-PCR product was generated using primers derived from TCSV S-RNA (JAP885, 5′-CTCGGTTTTCTGCTTTTC-3′ and JAP886, 5′CGGACAGGCTGGAGAAATCG3′) (~290 bp) but not when using primers specific to GRSV S-RNA (JAP887, 5′-CGTATCTGAGGATGTTGAGT-3′ and JAP888, 5′-GCTAACTCCTTGTTCTTTTG-3′). The 290-bp RT-PCR product was cloned using a TOPO TA cloning kit (Life Technologies, Grand Island, NY), and six clones were sequenced. Sequences from three clones were identical to a consensus sequence of a 292-bp fragment covering part of the TCSV nucleocapsid gene (GenBank Accession No. KJ744213). Sequences of the remaining three clones contained one, two, or three nucleotide mutations. To confirm the presence of TCSV in this sample, two newly designed primers flanking the entire nucleocapsid protein gene (TCSV-F1, 5′-AGTATTATGCATCTATAGATTAGCACA-3′ and TCSV-R1, 5′-ACAAATCATCACATTGCCAGGA-′) were used in RT-PCR to generate an expected 948-bp product. Upon cloning and sequencing, this fragment was shown to contain a full nucleocapsid protein gene of TCSV (GenBank Accession No. KM610235). The fragment contained a sequence identical to the first 292-bp RT-PCR product. BLASTn analysis (National Center for Biotechnology Information database) showed that the large fragment sequence had 98% nucleotide sequence identity to the TCSV Florida isolate (GenBank Accession No. JX244196) and 94% to the TCSV Physalis isolate (GenBank Accession No. JQ034525). Tobacco plants were inoculated mechanically with sap from symptomatic tomato fruits. Necrotic local lesions developed, and the presence of TCSV was confirmed using AC Diagnostics' DAS-ELISA. TCSV has been reported in Brazil (1), Puerto Rico (3), and Florida (2). To our knowledge, this is the first report of TCSV infecting tomatoes in Ohio. Because TCSV is transmitted by thrips and has a broad host range, this emerging virus could pose a significant threat to the U.S. vegetable industry. References: (1) A. Colariccio et al. Fitopatol. Bras. 20:347, 1995. (2) A. Londoño et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Plant Health Progress doi:10.1094/PHP-2013-0812-01-BR, 2013.

Reversion disease, thought to be caused by the eriophyid mite transmitted blackcurrant reversion virus (BRV), is the most economically important disease of black currants (Ribes nigrum L.) and can be found nearly everywhere blackcurrants are cultivated except North America and Australia (Jones and McGavin 2002; Lemmetty et al. 1997; Susi 2004). BRV causes morphological changes to leaves and flowers, reduced flower bud hairiness, decreased plant vigor, sterility, and increased flower pigmentation (Jones and McGavin 2002; Susi 2004). Its host range is limited to the genus Ribes, and the virus rarely infects species other than R. nigrum. National quarantines have been used to prevent the movement of BRV and its vector, Cecidophyopsis ribis Westwood, into the U.S. However, BRV may have been introduced prior to the development of a reliable detection method (Jones and McGavin 2002). The R. nigrum cultivar Burga (PI 653058, from France) has abnormal leaf morphology and was evaluated using next generation sequencing (NGS) during the summer of 2016. During a preliminary analysis, a significant portion of the BRV genome was detected, warranting further investigation. In November 2016, RNA was extracted from leaves of ‘Burga’ and 11 other NCGR black currant accessions, several of which also exhibited suspicious leaf symptoms. RNA was extracted from two symptomatic leaves of each accession and bulked. These samples were assayed in triplicate by quantitative reverse transcription PCR (qRT-PCR) in Oregon for BRV using the iTaq One-Step SYBR green RT-PCR Kit (Bio-Rad Laboratories Inc, Hercules, CA). The primer pairs BRV1-8F/BRV1-8R, BRV1-10F/BRV1-10R, and BR1-F/BR3-R previously developed from BRV RNA-1 were used in conjunction with the recommended annealing conditions (Dolan et al. 2011; Jones and McGavin 2002). Four cultivars tested positive for BRV at the USDA-ARS NCGR: Bogatyr (PI 556413, from Germany); Burga; Minaj Shmyrev (PI 617766, from England); and an R. nigrum selection (PI 617781, from France). Amplicons generated from BR1-F/BR3-R from Bogatyr and Burga were sequenced (GenBank: MH078528-9) and showed greater than 96% identity to published BRV sequences when using BLASTx (ABL84271.1, ABL84276.1, AAO52686.1, AAO52685.1, ABL84275.1, AAO60043.1, AAO52687.1, NP_733982.2, AAO52684.1, and NP_612586.1). In summer 2018, total RNAs were extracted and sequenced again as described by Zheng et al. (2018) on an Illumina NextSeq 500 system. A total of 19,002,868 reads were generated and a de novo assembly was conducted with CLC genomics workbench. A BLASTx search was conducted using the contigs. Four contigs ranging from 178 to 335 bp assembled from 1,066 reads were found to match with the BRV genome with greater than 88% identity. Three of these contigs mapped to BRV RNA1 (MK302449) and one mapped to RNA2 (MK302450). The contigs account for 7% of the BRV genome. The vector, C. ribis, is not known to be present in North America and it is unknown if any mites endemic to North America could serve as vectors. Three of the infected clones have been growing at the NCGR for more than 20 years. These clones had been tested by a graft-bioassay when they entered the country and were thought to be BRV-free. At the time, this graft-bioassay was the only tool available for BRV detection, but it is not sufficient to enforce a BRV quarantine due to low virus concentrations in planta. Germplasm from the NCGR Ribes collection has been distributed to nurseries and research programs across North America as part of the National Plant Germplasm System. To ensure there has not been any spread and that other black currant clones in the NCGR collection are free of BRV, all 200 black currant clones in the collection will be tested for BRV. Distribution records of the four infected black currant accessions were used to identify where these clones have been shipped and the recipients of these materials have been notified.

Li, R., Salih, S., and Hurtt, S. 2004. Detection of geminiviruses in sweetpotato by polymerase chain reaction. Plant Dis. 88:1347-1351. Geminivirus infection of sweetpotato (Ipomoea spp.) germplasm acquired from foreign regions is common. Graft inoculation of the indicator host, Ipomoea setosa, is the accepted detection method for these viruses, but the assay is laborious and requires up to 8 weeks. When infected sweetpotato is subjected to meristem tip culture to eliminate these viruses, the eradication rate is low. In this study, a polymerase chain reaction (PCR) detection assay was developed for the detection of geminiviruses in a variety of sweetpotato cultivars. Different methods were evaluated to extract nucleic acids suitable for PCR from Ipomoea spp., and a reliable and simple extraction method was developed for large-scale sample preparation. PCR products of the expected sizes were amplified from infected plants using degenerate and virus-specific primers, but not from noninoculated indicator plants. PCR assays using three primer pairs detected nine uncharacterized isolates of the geminiviruses in sweetpotato from Asia and America. However, the best PCR result was obtained with degenerate primers SPG1/SPG2, which detected a Taiwan isolate of Sweet potato leaf curl virus (SPLCV-Taiwan) in a sample diluted to 10 –9 . Viral identities of three amplicons from SPLCV-Taiwan were confirmed by sequencing. The degenerate primers had a broader detection range than virus-specific primers; therefore, they were used to detect geminiviruses in in vitro plantlets and greenhouse-grown sweetpotato plants, and in several Ipomoea hosts. PCR was shown to be as reliable for virus detection as grafting. Additional keywords: begomoviruses, DNA extraction, Ipomoea leaf curl virus, Ipomoea yellow vein virus, malate dehydrogenase

The most important viral diseases of wheat are caused by Barley yellow dwarf virus (BYDV, strains PAV and MAV) and Cereal yellow dwarf virus (CYDV, strain RPV). Starting in 2000, winter wheat crops growing in northern, central, and southern Alabama were evaluated for the occurrence of BYDV-PAV and CYDV-RPV. In addition to these viruses, samples were tested for the presence of Soilborne wheat mosaic virus (SBWMV), Wheat spindle streak mosaic virus (WSSMV), and Wheat streak mosaic virus (WSMV). BYDV-PAV and CYDV-RPV were found throughout the state, alone or as co-infections, in 14.6% of the samples collected in 2000 and 12.2% of samples in 2001. PAV was found at a lower incidence than RPV (4.3 and 9.9%, respectively) in 2000; however, in 2001, PAV was detected in 8.2% and RPV in 1.9% of the samples. There was less rainfall than the 30-year average during the 1999-2000 growing season, and this may have contributed to differences in the relative incidence of PAV and RPV between the 2 years. SBWMV, WSSMV, and WSMV also were detected in Alabama in 2, 7.8, and 5.4% of the samples collected in 2000, respectively, and in 9.6, 34.3, and 18.5% of the samples collected in 2001, respectively. This is the first report of WSMV in Alabama winter wheat.

In spring 2012, a severe disease was observed on a limited number of tomato plants (Solanum lycopersicum L.) in a research greenhouse facility in western North Carolina. The first symptoms noted were downward curling of the terminal leaves accompanied by a rough puckered darker green texture. This was followed in time by greater distortion of the leaves with pale green on leaf margins. Older leaves with symptoms developed necrosis, with necrotic spots and streaks appearing on a few fruits. On some of these affected fruits, stems, peduncles, pedicels, and sepals also showed symptoms. Infected plants were badly stunted, and fruits in the upper parts of plants displaying severe symptoms remained very small. In just a few months, the disease spread to other tomato plants inside the greenhouse. A survey in May 2012 showed a disease incidence of 18% (156 symptomatic plants out of a total of 864) in this greenhouse. Initial screenings for possible viruses using ELISA (Agdia, Elkhart, IN), as well as a reverse transcription (RT)-PCR panel of 15 common tomato viruses in our laboratory were negative. Because of the symptoms and negative results for viruses, a viroid infection was suspected. Total plant RNA was prepared using TRIzol reagent (Invitrogen, Carlsbad, CA) from leaf tissues of eight diseased plants and one seed sample. Using real-time RT-PCR developed against Potato spindle tuber viroid (PSTVd) and some related pospiviroids (1), positive signals were observed with a mean Ct = 13.24 for leaf tissues and Ct = 19.91 for the seed sample. To obtain a full viroid genome, RT-PCR using two different sets of primers, one specific for PSTVd (PSTVd-F and PSTVd-R) (2), and a universal primer set for pospiviroids (MTTVd-F and MTTVd-R) (3) was performed. RT-PCR generated amplicons with expected size of ~360 bp from all eight leaf and one seed samples, but not from a healthy control. PCR products were cloned using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA). A total of 22 full genomic sequences were obtained. A multi-sequence alignment generated a consensus sequence of 360 nt, designated as NC12-01 (GenBank Accession No. JX280944). BLASTn search in the NCBI database revealed the highest sequence identity of 96.9% to Australian (AY962324) and UK (AJ583449) isolates of PSTVd and 95.9% identity to the tomato isolate of PSTVd-CA1 (HM753555). Similar disease symptoms were observed on two ‘Rutgers’ tomato plants 2 weeks post mechanical inoculation and the presence of PSTVd was confirmed by real-time RT-PCR (1). A mock-inoculated plant did not show any symptoms. In the U.S., natural infection of PSTVd on tomato was first identified in California in 2010 (3). To our knowledge, this is the first report of a natural occurrence of PSTVd on tomato in the eastern U.S. The diseased plants were contained, properly disposed of, and eradicated in this location. The broader geographic distribution of PSTVd on tomato in the U.S., and the potential latent infection in potato and a number of ornamentals (4), emphasizes the need for better plant and seed health tests for viroids on these plants. References: (1) N. Boonham et al. J. Virol. Methods 116:139, 2004. (2) H. Bostan et al. J. Virol. Methods 116:189, 2004. (3) K.-S. Ling and D. Sfetcu. Plant Dis. 94:1376, 2010. (4) R. A. Owens and J. Th. J. Verhoeven. The Plant Health Instructor. DOI: 10.1094/PHI-I-2009-0804-01, 2009.