Search

Peanut (Arachis hypogaea L.) is an important source of edible oil in China but its yield and quality in agricultural production are affected by a number of diseases including those caused by viruses. The four viruses most commonly reported to affect the production of peanut worldwide are peanut stripe virus, cucumber mosaic virus, peanut stunt virus and peanut bud necrosis virus (Srinivasan et al. 2017; Xu et al. 2017). During a disease survey in June 2020, virus-like disease symptoms including mosaic and necrotic spots were observed in field peanut plants in Yuyao county, Zhejiang, China (Supplementary Fig S1). These symptoms differed from those caused by the four major peanut viruses (Dunoyer et al. 2020; Srinivasan et al. 2017; Takahashi et al. 2018; Xu et al. 2017). To identify the putative viral agent(s) associated with the virus-like disease in these plants, leaves from six plants in the same field were collected, pooled and subjected to high throughput RNA-Seq sequencing (HTS). The TruSeq RNA Sample Preparation Kit (Illumina, California, USA) was used to construct cDNA library according to the manufacturer's instructions. An Illumina NovaSeq 6000 platform (Illumina) with PE150 bp and CLC Genomic Workbench 11 (QIAGEN) was used for sequencing and data analysis. After data collection and analysis, a total of 18,592 contigs were generated from de novo assembly of the clean paired-end reads (35,935,936). After comparing with sequences deposited in GenBank using BLASTn, four assembled contigs (ranging from 4,969 to 8,937 nt in length) were found to share 94.9%-95.9% identity to the turnip mosaic virus (TuMV, genus Potyvirus). No other virus sequences were detected in the data. To confirm the presence of TuMV and to obtain its full-length sequence, total RNA was extracted from a single plant selected from initial sample pool by using the plant RNA extraction KIT (Aidlab, Beijing, China). Five primer pairs (Supplementary Table 1), which were anticipated to result in overlapping amplicons covering all but the 5'-end of the genome, were designed based on the TuMV contig sequences and the complete nucleotide sequence of TuMV was subsequently amplified by the reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) using the commercial SUPERSWITCH™ 5'RACE cDNA Kit (Tiosbio, Beijing, China). All the PCR products were subsequently cloned into pEASY®-T5 Zero (TransGen Biotech, Beijing, China), and three clones of each fragment were randomly selected and sequenced by Sanger sequencing at Ykang (Ykang, Hangzhou, China). The complete sequence of the TuMV isolate (designated isolate Ningbo) was deposited in GenBank under accession number MZ062212. BLASTn analysis showed that TuMV-Ningbo shared a sequence identity of 96.0% with a Brassica isolate of TuMV in China (HQ446216) and 95.9% with a Brassica isolate in the Czech Republic (LC537547). Phylogenetic analysis grouped the three into a cluster (Supplementary Fig S2), suggesting Ningbo as a member of the world-B Group (Kawakubo et al. 2021). A western blot analysis of leaf sap using a TuMV CP antibody prepared by our laboratory (unpublished data) confirmed the presence of TuMV in all of the samples used for the HTS analysis. Peanut and Nicotiana benthamiana plants growing in the green house were also mechanically inoculated with peanut leaf sap obtained from one of samples. Seven days after inoculation, mosaic and leaf curing symptoms were observed on inoculated plants and the infection of TuMV was subsequently confirmed by RT-PCR (primers TuMV-CP: 5'- GCAGGTGAAACGCTTGATGC -3' and 5'- CAACCCCTGAACGCCCAGTA-3') and western blot assay. In contrast, no symptoms nor TuMV were detected in the mock-inoculated plants. TuMV is an important pathogen of brassica crops and is known to have a worldwide host range. However, to our knowledge, this is the first report of TuMV infection in peanut in China and the finding suggests that the threat of TuMV should be considered when interplanting peanuts and cruciferous vegetables, as in common in this region of China.

Four o'clock (Mirabilis jalapa) and M. himalaica var. chinensis are members of the family Nyctaginaceae and are widely distributed weeds in Yunnan Province, China. In 2009, mosaic and malformation symptoms were observed on leaves of the four o'clock on the campus of Yunnan Agricultural University and in the Black Dragon Pool Park in Kunming City, China. More than 30% of the four o'clock plants showed symptoms of the disease. Sap from leaves of symptomatic four o'clock plants caused local chlorotic and necrotic lesions in inoculated Chenopodium amaranticolor after 7 to 10 days and systemic mosaic symptoms in C. quinoa and Nicotiana benthamiana after 10 to 12 days. No symptoms were observed following inoculation of sap from asymptomatic plants. A pure virus isolate (MJ) was obtained after three successive single-lesion transfers from C. amaranticolor. Following mechanical inoculation of the MJ isolate, seedlings of indicator plants, N. benthamiana, displayed mosaic symptoms. Moreover, back transmission to healthy four o'clock seedlings by leaf extracts from systemically infected N. benthamiana plants caused similar mosaic and malformation symptoms. Flexuous, filamentous particles (650 to 700 nm long and 13 nm wide) and cytoplasmic laminar aggregates and pinwheel inclusions typical of members of the genus Potyvirus were observed in infected four o'clock leaves by electron microscopy. No other virus particles were observed. Serological testing of 10 symptomatic and healthy plants using a monoclonal antibody specific for Potyvirus group members in an indirect ELISA (Agdia Inc., Elkhart, IN) also resulted in positive reactions in infected leaves, however, all healthy seedlings tested were negative. Total RNAs were extracted from infected four o'clock leaves with the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) and the 3′-terminal portion of the viral genome (including part of the NIb polymerase, the entire coat protein (CP), and 3′-UTR) was then amplified by reverse transcription-PCR with a universal Potyviridae primer Sprimer/M4 and an M4T as the initial primer (2). A fragment of 1,720 nucleotides long were separated, purified, and cloned and three independent clones were sequenced (GenBank Accession No. JN250997). Nucleotide and amino acid sequence analysis of the putative CP gene, respectively, revealed 75.1 to 76.3% and 80.3 to 82.1% identity with the Basella rugose mosaic virus (BaRMV) (GenBank Accession Nos. DQ821938, DQ394891, and DQ821939), 77.4 and 81.0% identity with Peace lily mosaic virus (GenBank Accession No. DQ851494), and 76.0 and 81.7% identity with the Phalaenopsis chlorotic spot virus (GenBank Accession No. HM021142). However, on the basis of the CP gene sequence analyses, these three viruses shared high (>88.5 and >94.3%) CP nucleotide and amino acid identity and should be classified as the same Potyvirus species. According to the species demarcation criteria for the Potyviridae (1), the pathogen causing mosaic and malformation symptoms on four o'clock was BaRMV (3). To our knowledge, this is the first report of BaRMV in four o'clock. References: (1) M. J. Adams et al. Arch. Virol. 150:459, 2005. (2) J. Chen et al. Arch. Virol. 146:757, 2001. (3) C. H. Hung and Y. C. Chang. Plant Pathol. 55:819, 2006.

Black nightshade (Solanum nigrum L. var. humile [Bernh.]) is a common solanaceous plant that is an arable weed and also used in herbal medicine in China (Wang et al. 2017b; Zhao et al. 2018). The weed occurs commonly in a wide variety of habitats, including orchards, fields, villages, and roadsides in southwest provinces in China. In May 2019, about 3% of black nightshade plants growing in a tomato field at Kunming city in Yunnan province in China were found showing typical symptoms of viral disease (chlorosis, mosaic, leaf twisting, and plant stunting). To identify the suspected virus, one plant with severe symptoms was chosen for small RNA sequencing. Total RNA was extracted from leaves of symptomatic tissues by TruSeq Small RNA Sample Prep Kits (Illumina, San Diego, CA), and a small RNA library was constructed and then sequenced by high-throughput sequencing (HTS) on an Illumina HiSeq 2500 platform. The analysis generated approximately 11.37 million Illumina reads (15 to 40 nt in length), of which more than 0.082 million reads were mapped to the tobacco vein banding mosaic virus (TVBMV) genome (reference sequence accession no. NC_009994.1). No other viruses and viroids were detected. Further observation by transmission electron microscopy showed that the negatively stained crude sap of two symptomatic plants contained flexuous, filamentous virus particles about 600 to 900 nm in length, typical of a potyvirus. To further confirm the results, total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, Carlsbad, CA), first-strand cDNA was synthesized from 1 µg of total RNA using an oligo dT primer and a random primer mix, and then fragments of the TVBMV-CP gene were amplified with specific primers (F, 5′-AATGACGAACAGACAGTTGATGCTG-3′; R, 5′-CACGCCACTCACACCAAGTAGG-3′; designed from the CP gene of an HTS-generated clone) by 2×T5 Super PCR Mix (Tsingke BioTech, China). After cloning into a pGEM-T vector (Promega Biotech, U.S.A.), six clones of each fragment were randomly chosen for Sanger sequencing (Tsingke BioTech). The clone sequences were identical, and this partial TVBMV sequence was then submitted to GenBank (accession no. MN331841). This new sequence was most similar to Chinese isolate XDBB-01 (95.1% nucleotide identity to the CP mRNA, accession MG880266.1, and 98.2% amino acid identity to the corresponding coat protein AYG97953.1). Ten additional black nightshade plants with similar symptoms and another three asymptomatic plants were randomly selected and tested for the presence of TVBMV using the same primers. All 10 symptomatic plants tested positive for TVBMV, whereas the asymptomatic plants tested negative by reverse transcription PCR (RT-PCR) (data not shown). Transmissibility of TVBMV from black nightshade to tomato (cultivar KP13) by aphids (Myzus persicae), which were present widely in the tomato fields in the region, was tested according to the method reported by Yu et al. (2007). At 21 days postinoculation, 10 out of 20 inoculated plants showed leaf twisting symptoms. RT-PCR confirmed the presence of TVBMV in these plants but not in plants without symptoms. Results from three biological repeats were consistent, demonstrating that black nightshade can serve as an effective inoculum source for TVBMV. TVBMV has been reported to infect tobacco, potato, Datura stramonium, wild eggplant, tomato, and sesame in China (Wang et al. 2017a). To our knowledge, this is the first report of TVBMV infecting S. nigrum in natural field conditions. Our findings indicate that S. nigrum in the field could be a reservoir of TVBMV to infect tomato and cause viral disease in tomato fields.