Search

In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus , fam. Closteroviridae , have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus , fam. Luteoviridae ) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies ( B. tabaci ) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F - 5' AAGAGCGGCAGCTACAATAC 3', CABYV RdRp-R - 5' TGCCACATTCCGGTTCATAG 3'), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.

Cucurbit yellow stunting disorder virus (CYSDV) was identified in the fall of 2006 affecting cucurbit production in the southwestern United States (California, Arizona), as well as in nearby Sonora, Mexico, resulting in nearly universal infection of fall melon crops in 2006 and 2007, and late infection of 2007 spring melons. Survival of CYSDV through the largely cucurbit-free winter months suggested the presence of weed or alternate crop hosts, although previous studies indicated a limited host range restricted to members of the Cucurbitaceae. To determine potential reservoir hosts for CYSDV in desert production, weed and crop hosts were collected from throughout the region over a period of 26 months, and were tested for the presence of CYSDV by reverse transcription-polymerase chain reaction (RT-PCR) using CYSDV HSP70h- and coat protein gene-specific primers. Many noncucurbits collected from infected melon fields and nearby areas were symptomless and virus free; however, CYSDV was detected in alfalfa (Medicago sativa), lettuce (Lactuca sativa), and snap bean (Phaseolus vulgaris), as well as in several weed species widely prevalent in the region. Typical crinivirus symptoms of interveinal yellowing and leaf brittleness were observed on CYSDV-infected snap bean, alkali mallow (Sida hederacea) and Wright's groundcherry (Physalis wrightii), while other infected crop and weed hosts were symptomless. Transmission tests demonstrated that lettuce, snap bean, alkali mallow, Wright's groundcherry, and buffalo gourd (Cucurbita foetidissima) could serve as virus reservoir hosts for transmission of CYSDV to melon and other cucurbits. These results expand the previously known host range of CYSDV, demonstrating that the virus is capable of infecting not only members of the Cucurbitaceae, but also plants in seven additional taxonomic families.

In August and September 2007, watermelon plants (Citrullus lanatus L.) in commercial fields in Manatee and Hillsborough counties in Florida exhibited stunting, deformation, interveinal chlorosis, and leaf mottling. Adult and immature whiteflies (Bemisia tabaci biotype B) were observed. Leaf samples were collected from seven watermelon and two squash plants showing different combinations of symptoms. Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Valencia, CA) and subjected to reverse transcription (RT)-PCR for the presence of criniviruses using primers specific to regions of the Cucurbit yellow stunting disorder virus (CYSDV) genome encoding the coat protein (CysCP5206F 5' TTTGGAAAAGAACCTGACGAG 3'; CysCP5600R 5' TTCATCAACAGATTGGCTGC 3') and HSP70h genes (2). Total nucleic acids were extracted using Gentra Puregene Kit (Qiagen) and subjected to PCR for the presence of begomoviruses using the degenerate primer pairs AC1048 and AV494, designed to amplify a region of the begomovirus coat protein gene (4), and PBL1v2040 and PCRc154, designed to amplify a region of the hypervariable region of the begomovirus B component (3). RT-PCR amplified the expected 394-bp fragment of the coat protein gene from three symptomatic plants (one squash, two watermelon) and from CYSDV-infected control plants but not from healthy controls. Similarly, the 175-bp HSP70h fragment was amplified from the same samples and from CYSDV-infected control plants but not from healthy controls. The coat protein amplicon was sequenced from one of the Manatee County isolates (GenBank Accession No. EU596528) and the 344 nt sequenced portion of the amplicon was found to be 100% identical to sequences of CYSDV from Texas, California, Jordan, and France (GenBank Accession Nos. AF312823, EU596529, DQ903107, and AY204220, respectively) and shared 99% identity with an isolate from Spain (GenBank Accession No. NC_004810), but only 91% with an isolate from Iran (GenBank Accession No. AY730779). The begomovirus primer pair pBL1v2040 and PCRc154 produced a 678-bp amplicon that is consistent with the presence of a bipartite begomovirus in all nine samples. Sequence analysis of four of the 678-bp amplicons revealed that all had greater than 97% sequence identity to isolates of Cucurbit leaf crumple virus (CuLCrV) from Arizona (GenBank Accession No. AF327559) and California (GenBank Accession No. AF224761). These results are similar to those reported in the first detection of CuLCrV in Florida in 2006 (1). In October 2007, CYSDV was detected in squash plants (Cucurbita pepo L.) in two additional fields in Manatee and Hillsborough counties, and additional fields with CYSDV-like symptoms have been observed with increasing frequency throughout the region. The appearance of CYSDV in Florida follows the recent emergence of CYSDV in California and Arizona and Sonora, Mexico in 2006 where the CYSDV infection of fall melons resulted in severe economic losses (2). The emergence of CYSDV in Florida, where the vector B. tabaci biotype B is well established, warrants concern for all cucurbit production in the southern United States. Disease monitoring efforts are in progress to determine the extent, severity, and impact of CYSDV on Florida cucurbit production. References: (1) F. Akad et al. Plant Dis.92:648, 2008. (2) Y.-W. Kuo et al. Plant Dis. 91:330, 2007. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.