Search

Neuroplasticity involves molecular changes in central nervous system (CNS) synaptic structure and function throughout life. The concept of neural organization allows for synaptic remodeling as a compensatory mechanism to the early pathobiology of Alzheimer’s disease (AD) in an attempt to maintain brain function and cognition during the onset of dementia. The hippocampus, a crucial component of the medial temporal lobe memory circuit, is affected early in AD and displays synaptic and intraneuronal molecular remodeling against a pathological background of extracellular amyloid-beta (Aβ) deposition and intracellular neurofibrillary tangle (NFT) formation in the early stages of AD. Here we discuss human clinical pathological findings supporting the concept that the hippocampus is capable of neural plasticity during mild cognitive impairment (MCI), a prodromal stage of AD and early stage AD.

The functional interactions of the neuropeptide galanin (GAL) occur through its binding to three G protein-coupled receptor subtypes: galanin receptor (GALR) 1, GALR2 and GALR3. Previously, we demonstrated that GALR1 mRNA expression was increased in the CA1 region of the hippocampus and discrete hypothalamic nuclei in galanin transgenic (GAL-tg) mice. This observation suggested a compensatory adjustment in cognate receptors in the face of chronic GAL exposure. To evaluate the molecular alterations to GALR2 and GALR3 in the forebrain of GAL overexpressing mice, we performed complementary quantitative, real-time PCR (qPCR), in situ hybridization, and immunohistochemistry in select forebrain regions of GAL-tg mice to characterize the neuronal distribution and magnitude of GAL mRNA and peptide expression and the consequences of genetically manipulating the neuropeptide GAL on the expression of GALR2 and GALR3 receptors. We found that GAL-tg mice displayed dramatic increases in GAL mRNA and peptide in the frontal cortex, posterior cortex, hippocampus, septal diagonal band complex, amygdala, piriform cortex, and olfactory bulb. Moreover, there was evidence for ectopic neuronal GAL expression in forebrain limbic regions that mediate cognitive and affective behaviors, including the piriform and entorhinal cortex and amygdala. Interestingly, regional qPCR analysis failed to reveal any changes in GALR2 or GALR3 expression in the GAL-tg mice, suggesting that, contrary to GALR1, these receptor genes are not under ligand-mediated regulatory control. The GAL-tg mouse model may provide a useful tool for the investigation of GAL ligand-receptor relationships and their role in normal cognitive and affective functions as well as in the onset of neurological disease.

The quantitative PCR (qPCR) primer sequences reported for mouse galanin receptor 2 (GALR2) mRNA [forward primer (5=-3=) TGCTCTTCTGTACCTCTCACGTCTG; reverse primer (5=-3=) AAGTTGGTTTTTATTGG] are specific for the mouse GALR1 receptor, whereas the primer sequences reported for mouse GALR3 mRNA [forward primer (5=-3=) CAGATTGCGAGAGTGGTGACATAG; reverse primer (5=-3=) GGATCTCAGGTAGTTCAAGGACTCC] are specific for mouse GALR2 message. Therefore, the qPCR data describing regional GALR2 expression in GAL wild type (WT) and GAL transgenic (GAL-tg) mouse forebrain actually refer to GALR1 expression, whilst data reported for GALR3 should instead be attributed to GALR2. The revised qPCR component of our report indicates that GALR1 and GALR2 mRNA levels do not change in seven different subregions (e.g., piriform cortex, hippocampus, amygdala) of the GAL-tg mouse forebrain compared to the WT mouse. This contrasts with a previous in situ hybridization study showing increased GALR1 mRNA in hippocampal CA1 neurons of these same GAL-tg mice (Hohmann et al., 2003). These observations suggest that GAL overexpression does not influence global GALR1 or GALR2 expression in the mouse forebrain but that changes in GALR expression in GAL-tg mice may be restricted to discrete neuronal groups. These focal alterations in GALR expression are likely undetectable by regional qPCR analysis.