Search

The article offers information on a report related to viral infection in Chrysanthemum hybrid plant caused by tomato spotted wilt virus in Serbia.

An abstract of the study "First Report of Septoria Leaf Spot of Lavandin Caused by Septoria lavandulae in Croatia" is presented.

The article offers information on a report related to viral infection in lamium maciilatum ornamental plant caused by Cucumber mosaic virus.

The article offers information on a report related to brown rot disease in nectarine plant caused by fungal pathogen Monilinia fructicola.

The cosmopolitan species Fusarium graminearum Schwabe directly reduces yield, as well as grain quality of cereals, due to its ability to synthesize mycotoxins. Previously it was considered to be one species occurring on all continents. However, phylogenetic analysis employing the GCPSR method (Genealogical Concordance Phylogenetic Species Recognition) revealed the existence of 15 phylogenetic species within what is now recognised as the Fusarium graminearum Species Complex (FGSC) (Sarver et al. 2011). During 1996-2008, a MRIZP collection of FGSC isolates was established and isolates originating from wheat (5), maize (3) and barely (2) were selected for further study. Morphological features including the appearance of colonies and macroconidia (average size 38.5-53.1 × 4.6-5.4 µm, No 50) of all 10 isolates on PDA were consistent with descriptions of F. graminearum (O'Donnell et al. 2004, Leslie and Summerell 2006). Total DNA was isolated from mycelium removed from 7-day old colonies of single-spore isolates grown on PDA using the DNeasy Plant Mini Kit (Qiagen, Hilden). Further identification was based on amplification and sequencing of elongation factor TEF-1α, histone H3 and β-tubulin in both directions, with primers ef1/ef2, H3-1a/H3-1b and T1/T22, respectively (Jacobs et al. 2010). The sequences were deposited in NCBI under accession numbers MF974399 - MF974408 (TEF-1α), MG063783 - MG063792 (β-tubulin) and MF999139 - MF999148 (histone H3). Sequence analysis was performed using BLAST while genetic similarity was calculated using MEGA 6.0 software. Isolate 1339 originating from wheat (collected at the locality of Kikinda in 2006), shared 100% nucleotide identity with TEF-1α (DQ459745), histone H3 (DQ459728) and β-tubulin (DQ459643) of F. vorosii isolate NRRL37605 (Starkey et al. 2007). The remaining nine isolates were identified as F. graminearum as they shared 99% to 100% nucleotide similarity with F. graminearum NRRL 28439 (O'Donnell et al. 2004). Pathogenicity was tested using artificial inoculations of spikes during wheat flowering (Mesterhazy et al. 1999). Thirty classes were inoculated with each isolate, in three replicates. Inoculum was prepared from 7-day colonies on PDA, and 30 ml of a conidia suspension (1x105 conidia/ml) was used. Control plants were inoculated with sterile water. Three weeks after inoculation, typical Fusarium head blight symptoms were visible on inoculated plants, from which all 10 isolates were successfully reisolated. Control spikes remained symptomless. Disease severity was estimated on the 1-7 scale (Blandino et al. 2012). Average pathogenicity of the F. vorosii isolate 1339 was 1.9, and 2.4 -5.1 of F. graminearum isolates. Toxin production was determined using gas chromatography-tandem mass spectrometry. Kernels inoculated with the 10 isolates were ground and tested for the presence of deoxynivalenol (DON) and its acetyl derivatives 3ADON, 15ADON and NIV. F. vorosii isolate 1339 possessed the 15ADON chemotype, as well as eight F. graminearum isolates, while only one F. graminearum isolate was 3ADON chemotype. To date, F. vorosii has only been detected in Hungary on wheat (Toth et al. 2005) and Korea on barley, corn and rice (Lee et al. 2016). This is the first report of F. vorosii in Serbia, which is of great importance, because it indicates the spread of this toxigenic species. Further studies should be focused on determining the distribution, aggressiveness and toxicological profile of F. vorosii.

Charcoal rot, caused by Macrophomina phaseolina , is an important disease in tropical and subtropical regions which affects a broad range of host plants, including potato ( Solanum tuberosum L.). In this crop, charcoal rot can reduce the marketable quality of tubers (Arora 2012) and cause yield losses up to 88% (Somani 2007). During a survey of a potato field of 'Spunta' cultivar in Goodlands, Mauritius (20°02'28.2"S 57°39'30.4"E) approximately 10% of tubers with grey pigmentation around the lenticels and small water-soaked spots with white dots were observed. These symptoms later advanced to dark brown to black patches on the skin surface, all conforming to typical symptoms of charcoal rot (Arora and Khurana 2004). Fragments of infected and adjacent healthy tissue were cut, thoroughly washed with tap water, surface sterilized for 30 s with 1% sodium hypochlorite (25% bleach), placed on chloramphenicol-amended Potato Dextrose Agar (PDA), and incubated for 5 days in the dark at 25±2oC. From all the inoculated plates, only fast-growing, dark brown, grey to black Macrophomina -like colonies grew and several mono-sclerotial isolates were obtained with uniform morphological features. Following staining with cotton lactophenol dye using the clean slide technique, the isolate 449G-19/M exhibiting typical characteristics of M. phaseolina (Arora and Dhurwe 2019) and forming flattened, globose, black sclerotia with an average diameter of 180 µm (n= 50), was selected and used for further characterization. Identification was confirmed by sequencing of the ITS region of rDNA. Total DNA was extracted directly from the mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions, while PCR amplification and sequencing were performed with primers ITS1-F (Gardes and Bruns 1993) and ITS-4 (White et al. 1990). The nucleotide sequence of the isolate 449G-19/M (Accession No. MW301138) shared 98.28 to 99.80% similarity with over 70 M. phaseolina isolates in GenBank (99.18% with isolate from Zea mays, Accession No. KF531825 (Phillips et al. 2013)). Pathogenicity was tested on 20 healthy tubers which were initially disinfected with 2% sodium hypochlorite for 1 min and individually placed in pots (20 cm ø) containing sterile substrate. Ten tubers were inoculated by placing colony fragments of 7-day-old cultures of the isolate 449G-19/M near each tuber. Similarly, 10 tubers inoculated with sterile PDA served as a negative control. The plants were maintained in greenhouse conditions, watered daily, and assessed for the presence of symptoms 8 weeks post emergence. All inoculated tubers exhibited charcoal rot on progeny tubers while control plants remained symptomless. Koch's postulates were fulfilled successfully and the fungus recovered from the inoculated plants. Although M. phaseolina was previously observed in Mauritius on groundnut resulting in pre-emergence rot and collar rot (Anonymous 1962), to our knowledge, this is the first report demonstrating charcoal rot on potato tubers caused by M. phaseolina in Mauritius. As the sclerotia can remain in the soil for long periods of time (Arora and Khurana 2004) and with prevailing conditions of global warming, charcoal rot may be a threat for potatoes and other local crops (Somani et al. 2013). This study will sensitize agricultural extension officers on this new disease and calls for routine surveillance to safeguard this crop.

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea , has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato ( Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. 'Elpida' located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive "ghost spot" was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius ; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. 'Elpida' with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch's postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Blackberries (Rubus L. subgenus Rubus Watson) are popular, wild fruits with high content of antioxidants and thus with beneficial effect on the human health (Reyes-Carmona et al. 2005). In July 2019 and May 2020, plants with typical powdery mildew symptoms were collected in the blackberry cv. 'Triple crown' orchard (of 2 ha in size) in the vicinity of Pakovraće (Moravica District, Serbia). The symptoms observed in 2019 included mild chlorotic spots on both old and young leaves accompanied by the white powdery mildew colonies on the surface of the leaves, visible on both primorcanes and floricanes. In 2020, even more intensive symptoms occurred on fruit bearing shoots which were covered with dense white fungal growth. Heavily infected leaves turned necrotic along the edges, followed by defoliation. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and estimated to be over 90% while disease severity was estimated to be over 40%. Morphological characteristics were assessed using bright-field and phase-contrast microscopy (Jankovics et al. 2011) and revealed the presence of unbranched, erect conidiophores (N=50, 75 to 200 μm) with cylindrical foot-cell and up to five short cells. Conidia were unicellular, hyaline and ellipsoid-barrel-shaped (N=50, 22.5 to 35.5 × 12.5 to 15 μm) containing fibrosin bodies (in 3% KOH). All observed characteristics resembled to Podosphaera spp. (Braun and Takamatsu 2000). The presence of chasmothecia was not recorded. Further molecular identification was conducted using internal transcribed spacer (ITS) sequence analysis of two isolates, 420G-19 and 30G-20, sampled in 2019 and 2020, respectively. Total DNA was extracted directly from epiphytic mycelium on the leaves using DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1F and ITS4 (Takamatsu et al. 2010). The nucleotide sequence of the representative isolates 420G-19 (530 bp) and 30G-20 (530 bp) (Accession No. MN914995 and MT514661) shared 100% identity, while both shared 99.49 to 99.81% nt identity with 32 Podosphaera aphanis strawberry and raspberry isolates in the GenBank (the highest 99.81% with GU942455, Harvey and Xu 2010), confirming that powdery mildew of blackberry in Serbia is caused by P. aphanis . In order to fulfill Koch's postulates, 10 rooted, healthy blackberry plants cv. 'Triple crown' were dusted with conidia of isolate 30G-20 and incubated at 23°C under the high relative humidity in the glasshouse. Healthy blackberry plants incubated in the same conditions, served as negative control. The minute white fungal colonies sharing the same microscopic features with the original isolate were visible 7-8 days post inoculation on all inoculated plants. No fungal growth was observed in the negative control. Serbia is the fourth largest blackberry producer in the world (Strik et al. 2007) and the occurrence of P. aphanis causing powdery mildew as a new pathogen is of utmost importance. P. aphanis is described as strawberry and raspberry powdery mildew pathogen with a population expressing substantial genetic diversity (Harvey and Xu 2010). The molecular data on blackberry originating isolates of P. aphanis are missing. Our study showed that P. aphanis could be destructive for blackberry in Serbia, thus representing a threat for the production of this valuable crop.

Potato ( Solanum tuberosum L.) is considered as one of the most economically important non-sugar food crops in Mauritius, with annual production of over 14,000 tonnes (Statistics Mauritius 2018). In September 2019, in a seed potato field located in St Pierre, approximately 10% of tubers showed the presence of numerous irregular-shaped black scurf lesions on the surface. After surface sterilization of tubers with 70% alcohol, the presumed sclerotia were directly transferred to chloramphenicol amended Potato Dextrose Agar (PDA) and incubated for 5 days at 25oC in the dark. From all sampled tubers, only fast-growing, pale brown Rhizoctonia - like colonies grew, from which hyphal-tip isolates with uniform morphology were obtained. Following staining with aniline blue using the clean slide technique, cells of the isolate were observed to be multinucleate, with typical characteristics of Rhizoctonia solani AG-3 including hyphal branching at right angles, slight constriction and septum near the branch base, presence of typical monilioid cells and formation of light-brown irregular-shaped sclerotia of average size 2 mm (Tsror 2010). Identification was further conducted by sequencing of ITS rDNA region. Total DNA was extracted directly from mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1-F (5'-CTTGGTCATTTAGAGGAAGTAA-3') (Gardes and Bruns 1993) and ITS-4 (5'-TCCTCCGCTTATTGATATGC-3') (White et al. 1990). The nucleotide sequence of the representative isolate 448G-19/M (Accession No. MT523021) was compared with those available in GenBank and shared 99-100% identity with over 20 R. solani AG-3 isolates (100% with isolate 16-107, Salamone and Okubara 2020). Therefore, based on the morphological characteristics and sequence homology, the isolate was identified as R. solani AG-3. Koch's postulates were confirmed for the isolate by carrying out the pathogenicity tests. Twenty healthy, unwounded tubers were disinfected for 1 min with 50% commercial bleach (2% NaOCl) and individually placed in pots (20 cm ø) containing sterile substrate. Ten tubers were inoculated by placing colony fragments of 7 day-old cultures of isolate 448G-19/M near each tuber during planting. Similarly, 10 tubers inoculated with sterile PDA served as negative control. Plants were maintained in a greenhouse, watered daily and assessed for the presence of symptoms 60 days post emergence. All inoculated plants exhibited partial root necrosis while progeny tubers showed black scurf due to presence of sclerotia. Control plants remained symptomless. From all symptomatic tubers, the original isolate was successfully recovered and identified by the morphological and molecular characteristics mentioned above, thus fulfilling Koch's postulates. Although occurrence of potato black scurf had previously been observed in Mauritius (Anonymous 1927), to the best of our knowledge, this the first report confirming R. solani AG-3 as causal agent of black scurf on seed tubers in Mauritius. Early detection of R. solani AG-3 during potato seed production is necessary to prevent its dispersal via infected tubers to other fields around the island. This research is significant as it will contribute to the body of knowledge on potato pathology in Mauritius and at the same time assist in reducing losses associated with this important crop.

Tomatoes ( Solanum lycopersicum ) represent one of the most frequently consumed vegetables in Mauritius after potatoes and onions. The value of the tomato industry is estimated to be around Rs 300 M in Mauritius, with an annual production of 18,376 t over an area of 1365 ha. (Cheung Kai Suet 2019). In August 2019, disease surveillance was conducted in the tomato cv. 'Elipida' grown in the greenhouse situated at Camp Thorel (eastern part of Mauritius), a super-humid zone where the prevailing temperature and humidity were 30°C and 70% respectively. The symptoms included numerous circular to irregular, dark brown, target like lesions on the leaves, followed by the occurrence of yellow halo and occasional defoliation. Disease incidence was estimated to be 80% in the entire greenhouse. From sampled symptomatic leaves, small pieces of infected tissue were surface-disinfected with 1% sodium hypochlorite, air dried, and placed on PDA. After 7 days incubation at 23°C under 12 hours of natural light regime, isolates with fast growing grey-brown, velvety colonies were recovered. In colonies, singly-borne or in short chains, pale brown, cylindrical, straight or slightly curved conidia with 2 - 14 pseudosepta (34 x 2 μm) were numerous. Based on morphological features, the isolates were identified as Corynespora cassiicola (Berk. and M.A. Curtis) C.T. Wei (Dixon et al. 2009). Morphological identification was confirmed by amplifying and sequencing of the ITS region (ITS1, 5.8S rDNA and ITS2 regions) of the rDNA. Total DNA was extracted directly from fungal mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1F and ITS4 (Takamatsu et al. 2010). The nucleotide sequence of the representative isolate 408G-19/M (575 bp) (Accession No. MN860167) was compared with those available in GenBank and shared 98 to 99.82% identity with over 100 C. cassiicola isolates (99.65% with FJ852578 from Solanum melongena , Dixon et al. 2009). Koch's postulates were confirmed by spraying 10 healthy tomato plants (four leaf phenophase) with spore suspension (1 x 103 conidia/ml) prepared from 10 days old colonies of isolate 408G-19/M in sterile water. Healthy tomato plants inoculated with sterile water served as negative control. Plants were maintained in greenhouse conditions. On all inoculated plants, characteristic target like necrotic spots were visible 7 days post inoculation. No symptoms were recorded in the negative control after 15 days. From all symptomatic tomato leaves, the original isolate was successfully recovered. So far in Mauritius, C. cassiicola had been reported on Molucella (Anon. [Director of Agriculture] 1961) and Bignonia spp. (Orieux 1959) and also as an endophyte associated with Jatropha spp. (Rampadarath et al. 2018). Although symptoms resembling target spot were previously observed on field-grown tomatoes (Vally, pers. Comm.), to our knowledge, this is the first study confirming C. cassiicola as a tomato pathogen in Mauritius. As C. cassiicola affects a wide range of hosts (Lopez et al. 2018), including tomato, cucumber, zucchini and banana which are all important for Mauritius, the occurrence of this pathogen is a potential threat. Additionally, the results will help in developing efficient disease control strategies, thus minimizing yield loss of tomatoes produced locally.