Search

Manfred Göthert, who had served Naunyn-Schmiedeberg’s Arch Pharmacol as Managing Editor from 1998 to 2005, deceased in June 2019. His scientific oeuvre encompasses more than 20 types of presynaptic receptors, mostly on serotoninergic and noradrenergic neurones. He was the first to identify presynaptic receptors for somatostatin and ACTH and described many presynaptic receptors, known from animal preparations, also in human tissue. In particular, he elucidated the pharmacology of presynaptic 5-HT receptors. A second field of interest included ligand-gated and voltage-dependent channels. The negative allosteric effect of anesthetics at peripheral nACh receptors is relevant for the peripheral clinical effects of these drugs and modified the Meyer-Overton hypothesis. The negative allosteric effect of ethanol at NMDA receptors in human brain tissue occurred at concentrations found in the range of clinical ethanol intoxication. Moreover, the inhibitory effect of gabapentinoids on P/Q Ca2+ channels and the subsequent decrease in AMPA-induced noradrenaline release may contribute to their clinical effect. Another ligand-gated ion channel, the 5-HT3 receptor, attracted the interest of Manfred Göthert from the whole animal via isolated preparations down to the cellular level. He contributed to that molecular study in which 5-HT3 receptor subtypes were disclosed. Finally, he found altered pharmacological properties of 5-HT receptor variants like the Arg219Leu 5-HT1A receptor (which was also shown to be associated with major depression) and the Phe124Cys 5-HT1B receptor (which may be related to sumatriptan-induced vasospasm). Manfred Göthert was a brilliant scientist and his papers have a major impact on today’s pharmacology.

Athineos Philippu, Department of Pharmacology and Toxicology, University of Innsbruck, Austria The eighth pharmacologic-historical Forum was held online in 2022 in Bonn during the Meeting of the DGPT. In this forum the personalities of Hans Dengler, Paul Martini, Manfred Göthert, and Rudolf Buchheim were honoured by describing their lives and scientific achievements.

Muscarinic M2 and M4 receptors resemble each other in brain distribution, function, and Gi/o protein signaling. However, there is evidence from human recombinant receptors that the M4 receptor also couples to Gs protein whereas such an alternative signaling is of minor importance for its M2 counterpart. The question arises whether this property is shared by native receptors, e.g., the murine hippocampal M2- and the striatal M4-autoreceptor. To this end, the electrically evoked tritium overflow was studied in mouse hippocampal and striatal slices pre-incubated with 3H-choline. 3H-Acetylcholine release in either region was inhibited by the potent muscarinic receptor agonist iperoxo (pIC50 8.6–8.8) in an atropine-sensitive manner (apparent pA2 8.6–8.8); iperoxo was much more potent than oxotremorine (pIC50 6.5–6.6). In hippocampal slices, N-ethylmaleimide (NEM) 32 μM, which inactivates Gi/o proteins, tended to shift the concentration-response curve of iperoxo (pIC50 8.8) to the right (pIC50 8.5) and depressed its maximum from 85 to 69%. In striatal slices, the inhibitory effect of iperoxo declined at concentrations higher than 0.1 μM, yielding a biphasic curve with a pIC50 of 8.6 for the falling part and a pEC50 of 6.4 for the rising part of the curve. The inhibitory effect of iperoxo 10 μM (47%) after NEM pre-treatment was lower by about 35% compared to the maximum (74%) obtained without NEM. In conclusion, our data, which need to be confirmed by pertussis toxin, might suggest that in the striatum, unlike the hippocampus, stimulatory Gs protein comes into play at high concentrations of a muscarinic receptor agonist.

Muscarinic M

The cannabinoid CB1 receptors on the noradrenergic neurons in guinea pig hippocampal slices show an endogenous endocannabinoid tone. This conclusion is based on rimonabant, the facilitatory effect of which on noradrenaline release might be due to its inverse CB1 receptor agonism and/or the interruption of a tonic inhibition elicited by endocannabinoids. To examine the latter mechanism, a neutral antagonist would be suitable. Therefore, we studied whether O-2050 is a neutral CB1 receptor antagonist in the guinea pig hippocampus and whether it mimics the facilitatory effect of rimonabant. CB1 receptor affinity of O-2050 was quantified in cerebrocortical membranes, using (3)H-rimonabant binding. Its CB1 receptor potency and effect on (3)H-noradrenaline release were determined in superfused hippocampal slices. Its intrinsic activity at CB1 receptors was studied in hippocampal membranes, using (35)S-GTPγS binding. Endocannabinoid levels in hippocampus were determined by liquid chromatography-multiple reaction monitoring. O-2050 was about ten times less potent than rimonabant in its CB1 receptor affinity, potency and facilitatory effect on noradrenaline release. Although not affecting (35)S-GTPγS binding by itself, O-2050 shifted the concentration-response curve of a CB1 receptor agonist to the right but that of rimonabant to the left. Levels of anandamide and 2-arachidonoyl glycerol in guinea pig hippocampus closely resembled those in mouse hippocampus. In conclusion, our results with O-2050 confirm that the CB1 receptors on noradrenergic neurons of the guinea pig hippocampus show an endogenous tone. To differentiate between the two mechanisms leading to an endogenous tone, O-2050 is not superior to rimonabant since O-2050 may increase the inverse agonistic effect of endocannabinoids.

It has been suggested that activation of nuclear peroxisome proliferator-activated receptors γ (PPARγ) may represent a new strategy for the treatment of pulmonary arterial hypertension. It has been demonstrated that PPARγ activation relaxed the isolated mouse pulmonary artery. The aims of the present study were to examine whether and to which extent the two PPARγ agonists rosiglitazone and pioglitazone relax the isolated human pulmonary artery and to investigate the underlying mechanism(s). Isolated human pulmonary arteries were obtained from patients without clinical evidence of pulmonary hypertension during resection of lung carcinoma. Vasodilatory effects of PPARγ agonists were examined on endothelium-intact or endothelium-denuded vessels preconstricted with the thromboxane prostanoid receptor agonist U-46619. Rosiglitazone and pioglitazone (0.01–100 μM) caused a concentration- and/or time-dependent full relaxation of U-46619-preconstricted vessels. The rosiglitazone-induced relaxation was attenuated by the PPARγ antagonist GW9662 1 μM, endothelium denudation, the nitric oxide synthase inhibitor L-NAME 300 μM, the cyclooxygenase inhibitor indomethacin 10 μM, and the KATP channel blocker glibenclamide 10 μM. The prostacyclin IP receptor antagonist RO1138452 1 μM shifted the concentration–response curve for rosiglitazone to the right. The PPARγ agonists pioglitazone and rosiglitazone relax human pulmonary arteries. The rosiglitazone-induced vasorelaxation is partially endothelium-dependent and involves PPARγ receptors, arachidonic acid degradation products, nitric oxide, and KATP channels. Thus, the relaxant effect of PPARγ agonists in human pulmonary arteries may represent a new therapeutic target in pulmonary arterial hypertension.

Intravenous (i.v.) injection of the endocannabinoid anandamide induces triphasic cardiovascular responses, including a pressor effect mediated via unknown central and peripheral mechanism(s). The aim of the present study was to determine the central mechanism(s) responsible for the pressor response to anandamide. For this purpose, the influence of antagonists at thromboxane A(2) TP (sulotroban, daltroban, SQ 29548), NMDA (MK-801) and beta(2)-adrenergic receptors (ICI 118551) on the pressor effect induced by i.v. and intracerebroventricularly (i.c.v.) administered anandamide was examined in urethane-anaesthetized rats. Anandamide (1.5-3 micromol/kg, i.v.) or its stable analogue methanandamide (0.75 micromol/kg, i.v.) increased blood pressure by 25%. Anandamide (0.03 mumol per animal i.c.v.) caused a pure pressor effect (by 20%) but only in the presence of antagonists of CB(1) and TRPV1 receptors. The effects of cannabinoids (i.v. or i.c.v.) were diminished by i.v. daltroban, sulotroban (10 mumol/kg each), and/or SQ 29548 (1 mumol/kg). The effect of anandamide i.v. was reduced by SQ 29548 (0.02 mumol per animal i.c.v.) and by the thromboxane A(2) synthesis inhibitor furegrelate i.c.v. (1.8 micromol per animal). ICI 118551, MK-801 (1 micromol/kg i.v. each), and bilateral adrenalectomy diminished the effect of anandamide i.c.v. Sulotroban (i.v.) failed to affect the response to anandamide (i.v.) in pithed rats, and anandamide and methanandamide did not bind to TP receptors in rat platelets. The present study suggests that central beta(2)-adrenergic, NMDA and thromboxane A(2) receptors are involved in the anandamide-induced adrenal secretion of catecholamines and their pressor effect in urethane-anaesthetized rats.

Prostaglandin E(2) (PGE(2)) and its analogue sulprostone inhibit noradrenaline and serotonin release in rodent tissues. We examined whether the receptor involved is blocked by the EP(3) antagonist L-826,266, whether such receptors also occur on central cholinergic neurones and retinal dopaminergic cells, whether PGE(2) is produced by the degradation of the endocannabinoid virodhamine and whether EP(3) receptor activation stimulates (35)S-GTPgammaS binding. Transmitter release was studied as electrically evoked tritium overflow in superfused tissues preincubated with (3)H-noradrenaline (which in the guinea pig retina labels dopaminergic cells), (3)H-serotonin or (3)H-choline. (35)S-GTPgammaS binding, a measure of G protein activation, was studied in mouse and guinea pig hippocampal membranes. L-826,266 antagonised the effect of sulprostone on noradrenaline release in the rat cortex, yielding a Schild plot-based pA(2) value of 7.56. Apparent pA(2) values in mouse cortex and rat vas deferens (noradrenaline release) and rat cortex (serotonin release) were 7.55, 7.87 and 7.67, respectively. PGE(2) did not affect acetylcholine release in rat brain and dopamine release in guinea pig retina. In seven mice tissues, noradrenaline release was inhibited by sulprostone but not affected by virodhamine. (35)S-GTPgammaS binding was not altered by sulprostone but stimulated by the cannabinoid agonist WIN 55,212-2. Prostaglandins of the E series inhibit monoamine release via EP(3) receptors at which L-826,266 is a competitive antagonist. EP(3) receptors that inhibit transmitter release are not present on central cholinergic neurones and retinal dopaminergic cells. Virodhamine is not converted to PGE(2). An EP(3) receptor model based on (35)S-GTPgammaS binding could not be identified.

Cannabinoids exert complex effects on blood pressure related to their interference with cardiovascular centres in the central nervous system and to their direct influence on vascular muscle, vascular endothelium and heart. In view of the relative lack of information on the occurrence of CB1 receptors on the vascular postganglionic sympathetic nerve fibres, the aim of the present study was to examine whether cannabinoid receptor ligands affect the electrically evoked tritium overflow in superfused vessels (tissue pieces) from the guinea-pig, the rat and the mouse preincubated with 3H-noradrenaline. The cannabinoid receptor agonist WIN 55,212-2 (R(+)-[2,3-dihydro-5-methyl-3-[(morpholinyl)methyl]-pyrrolo[1,2,3-de]1,4-benzoxazinyl](1-naphthalenyl) methanone) inhibited the evoked tritium overflow in the guinea-pig aorta, but not in that of the rat or mouse. The concentration-response curve of WIN 55,212-2 was shifted to the right by the CB1 receptor antagonist rimonabant, yielding an apparent pA2 value of 7.9. The most pronounced (near-maximum) inhibition obtained at the highest WIN 55,212-2 concentration applied (3.2 microM) amounted to 40%. WIN 55,212-2 also inhibited the evoked overflow in guinea-pig pulmonary artery, basilar artery and portal vein, again in a manner sensitive to antagonism by rimonabant. The latter did not affect the evoked overflow by itself in the four vessels, but did increase the electrically evoked tritium overflow from superfused guinea-pig hippocampal slices preincubated with 3H-choline and from superfused guinea-pig retina discs preincubated with 3H-noradrenaline (labelling dopaminergic cells in this tissue). The inhibitory effect of 3.2 microM WIN 55,212-2 on the evoked overflow from the guinea-pig aorta was comparable in size to that obtained with agonists at the histamine H3, kappa opioid (KOP) and ORL1 (NOP) receptor (1 or 10 microM, producing the respective near-maximum effects) whereas prostaglandin E2 1 microM caused a higher near-maximum inhibition of 70%. Prostaglandin E2 also induced an inhibition by 65 and 80% in the rat and mouse aorta respectively, indicating that the present conditions are basically suitable for detecting presynaptic receptor-mediated inhibition of noradrenaline release. The results show that the postganglionic sympathetic nerve fibres in the guinea-pig aorta, but not in the rat or mouse aorta, are endowed with presynaptic inhibitory cannabinoid CB1 receptors; such receptors also occur in guinea-pig pulmonary artery, basilar artery and portal vein. These CB1 receptors are not subject to an endogenous tone and the extent of inhibition obtainable via these receptors is within the same range as that of several other presynaptic heteroreceptors, but markedly lower than that obtainable via receptors for prostaglandin E2.

We examined whether replacement of imidazole by a piperidine or pyrrolidine moiety will affect the potency and affinity of six H3-receptor antagonists. Potencies were determined in superfused mouse brain cortex slices preincubated with [3H]noradrenaline, in which the interaction of the antagonists with histamine with respect to its inhibitory effect on the electrically evoked tritium overflow was studied. Affinities were determined in mouse brain cortex membranes, using the radioligand [3H] N(alpha)-methylhistamine. The concentration-response curve of histamine for its effect on the evoked overflow from mouse brain cortex slices was shifted to the right by the 13 compounds under study. Replacement of the imidazole by a piperidine ring affected the p A2 value as follows: thioperamide, -2.7 log units; clobenpropit, -1.9; proxyfan, -1.3; FUB 138, -1.2. Potency hardly changed (or =0.4 log units) when imidazole was replaced by piperidine in FUB 181 and by piperidine or pyrrolidine in FUB 153. Binding of [3H] N (alpha)-methylhistamine to mouse brain cortex membranes was inhibited monophasically by all compounds. The p K(i) values closely matched their p A2 values with three exceptions. The p K(i) values of proxyfan, FUB 138, and FUB 153 exceeded their respective p A(2) values by about 1 log unit. To reveal a potential partial agonism, the effect of the three drugs on (1) the electrically evoked tritium overflow and (2) [35S]GTPgammaS binding in mouse cortex preparations was determined. Proxyfan proved to be a partial agonist in both models (with intrinsic activities of 0.2 and 0.3, respectively) whereas FUB 138 and FUB 153 were devoid of agonistic effects. In conclusion, replacement of imidazole by piperidine or pyrrolidine affects the antagonist potencies of six H3-receptor antagonists in a very different manner. The piperidine analogue of FUB 181 (with a p A2 value as high as 7.7) may represent a lead for the development of non-imidazole H3-receptor antagonists. The discrepancy between the p K(i) and p A2 values may be accounted for by partial agonism in the case of proxyfan but can, at present, not be satisfactorily explained with respect to FUB 138 and FUB 153.

In previous studies, long-term cannabis use led to alterations of the endocannabinoid system including an increase in CB1 and/or CB2 receptor messenger RNA (mRNA) in blood cells and an increase in the serum level of the endocannabinoid 2-arachidonoyl glycerol. However, in those studies, cannabis use was stopped only few days before testing or not interrupted at all. Therefore, one cannot decide whether the alterations are due to long-term cannabis abuse or are confounded by acute effects of cannabis. Blood was sampled from donors that had smoked marijuana ≥20 times in their lives but had abstained from cannabis for ≥6 months (high-frequency users, HFU) and from controls (cannabis use ≤5 times lifetime). CB1 and CB2 mRNA was determined in peripheral mononuclear blood cells using the reverse transcriptase polymerase chain reaction. Serum anandamide level was assayed using electrospray tandem mass spectrometry. CB2 mRNA was increased by 45 % in HFU when compared to controls, whereas CB1 mRNA did not differ. The anandamide level in HFU exceeded that in controls by 90 %. Tobacco smoking could be excluded as a confounding factor. In conclusion, marijuana users that had smoked marijuana ≥20 times in their lives and stopped cannabis use at least 6 months before the study show an increase in CB2 receptor mRNA in the blood and in serum anandamide level. These alterations resemble those obtained for marijuana smokers that had stopped cannabis use only few days before testing and may be implicated in the pathogenesis of disorders associated with long-term cannabis use.

We studied the effects of nociceptin, the endogenous ligand of the opioid OP4 receptor, and of two cannabinoid receptor agonists WIN 55,212-2 and CP-55,940 (0.001-1 micromol/kg each) on the neurogenic tachycardia and bradycardia in pithed rats. Electrical stimulation (1 Hz, 1 ms, 50 V for 10 s) of the preganglionic sympathetic nerve fibres and injection of nicotine 2 micromol/kg or isoprenaline 0.5 nmol/kg increased heart rate by about 70 beats/min (bpm) in pithed rats pretreated with atropine 1.5-2 micromol/kg. The electrically induced tachycardia was reduced dose dependently by nociceptin, WIN 55,212-2 and CP-55,940 (by 60, 30 and 20% at the highest dose, respectively). The OP4 and cannabinoid receptor agonists diminished the nicotine- but not the isoprenaline-stimulated increase in heart rate. In pithed rats pretreated with propranolol 3 micromol/kg, vagal stimulation (5 Hz, 1 ms, 15 V for 10 s) or injection of methacholine (5-10 nmol/kg) decreased heart rate by about 30 bpm. Nociceptin, but not WIN 55,212-2 or CP-55,940 decreased the vagal bradycardia dose dependently (the inhibitory effect of 1 micromol/kg was about 40%). Nociceptin failed to modify the methacholine-induced decrease in heart rate. The OP4 receptor antagonists naloxone benzoylhydrazone 5 micromol/kg and/or [Phe1Psi(CH2-NH)Gly2]-nociceptin(1-13)NH2 0.7 micromol/kg, but not the OP(1-3) receptor antagonist naloxone 10 micromol/kg, diminished the inhibitory action of nociceptin on the neurogenic tachycardia and bradycardia. The inhibitory effect of both cannabinoid receptor agonists on the neurogenic tachycardia was abolished by the CB1 receptor antagonist SR 141716 0.1 micromol/kg. The present data suggest that the postganglionic sympathetic nerve fibres innervating the rat heart are endowed with presynaptic opioid OP4 and cannabinoid CB1 receptors, activation of which inhibits the neurogenic tachycardia. The parasympathetic nerve fibres innervating the heart and causing bradycardia are endowed with presynaptic opioid OP4 but not cannabinoid receptors.

Clenbuterol, a lipophilic beta2-adrenoceptor agonist, was investigated in various seizure models of experimental epilepsy. In the maximal electroshock seizure threshold test, clenbuterol (> or =4 mg/kg i.p.) increased the electroconvulsive threshold for tonic seizures in mice. In the traditional maximal electroshock seizure (MES) test in mice, ED50 values of 11 mg/kg i.p. or s.c. were determined. In both models, the beta2-receptor antagonist ICI 118.551 did not antagonize the anticonvulsant activity of clenbuterol. Combinations of clenbuterol with standard antiepileptics revealed additive anticonvulsant effects. Repeated administration of clenbuterol (5 mg/kg s.c., twice daily for 14 days) to mice did not significantly influence its anticonvulsant potency or the effectiveness of phenobarbital in the MES test. In various chemically-induced seizure tests with tonic convulsions, clenbuterol inhibited or tended to suppress the tonic phase. However, this drug was not effective in preventing clonic seizures in the pentylenetetrazol (85 mg/kg s.c.) seizure threshold test. In the rotarod ataxia test (mice), a minimal "neurotoxic" dose (TD50) of 41 mg/kg i.p. was determined. In unrestrained rats with chronically implanted electrodes in the dorsal hippocampus, clenbuterol (2 mg/kg and 4 mg/kg i.p.) significantly reduced the duration of electrically evoked hippocampal afterdischarges. In amygdala-kindled rats, clenbuterol (5 mg/kg and 10 mg/kg i.p.) reduced the seizure severity to stage 3. Additional studies indicated that clenbuterol (6 mg/kg i.p.) increased the heart rate and decreased the blood pressure, but this drug did not alter the plasma level of the two tested antiepileptics phenobarbital and carbamazepine. Furthermore, in whole-cell voltage-clamp experiments on cultured neonatal rat cardiomyocytes, clenbuterol (1-100 microM) depressed the fast sodium current in a concentration- and frequency-dependent manner. In conclusion, the anticonvulsant effects of higher doses of clenbuterol against generalized tonic-clonic and complex partial seizures seem to be related to the inhibition of voltage-dependent sodium channels and not to the modulation of beta-adrenoceptors.

Cannabinoid CB1 receptors occur as presynaptic receptors producing inhibition of neurotransmitter release. To elucidate their physiological role, experiments on tissues from CB1 receptor knockout mice would be helpful. We studied whether CB1 receptor-mediated inhibition of acetylcholine release is detectable in the brain of NMRI mice and of CD-1 and C57BL/6J mice (the latter two strains representing the wild-type strains of the two CB1 receptor knockout mouse models). Brain slices preincubated with [3H]choline were superfused and tritium overflow was evoked electrically (3 Hz) or by introduction of Ca2+ into Ca2+-free K+-rich medium (35 mM) containing tetrodotoxin. The eletrically evoked tritium overflow from NMRI mouse hippocampal slices was inhibited (maximally by 60%) by the cannabinoid receptor agonists CP-55,940 and WIN 55,212-2 but not affected by WIN 55,212-3 (the inactive enantiomer of WIN 55,212-2; pEC50=7.9, 7.4 and5.5). The concentration-response curve of WIN 55,212-2 was shifted to the right by the CB1 receptor antagonist SR 141716 (apparent pA2=8.6). Compared to hippocampal slices from NMRI mice, WIN 55,212-2 1 microM inhibited the electrically evoked overflow (1) from cortical slices from NMRI mice to a lesser extent and from striatal slices not at all, (2) from hippocampal slices from CD-1 and C57BL/6J mice to an identical extent and (3) from hippocampal slices from Sprague-Dawley rats to at least the same extent. SR 141716 0.32 microM abolished the effect of WIN 55,212-2 1 microM in hippocampal slices from NMRI, CD-1 and C57BL/6J mice and in cortical slices from NMRI mice. The electrically evoked tritium overflow from NMRI mouse hippocampal slices was also inhibited by the muscarinic receptor agonist oxotremorine (maximum effect of 85%; pEC50=6.5) and this effect was antagonized by the muscarinic receptor antagonist AF-DX 384 (apparent pA2=8.3). The Ca2+-evoked tritium overflow from NMRI mouse hippocampal slices was inhibited by WIN 55,212-2 in a manner sensitive to SR 141716. In conclusion, the cholinergic axon terminals of the NMRI mouse hippocampus are endowed with presynaptic CB1 receptors. Such receptors are also detectable in the hippocampus of CD-1 and C57BL/6J mice. The maximum extent of the CB1 receptor-mediated inhibition of acetylcholine release is lower than the maximum effect mediated via the autoreceptor.

We studied whether serotonin release in the CNS is inhibited via cannabinoid receptors. In mouse brain cortex slices preincubated with [3H]serotonin and superfused with medium containing indalpine and metitepine, tritium overflow was evoked either electrically (3 Hz) or by introduction of Ca2+ (1.3 mM) into Ca2+-free K+-rich (25 mM) medium containing tetrodotoxin. The effects of cannabinoid receptor ligands on the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]choline and on the binding of [3H]WIN 55,212-2 and [35S]GTPgammaS to mouse brain cortex membranes were examined as well. In superfused mouse cortex membranes preincubated with [3H]serotonin, the electrically evoked tritium overflow was inhibited by the cannabinoid receptor agonist WIN 55,212-2 (maximum effect of 20%, obtained at 1 microM; pEC50=7.11) and this effect was counteracted by the CB1 receptor antagonist SR 141716 (apparent pA2=8.02), which did not affect the evoked tritium overflow by itself. The effect of WIN 55,212-2 was not shared by its enantiomer WIN 55,212-3 but was mimicked by another cannabinoid receptor agonist, CP-55,940. WIN 55,212-2 also inhibited the Ca2+-evoked tritium overflow and this effect was antagonized by SR 141716. Concentrations of histamine, prostaglandin E2 and neuropeptide Y, causing the maximum effect at their respective receptors, inhibited the electrically evoked tritium overflow by 33, 69 and 73%, respectively. WIN 55,212-2 (1 microM) inhibited the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]choline by 49%. [3H]WIN 55,212-2 binding to mouse cortex membranes was inhibited by CP-55,940, SR 141716 and WIN 55,212-2 (pKi=9.30, 8.70 and 8.19, respectively) but not by the auxiliary drugs indalpine, metitepine and tetrodotoxin (pKi

Nociceptin (or orphanin FQ), the endogenous ligand for the opioid receptor-like 1 (ORL1) receptor, decreases blood pressure in the conscious and anesthetized rat. This study examined whether prejunctional inhibitory ORL1 receptors located on the postganglionic sympathetic neurons innervating the resistance vessels are detectable in pithed rats. In pithed and vagotomized rats electrical stimulation of the preganglionic sympathetic nerve fibers, injection of nicotine (2 micromol/kg) or noradrenaline (1 nmol/kg) increased blood pressure by about 30 mmHg. The electrically induced vasopressor response was decreased dose-dependently by nociceptin (0.001-1 micromol/kg; decrease by about 60% at 1 micromol/kg). Nociceptin 0.1 micromol/kg reduced the nicotine-induced vasopressor response by about 40% but at doses up to 1 micromol/kg failed to affect the increase in blood pressure evoked by noradrenaline. The inhibitory action of nociceptin on the electrically and nicotine-induced increase in blood pressure was attenuated by the ORL1 receptor antagonists naloxone benzoylhydrazone (5 micromol/kg) and/or [Phe1psi(CH2-NH)Gly2]-nociceptin(1-13)NH2 (1 micromol/kg) but was not affected by naloxone 10 micromol/kg. In conclusion, the present data suggest that the postganglionic sympathetic nerve fibers innervating the resistance vessels of the rat are endowed with prejunctional ORL1 receptors, activation of which causes inhibition of noradrenaline release.

We have studied (i) the effect of antisense oligodeoxynucleotides complementary to CB1 mRNA on the CB1 receptor binding in hippocampus, striatum and cerebral cortex of the rat; (ii) the possible mechanism of action of one of the antisense oligodeoxynucleotides; and (iii) its effect on two functional CB1 receptor-mediated effects. Synthetic oligodeoxynucleotides or saline were administered to male Wistar rats by the intracerebroventricular (i.c.v.) route twice daily for 3 days. Antisense oligodeoxynucleotides corresponding to the nucleotides 4 to 21 (AS1; GCCATCTAGGATCGACTT) and -8 to 12 (AS2; GATCGACTTCATAACCTCAG) and a mismatch oligodeoxynucleotide differing from AS1 in 6 positions (MM; TCCAGCTACTATGGACTG) were used. The dissociation constant (K(D)) of rat CB1 cannabinoid receptors, labelled by the radioligand [3H]-SR141716, did not differ in membranes from rats treated with saline, AS , AS2 or MM. The density of receptor binding (Bmax) was reduced by the antisense oligodeoxynucleotides, 10nmol, in the hippocampus (AS 1, -40%; AS2, -20%) and striatum (AS1, -29%; AS2 -6%), but not in the cerebral cortex. When the dose of AS1 was raised to 30 nmol, the reduction of Bmax in the hippocampus and striatum was only marginally increased; a dose of 3nmol of AS1 reduced Bmax in both brain regions by somewhat more than the half-maximum effect. The mismatch oligodeoxynucleotide MM (3-30nmol) did not affect Bmax. In the second part of the study, RNA obtained from the three brain regions of rats pretreated with AS1 10 nmol, MM 10 nmol or saline was analyzed using reverse transcription-polymerase chain reaction of CB1 receptor mRNA and of beta-actin mRNA levels (used as reference value). The ratio of CB1 receptor mRNA over beta-actin mRNA after treatment with AS1 did not differ from the ratios following treatment with saline or MM in the hippocampus, striatum and cerebral cortex. Finally, pretreatment with antisense oligodeoxynucleotide AS1 30nmol attenuated two functional effects via CB1 receptors, i.e., the facilitatory effect of WIN 55,212-2 on [35S]-GTPgammaS binding in rat hippocampus membranes and the inhibitory effect of WIN 55,212-2 on acetylcholine release in rat hippocampus slices. In conclusion, (i) two antisense oligodeoxynucleotides reduce the density of CB1 receptors in the rat hippocampus and striatum after i.c.v. administration. (ii) The effect of the antisense oligodeoxynucleotide AS1 does not appear to be related to breakdown of CB1 receptor mRNA. (iii) Pretreatment with AS1 attenuated the CB1 receptor-mediated effect in two functional models.

Selective H2- and H3-receptor agonists, exhibiting an at least tenfold higher potency than histamine itself at the respective receptors, have been known for several years. Selective H1-receptor agonists with a potency exceeding that of histamine have become available only recently; the most potent are methylhistaprodifen and dimethylhistaprodifen [Nalpha-methyl- and Nalpha,Nalpha-dimethyl-2(3,3-diphenylpropyl)histamine, respectively] with 3.4- and 2.4-fold higher potencies than histamine in vitro (in the guinea-pig ileum). The aim of the present study was to examine whether these compounds and the parent compound histaprodifen are potent H1-receptor agonists in the pithed and in the anaesthetized rat. In pithed, vagotomized rats diastolic blood pressure was decreased by 2-(2-thiazolyl)ethanamine i.v. (which was used as a reference H1-receptor agonist) and by histaprodifen, methylhistaprodifen, and dimethylhistaprodifen; the maximum decrease was about 45 mmHg for each compound, and the potencies, expressed as pED50, the negative logarithm of the dose (in mole per kilogram body weight) eliciting a half-maximal response, were 7.23, 7.55, 8.43 and 8.12, respectively. The dose/response curves of the four compounds were shifted to the right to about the same extent by the H1-receptor antagonist dimetindene (1 micromol/kg i.v.). The vasodepressor response was not affected by combined i.v. administration of the H2- and H3-receptor antagonists ranitidine and thioperamide, by combined i.v. administration of the alpha1- and alpha2-adrenoceptor antagonists prazosin and rauwolscine, and by the beta-adrenoceptor antagonist propranolol i.v. but was attenuated by the inhibitor of NO synthase, N(omega)-nitro-L-arginine methyl ester i.v. In anaesthetized rats 2-(2-thiazolyl)ethanamine, histaprodifen, methylhistaprodifen and dimethylhistaprodifen i.v. also decreased diastolic blood pressure in a manner sensitive to dimetindene i.v. Our data show that histaprodifen and, in particular, methyl and dimethylhistaprodifen are highly potent H1-receptor agonists in vivo.

The effect of histamine and related drugs on the tritium overflow evoked electrically (0.3 Hz) or by introduction of Ca2+ ions into Ca2+-free K+-rich (25 mmol/l) medium containing tetrodotoxin was studied in superfused guinea-pig brain cortex, cerebellum, hippocampus or hypothalamus slices and in mouse brain cortex slices preincubated with 3H-noradrenaline. The electrically evoked tritium overflow in guinea-pig cortex slices was inhibited by histamine; the H3 receptor antagonist clobenpropit reversed the effect of histamine to a slight facilitation. The facilitatory effect of histamine (obtained in the presence of clobenpropit) was not affected by the H1 receptor antagonist mepyramine but abolished by the H2 receptor antagonist ranitidine. In the absence of clobenpropit, ranitidine augmented the inhibitory effect of histamine. In slices superfused in the presence of ranitidine, the evoked overflow was inhibited by histamine and, more potently, by the H3 receptor agonist R-alpha-methylhistamine in a concentration-dependent manner (maximum inhibitory effect obtained for both agonists 30-35%). The concentration-response curve of histamine was shifted to the right by the H3 receptor antagonist thioperamide. R-alpha-methylhistamine inhibited the electrically evoked tritium overflow also in guinea-pig cerebellar, hippocampal and hypothalamic slices. In cortex slices superfused in the presence of clobenpropit, the H2 receptor agonists impromidine and, less potently, R-sopromidine facilitated the evoked overflow in a concentration-dependent manner. S-Sopromidine only tended to increase the evoked overflow. The effect of impromidine was counteracted by the H2 receptor antagonists ranitidine and cimetidine. The extent of the maximum facilitatory effect of impromidine (by 15-20%) was about the same when (i) the Ca2+ concentration in the medium was reduced from 1.3 to 0.98 mmol/l, (ii) the time of exposure to impromidine was reduced from 28 to 8 min or (iii) cerebellar, hippocampal or hypothalamic slices were used instead of cortical slices. The Ca2+-induced tritium overflow in guinea-pig cortex slices was inhibited by histamine (in the presence of ranitidine); this effect was abolished by clobenpropit. In slices superfused in the presence of clobenpropit, impromidine failed to facilitate the Ca2+-evoked tritium overflow. The electrically evoked tritium overflow in mouse brain cortex slices was inhibited by histamine by about 60% (both in the absence or presence of ranitidine). The inhibitory effect of histamine was abolished (but not reversed) by clobenpropit. In conclusion, noradrenaline release in the guinea-pig brain cortex is inhibited via presynaptic H3 receptors and facilitated via H2 receptors not located presynaptically. In the mouse brain cortex, only inhibitory H3 receptors occur. The extent of the H3 receptor-mediated effect is more marked in the mouse than in the guinea-pig brain cortex.

Human cerebral cortical slices and synaptosomes, guinea-pig cerebral cortical slices and human right atrial appendages were used to study the effects of SB-216641, a preferential h5-HT1B receptor ligand, and of BRL-15572, a preferential h5-HT1D receptor ligand, on the presynaptic h5-HT1B and h5-HT1B-like autoreceptors in the human and guinea-pig brain preparations, respectively, and on the presynaptic h5-HT1D heteroreceptors in the human atrium. The brain preparations, preincubated with [3H]serotonin ([3H]5-HT), and the segments of atrial appendages, preincubated with [3H]noradrenaline, were superfused with modified Krebs' solution and tritium overflow was evoked electrically (human and guinea-pig cerebral cortex slices and human atrial appendages) or by high K+ (human cerebral cortex synaptosomes). The electrically evoked tritium overflow from guinea-pig cerebral cortex slices was reduced by the 5-HT receptor agonist 5-carboxamidotryptamine (5-CT). This effect was not modified by BRL-15572 (2 microM; concentration 154 times higher than its Ki at h5-HT1D receptors) but was antagonized by SB-216641 (0.1 microM; concentration 100 times higher than its Ki at h5-HT1B receptors; apparent pA2 8.45). SB-216641 (0.1 microM) by itself facilitated, whereas BRL-15572 (2 microM) did not affect, the evoked overflow. In human cerebral cortex slices SB-216641 (0.1 microM) also facilitated, and BRL-15572 (2 microM) again failed to affect, the electrically evoked tritium overflow. In human cerebral cortical synaptosomes, 5-CT reduced the K+-evoked tritium overflow. This response was unaffected by BRL-15572 (300 nM) but antagonized by SB-216641 (15 nM; drug concentrations 23 and 15 times higher than their Ki at h5-HT1D and h5-HT1B receptors, respectively). Both drugs, given alone, did not modify the K+-evoked tritium overflow. In human atrial appendages, the electrically evoked tritium overflow was inhibited by 5-HT in a manner susceptible to antagonism by BRL-15572 (300 nM; 23 times Ki at h5-HT1D receptors) but not by SB-216641 (30 nM; 30 times Ki at h5-HT1B receptors). Both drugs by themselves did not change the electrically evoked tritium overflow. In conclusion, SB-216641 behaves as a preferential antagonist at native human 5-HT1B receptors and BRL-15572 as a preferential antagonist at native human 5-HT1D receptors. These compounds are clearly useful tools for the differentiation between human 5-HT1B and 5-HT1D receptors in functional studies.

The effects of two cannabinoid receptor agonists, R(+)-[2,3-dihydro-5-methyl-3-[(morpholinyl)methyl]pyrrolo[1,2,3-de]-1,4- benzoxazin-yl]-(1-naphthalenyl)-methanone (WIN 55,212-2) and (-)-cis-3-[2-hydroxy-4-(1,1-dimethylheptyl)phenyl]-trans-4-(3-hydr oxypropyl)-cyclohexanol (CP-55,940), were studied on (i) the vasopressor response elicited in pithed rats by electrical stimulation of the sympathetic outflow and (ii) the release of 3H-noradrenaline and the vasoconstriction elicited in isolated rat tail arteries by transmural electrical stimulation. In pithed rats, the electrical (1 Hz for 10 s) stimulation of the preganglionic sympathetic nerve fibres increased diastolic blood pressure by about 30 mmHg. This neurogenic vasopressor response (which under the conditions of our study was almost exclusively due to the release of catecholamines) was decreased by WIN 55-212,2 and CP-55,940 in a dose-dependent manner (inhibition by WIN 55,212-2 and CP-55,940, 0.1 micromol/kg each, about 25-30%). The inhibition was identical in adrenalectomized rats and in animals with intact adrenals. The inhibitory action of WIN 55,212-2 and CP-55,940 was abolished by a dose of 0.03 micromol/kg of the CB1 receptor antagonist N-piperidino-5-(4-chlorophenyl)-1-(2,4-dichlorophenyl)-4-methyl-3-pyrazo le-carboxamide (SR 141716), which, by itself, had no effect. WIN 55,212-2, CP-55,940 and SR 141716 failed to affect the vasopressor response to exogenous noradrenaline (1 nmol/kg), which also increased diastolic blood pressure by about 30 mmHg. In isolated rat tail arteries, the electrically (0.4 Hz) evoked tritium overflow and vasoconstriction were not modified by WIN 55,212-2 and CP-55,940 (1 micromol/l each). In conclusion, the neurogenic vasopressor response in the pithed rat can be modulated via cannabinoid CB1 receptors probably located presynaptically on the postganglionic sympathetic nerve fibres innervating resistance vessels.

Our previous results demonstrate the occurrence of presynaptic inhibitory histamine H3 receptors on sympathetic neurons innervating resistance vessels of the pithed rat. The present study, in which new H3 receptor ligands with increased potency and selectivity (imetit, clobenpropit) were used, was designed to further explore the role of H3 receptors in the regulation of the rat cardiovascular system. In particular we were interested whether these receptors may be activated by endogenous histamine and whether they are detectable in an experimental model of hypertension. All experiments were performed on pithed and vagotomized rats treated with rauwolscine 1 mumol/kg. In normotensive Wistar rats the electrical (1 Hz, 1 ms, 50 V for 20 s) stimulation of the preganglionic sympathetic nerve fibres increased diastolic blood pressure by about 35 mmHg. Two H3 receptor agonists, R-(-)-alpha-methylhistamine and imetit, inhibited the electrically induced increase in diastolic blood pressure in a dose-dependent manner. The maximal effect (about 25%) was obtained for R-(-)-alpha-methylhistamine at about 10 mumol/kg and for imetit at about 1 mumol/kg. Two H3 receptor antagonists, thioperamide 1 mumol/kg and clobenpropit 0.1 mumol/kg, attenuated the inhibitory effect of imetit. The neurogenic vasopressor response was increased by about 15% by thioperamide 1 mumol/kg and clobenpropit 0.1 mumol/kg and decreased by 25% by the histamine methyltransferase inhibitor metoprine 37 mumol/kg. R-(-)-alpha-Methylhistamine, imetit, thioperamide, clobenpropit and metoprine did not affect the vasopressor response to exogenously added noradrenaline 0.01 mumol/kg (which increased diastolic blood pressure by about 40 mmHg). Metoprine had only a very low affinity for H3 binding sites (labelled by 3H-N alpha-methylhistamine; pKi 4.46). In pithed Wistar Kyoto (WKY) and spontaneously hypertensive (SHR) rats, electrical (1 Hz, 1 ms, 50 V for 10 s) stimulation increased diastolic blood pressure by 28 and 37 mmHg, respectively. Imetit inhibited the neurogenic vasopressor response to about the same extent in WKY and SHR rats (maximal effect of about 30%). The inhibitory influence of imetit was diminished by thioperamide 1 mumol/kg to about the same degree in rats of either strain. The present study confirms the occurrence of presynaptic H3 receptors on sympathetic nerve fibres involved in the inhibition of the neurogenic vasopressor response. Moreover, it demonstrates that these H3 receptors are probably activated by endogenous histamine and appear to be operative in hypertension.

The possible occurrence of cannabinoid (CB) receptors was studied on superfused guinea-pig retinal discs preincubated with [3H]dopamine or [3H]noradrenaline. Tritium overflow was evoked either electrically (3 Hz) or by re-introduction of Ca2+ 1.3 mM after superfusion with Ca(2+)-free medium containing K+ 30 mM. The accumulation of [3H]dopamine ([3H]DA) and [3H]noradrenaline ([3H]NA) was inhibited by the selective inhibitor of the neuronal dopamine transporter GBR-12909 (pIC50% 7.29 and 7.41, respectively) but not by the selective inhibitor of the neuronal noradrenaline transporter desipramine (1 microM). The electrically or Ca(2+)-evoked tritium overflow in retinal discs preincubated with [3H]DA or [3H]NA was reduced by the CB receptor agonists CP-55,940 and WIN 55,212-2 (pIC50% in discs preincubated with [3H]NA, electrical stimulation: 7.03 and 6.70, respectively) but not affected by the inactive S(-)enantiomer of the latter, WIN 55,212-3 (up to 10 microM). The concentration-response curve of WIN 55,212-2 was shifted to the right by the CB1 receptor antagonist SR 141716 (apparent pA2: 8.29) which, by itself, increased the evoked overflow. The facilitatory effect of SR 141716 was not affected by GBR-12909 and the dopamine receptor antagonist haloperidol. In conclusion, the dopaminergic neurones of the guinea-pig retina can be labelled by both [3H]DA and [3H]NA. Transmitter release from the dopaminergic neurones is inhibited by activation of cannabinoid receptors of the CB1 type, which appear to be tonically activated by an endogenous CB receptor ligand.

Different types of presynaptic inhibitory Gα(i/o) protein-coupled receptors usually do not act independently of each other but rather pre-activation of receptor X impairs the effect mediated via receptor Y. It is, however, unknown whether this interaction extends to the cannabinoid CB(1) receptor on cholinergic neurones and hence we studied whether its activation, pharmacological blockade, or genetic inactivation affects the function of other presynaptic inhibitory receptors. The electrically evoked acetylcholine or noradrenaline release was determined in superfused rodent tissues preincubated with (3)H-choline or (3)H-noradrenaline. The muscarinic M(2) receptor, Gα(i), and Gα(o) proteins were determined in hippocampal synaptosomes by Western blotting. Hippocampal anandamide and 2-arachidonoyl glycerol levels were determined by LC-MS/MS. The inhibitory effect of the muscarinic receptor agonist oxotremorine on acetylcholine release in hippocampal slices was increased by genetic CB(1) receptor ablation (mouse) and the CB(1) antagonist rimonabant (rat but not mouse) and decreased by a cannabinoid receptor agonist (mouse). In mouse tissues, CB(1) receptor ablation also increased the effect of a δ opioid receptor agonist on acetylcholine release in the hippocampus and the effect of oxotremorine on noradrenaline release in the vas deferens. CB(1) receptor ablation, to a very slight extent, increased Gα(o) protein levels without affecting either Gα(i) and M(2) receptor protein or the levels of anandamide and 2-arachidonoyl glycerol in the hippocampus. In conclusion, the CB(1) receptor shows an inhibitory interaction with the muscarinic and δ opioid receptor on cholinergic neurones in the rodent hippocampus and with the muscarinic receptor on noradrenergic neurones in the mouse vas deferens.

The human saphenous vein was used to examine whether presynaptic histamine receptors can modulate noradrenaline release and, if so, to determine their pharmacological characteristics. Strips of this blood vessel were incubated with [3H]noradrenaline and subsequently superfused with physiological salt solution containing desipramine and corticosterone. Electrically (2 Hz) evoked 3H overflow was inhibited by histamine and the H3 receptor agonist R-(-)-alpha-methylhistamine. Histamine-induced inhibition of electrically evoked tritium overflow was not affected by alpha 2-adrenoceptor blockade by rauwolscine. S-(+)-alpha-methylhistamine (up to 10 mumol/l) as well as the histamine H1 and H2 receptor agonists 2-(2-thiazolyl)ethylamine (up to 3 mumol/l) and dimaprit (up to 30 mumol/l), respectively, were ineffective. The selective histamine H3 receptor antagonist thioperamide abolished the inhibitory effect of histamine. The histamine H2 and H1 receptor antagonists ranitidine and pheniramine, respectively, did not affect the histamine-induced inhibition of evoked tritium overflow. The present results are compatible with the suggestion that the sympathetic nerves of the human saphenous vein are endowed with inhibitory presynaptic histamine receptors of the H3 class.

Brain cortex slices were preincubated with 3H-noradrenaline and superfused with physiological salt solution containing desipramine. We studied the inhibition of the electrically evoked tritium overflow caused by histamine in the presence of α-adrenoceptor ligands (mouse and rat brain cortex), and the inhibition caused by talipexole (the former B-HT 920) in the presence of H3-receptor ligands (mouse brain cortex). In mouse brain cortex slices, the inhibitory effect of histamine on the tritium overflow evoked by 36 pulses, 0.3 Hz was not changed by the α1-adrenoceptor antagonist prazosin, but increased by the α2-adrenoceptor antagonist rauwolscine. When the current strength or the duration of electrical pulses was reduced to compensate for the increase in evoked tritium overflow produced by rauwolscine, the latter still. enhanced the effect of histamine. The histamine-induced inhibition of tritium overflow evoked by 360 pulses, 3 Hz was not affected by the α1-adrenoceptor agonist phenylephrine but attenuated by the α2-adrenoceptor- agonist talipexole. Finally, the inhibition by histamine of the tritium overflow evoked by 3 pulses, 100 Hz was attenuated by talipexole but not affected by rauwolscine. Conversely,. the inhibitory effect of talipexole on tritium overflow elicited by 360 pulses, 3 Hz was slightly attenuated by the H3-receptor agonist R-(−)-α-methylhistamine but not, affected by the H3- receptor antagonist thioperamide. In rat brain cortex slices, histamine only tended to inhibit tritium overflow evoked by 360 pulses, 3 Hz, both in the absence of α-adrenoceptor antagonists and in the presence of prazosin. However, histamine markedly inhibited the evoked overflow in the presence of rauwolscine. Again, enhancement of the histamine-induced inhibition also occurred when the current strength or the duration of pulses was reduced in order to compensate for the increase in evoked tritium overflow produced by rauwolscine. The results suggest that the α2-autoreceptors and the H3-heteroreceptors at the noradrenergic nerve endings in the brain of mouse and rat interact with each other. Activation of the α2-autoreceptors decreases, whereas blockade of the activated (but not of the non-activated) α2-autoreceptors increases, the inhibitory effect of histamine. Activation of the H3-heteroreceptors slightly decreases, whereas blockade of the H3-receptors fails to affect, the inhibitory effect of talipexole.

The effects of neuropeptide Y (NPY), peptide YY (PYY), pancreatic polypeptide and of another four peptides on the electrically evoked 3H overflow were studied in superfused rat brain cortex slices preincubated with 3H-serotonin. In addition, we determined the effect of NPY on the Ca2(+)-induced 3H overflow from rat brain cortex slices and synaptosomes (preincubated with 3H-serotonin) and on the forskolin-stimulated accumulation of cAMP in a membrane fraction from rat brain cortex. The electrically (3 Hz) evoked 3H overflow was inhibited by PYY, NPY and pancreatic polypeptide (decreasing order of potency), but not affected by ACTH1-24, angiotensin II, bradykinin and delta-sleep-inducing peptide. The inhibitory effect of NPY did not change when the stimulation frequency was lowered to 1 Hz, but was markedly reduced at 10 Hz. The inhibitory effect of a presumably maximally active concentration of PYY was not altered in the presence of NPY or pancreatic polypeptide (effects not additive), whereas the inhibition produced by a maximally active concentration of the alpha 2-adrenoceptor agonist clonidine was further increased by NPY. NPY also inhibited (1) the tritium overflow, evoked by introduction of Ca2+, in slices superfused with Ca2(+)-free and K(+)-rich medium containing tetrodotoxin, (2) the tritium overflow, evoked by simultaneously increasing Ca2+ and K+ in the superfusion fluid of synaptosomes previously superfused with Ca2(+)-free medium and (3) the forskolin-stimulated accumulation of cAMP in rat brain cortex membranes. The present results suggest that NPY inhibits serotonin release in the rat brain via presynaptic NPY receptors, which are also activated by PYY and pancreatic polypeptide and may be negatively coupled to an adenylate cyclase.

Rimonabant is an inverse agonist specific for cannabinoid receptors and selective for their cannabinoid-1 (CB(1)) subtype. Although CB(1) receptors are more abundant in the central nervous system, rimonabant has many effects in the periphery, most of which are related to prejunctional modulation of transmitter release from autonomic nerves. However, CB(1) receptors are also expressed in, e.g., adipocytes and endothelial cells. Rimonabant inhibits numerous cardiovascular cannabinoid effects, including the decrease of blood pressure by central and peripheral (cardiac and vascular) sites of action, with the latter often being endothelium dependent. Rimonabant may also antagonize cannabinoid effects in myocardial infarction and in hypotension associated with septic shock or liver cirrhosis. In the gastrointestinal tract, rimonabant counteracts the cannabinoid-induced inhibition of secretion and motility. Although not affecting most cannabinoid effects in the airways, rimonabant counteracts inhibition of smooth-muscle contraction by cannabinoids in urogenital tissues and may interfere with embryo attachment and outgrowth of blastocysts. It inhibits cannabinoid-induced decreases of intraocular pressure. Rimonabant can inhibit proliferation of, maturation of, and energy storage by adipocytes. Among the many cannabinoid effects on hormone secretion, only some are rimonabant sensitive. The effects of rimonabant on the immune system are not fully clear, and it may inhibit or stimulate proliferation in several types of cancer. We conclude that direct effects of rimonabant on adipocytes may contribute to its clinical role in treating obesity. Other peripheral effects, many of which occur prejunctionally, may also contribute to its overall clinical profile and lead to additional indications as well adverse events.

The mechanism of action of cannabidiol, one of the major constituents of cannabis, is not well understood but a noncompetitive interaction with mu opioid receptors has been suggested on the basis of saturation binding experiments. The aim of the present study was to examine whether cannabidiol is an allosteric modulator at this receptor, using kinetic binding studies, which are particularly sensitive for the measurement of allosteric interactions at G protein-coupled receptors. In addition, we studied whether such a mechanism also extends to the delta opioid receptor. For comparison, (-)-Delta9-tetrahydrocannabinol (THC; another major constituent of cannabis) and rimonabant (a cannabinoid CB1 receptor antagonist) were studied. In mu opioid receptor binding studies on rat cerebral cortex membrane homogenates, the agonist 3H-DAMGO bound to a homogeneous class of binding sites with a KD of 0.68+/-0.02 nM and a Bmax of 203+/-7 fmol/mg protein. The dissociation of 3H-DAMGO induced by naloxone 10 microM (half life time of 7+/-1 min) was accelerated by cannabidiol and THC (at 100 microM, each) by a factor of 12 and 2, respectively. The respective pEC50 values for a half-maximum elevation of the dissociation rate constant k(off) were 4.38 and 4.67; 3H-DAMGO dissociation was not affected by rimonabant 10 microM. In delta opioid receptor binding studies on rat cerebral cortex membrane homogenates, the antagonist 3H-naltrindole bound to a homogeneous class of binding sites with a KD of 0.24+/-0.02 nM and a Bmax of 352+/-22 fmol/mg protein. The dissociation of 3H-naltrindole induced by naltrindole 10 microM (half life time of 119+/-3 min) was accelerated by cannabidiol and THC (at 100 microM, each) by a factor of 2, each. The respective pEC50 values were 4.10 and 5.00; 3H-naltrindole dissociation was not affected by rimonabant 10 microM. The present study shows that cannabidiol is an allosteric modulator at mu and delta opioid receptors. This property is shared by THC but not by rimonabant.

We have shown previously that histaprodifen and its Nalpha-substituted analogues methylhistaprodifen and dimethylhistaprodifen are highly potent H1-receptor agonists in vivo. The aim of the present study was to examine the influence of four newly synthesized histaprodifen analogues, 3-fluoro-methylhistaprodifen (1), Nalpha-imidazolylethylhistaprodifen (2), bis-histaprodifen (3) and Nalpha-methyl-bis-histaprodifen (4), on the cardiovascular system in the pithed and in the anaesthetized rat. In pithed and vagotomized rats, diastolic blood pressure (which was increased to 80-85 mmHg by vasopressin infusion) was decreased dose dependently by methylhistaprodifen (the reference compound) and by compounds 1-4. The maximum decrease was about 47-50 mmHg for methylhistaprodifen and compounds 1, 2 and 3. Their potencies, expressed as pED50 (the negative logarithm of the dose in mole per kilogram body weight that decreased diastolic blood pressure by 25 mmHg), were 8.31, 8.23, 8.26 and 7.84, respectively. With compound 4 the maximal effect was not achieved at doses up to 1 micromol/kg (the latter dose decreased blood pressure by about 30 mmHg; pED50 approximately 6.5). The vasodepressor effect of the five compounds was attenuated by the H1-receptor antagonist dimetindene (1 micromol/kg) but was not changed by combined administration of the H2- and H3-receptor antagonists ranitidine and thioperamide (1 micromol/kg each), by combined administration of the alpha1- and alpha2-adrenoceptor antagonists prazosin and rauwolscine (1 micromol/kg each) or by the beta-adrenoceptor antagonist propranolol (3 micromol/kg). In anaesthetized rats methylhistaprodifen and compounds 1-4 induced almost the same fall in blood pressure as in pithed and vagotomized animals; the effects were sensitive to blockade by dimetindene (1 micromol/kg). Higher doses of compounds 1 and 2 (1 micromol/kg) increased heart rate in pithed and vagotomized rats in a manner sensitive to propranolol (3 micromol/kg) but insensitive to dimetindene (3 micromol/kg). The same dose of methylhistaprodifen and of compounds 3 and 4 failed to affect heart rate. We conclude that the agonistic potency of compounds 1 and 2 at H1-receptors in the cardiovascular system of the rat equals that of methylhistaprodifen, the most potent histamine H1-receptor agonist available until recently. Compounds 1 and 2 exhibit sympathomimetic activity at high doses.

Guinea-pig hippocampal slices preincubated with [3H]noradrenaline were superfused with medium containing desipramine and rauwolscine and rat striatal slices preincubated with [3H]dopamine were superfused with medium containing nomifensine; the effect of cannabinoid receptor ligands on tritium overflow stimulated by NMDA or kainate was examined. Furthermore, the affinity of the drugs for cannabinoid CB1 receptors was determined in rat brain cortex membranes using [3H]SR 141716. In guinea-pig hippocampal slices preincubated with [3H]noradrenaline, tritium overflow stimulated by NMDA 100 microM and 1000 microM and by kainate 1000 microM was inhibited by the cannabinoid receptor agonists CP-55,940 and/or WIN 55,212-2. The CB1 receptor antagonist SR 141716 increased the NMDA (1000 microM)-stimulated tritium overflow but did not affect tritium overflow stimulated by NMDA 100 microM or kainate 1000 microM. The inhibitory effect of WIN 55,212-2 on the NMDA (100 microM)- and kainate (1000 microM)-evoked tritium overflow was antagonized by SR 141716. In rat striatal slices preincubated with [3H]dopamine, WIN 55,212-2 inhibited the NMDA (1000 microM)-stimulated tritium overflow. SR 141716, which, by itself, did not affect tritium overflow, counteracted the inhibitory effect of WIN 55,212-2. [3H]SR 141716 binding to rat cortical membranes was inhibited by SR 141716, CP-55,940 and WIN 55,212-2 (pKi 8.53, 7.34 and 5.93, respectively) but not affected by desipramine, rauwolscine and nomifensine (pKi5). In conclusion, activation of CB1 receptors inhibits the NMDA- and kainate-stimulated noradrenaline release in guinea-pig hippocampus and the NMDA-stimulated dopamine release in rat striatum. The explanation for the facilitatory effect of SR 141716 might be that it acts as an inverse agonist at CB1 receptors or that these receptors are activated by endogenous cannabinoids.

Mr 2266 [(-)-(1R,5R,9R)-5,9-diethyl-2-(3-furylmethyl)-2'-hydroxy-6,7-benzomorpha n] is an antagonist at kappa-opioid receptors and at ORL1 receptors as well. The aim of our study was to examine whether the known stereoselective antagonism of Mr 2266 at kappa-opioid receptors also extends to ORL1 receptors. In mouse brain cortex membranes, the binding of the ORL1 receptor agonist [3H]nociceptin was equipotently inhibited by Mr 2266 and its enantiomer Mr 2267 (pK(i) 4.82 and 5.14, respectively), whereas the binding of the kappa-opioid receptor agonist [3H]U-69,593 was inhibited by Mr 2266 more potently (pK(i) 9.11) than by its enantiomer Mr 2267 (pK(i)7.15). In mouse brain cortex slices preincubated with [3H]noradrenaline, the concentration-response curve of nociceptin for inhibition of the electrically evoked overflow of tritium was equipotently shifted to the right by Mr 2266 and Mr 2267 (pA2 5.77 and 5.64, respectively). On the other hand, the inhibitory effect of U-69,593 on the electrically evoked overflow of tritium in guinea-pig brain cortex slices preincubated with [3H]noradrenaline was more potently antagonized by Mr 2266 (pA2 8.81) than by Mr 2267 (pA2 7.15). These data show that the stereoselective antagonism of Mr 2266 at kappa-opioid receptors does not extend to ORL1 receptors.

We determined the affinities of five newly synthesized histamine H3-receptor antagonists in an H3-receptor binding assay and their potencies in a functional H3-receptor model. Furthermore, we determined their potencies in a histamine H2- and H1-receptor model. The compounds differ from histamine in that the ethylamine side chain is replaced by an aryl-substituted propyloxy chain and they differ from one another by varying substituents of the aryl rest. Iodoproxyfan, a highly potent and selective antagonist at H3 receptors, is structurally related to these five compounds. The specific binding of [3H]-Nalpha-methylhistamine to rat brain cortex membranes was monophasically displaced by each of the five compounds at pKi values ranging from 8.24 to 9.27. Inhibition by histamine of the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]noradrenaline was antagonized by all compounds and the concentration-response curve was shifted to the right with apparent pA2 values ranging from 7.78 to 9.39. The five compounds under study possess negligible potencies at histamine H2 and H1 receptors studied in the guinea-pig right atrium and ileum, respectively (pD'2 or pKp values < or = 5.2). The present paper shows that the five compounds under study possess high affinities and potencies at histamine H3 receptors, four out of the five compounds in this respect being equipotent with iodoproxyfan. Like iodoproxyfan, the five compounds show an at least 1000-fold selectivity for H3 as compared to H2 and H1 receptors.

A fourth type of opioid receptor, termed ORL1, has been cloned and nociceptin (also known as orphanin FQ) has been identified as an endogenous ligand at this receptor. We examined whether nociceptin affects the release of noradrenaline in the brain. For this purpose, cerebral cortex slices from the mouse, rat or guinea-pig were preincubated with [3H]noradrenaline and then superfused with medium containing desipramine and rauwolscine. Tritium overflow was evoked electrically (0.3 Hz) or by introduction of Ca2+ 1.3 mM into Ca2+-free K+-rich (15 mM) medium. Nociceptin 1 microM reduced the electrically evoked tritium overflow from mouse, rat and guinea-pig brain cortex slices by 80, 71 and 36%, respectively. Naloxone 10 microM did not change the effect of nociceptin. All subsequent experiments were performed on mouse brain cortex slices and in the presence of naloxone 10 microM. The concentration-response curve of nociceptin (maximum inhibition by 80%, pEC50 7.5) was shifted to the right by the non-selective ORL1 receptor antagonist naloxone benzoylhydrazone and the selective ORL1 receptor antagonist [Phe1psi(CH2-NH)Gly2]-nociceptin(1-13)NH2 (pA2 6.6 and 7.2, respectively). Naloxone benzoylhydrazone did not affect the evoked overflow by itself whereas [Phe1psi(CH2-NH)Gly2]nociceptin(1-13)NH2 caused an inhibition by maximally 35% (pEC50 7.0; intrinsic activity alpha 0.45). The inhibitory effect of [Phe1psi(CH2-NH)Gly2]-nociceptin(1-13)NH2 was counteracted by naloxone benzoylhydrazone. Nociceptin also reduced the Ca2+-evoked tritium overflow in mouse brain cortex slices superfused in the presence of tetrodotoxin. This effect was also antagonized by naloxone benzoylhydrazone, which, by itself, did not affect the evoked tritium overflow. In conclusion, nociceptin inhibits noradrenaline release more markedly in the mouse than in the rat or guinea-pig brain cortex. The effect of nociceptin in the mouse brain cortex involves ORL1 receptors, which are located presynaptically on noradrenergic neurones.

We examined the question of whether cannabinoid receptors modulating noradrenaline release are detectable in the brain of humans and experimental animals. For this purpose, hippocampal slices from humans, guinea-pigs, rats and mice and cerebellar, cerebrocortical and hypothalamic slices from guinea-pigs were incubated with [3H]noradrenaline and then superfused. Tritium overflow was evoked either electrically (0.3 or 1 Hz) or by introduction of Ca2+ ions (1.3 mM) [corrected] into Ca(2+)-free, K(+)-rich medium (25 mM) [corrected] containing tetrodotoxin 1 microM. Furthermore, the cAMP accumulation stimulated by forskolin 10 microM was determined in guinea-pig hippocampal membranes. We used the following drugs: the cannabinoid receptor agonists (-)-cis-3-[2-hydroxy-4-(1,1- dimethylheptyl)phenyl]-trans-4-(3-hydroxypropyl)cyclo-hexanol (CP-55,940) and R(+)-[2,3-dihydro-5-methyl-3- [(morpholinyl)methyl]pyrrolo[1,2,3-de]-1,4-benzoxazinyl]- (1-naphthalenyl)methanone (WIN 55,212-2), the inactive S(-)-enantiomer of the latter (WIN 55,212-3) and the CB1 receptor antagonist N-piperidino-5-(4-chlorophenyl)- 1-(2,4-dichlorophenyl)-4-methyl-3-pyrazole-carboxamide (SR 141716). The electrically evoked tritium overflow from guinea-pig hippocampal slices was reduced by WIN 55,212-2 (pIC30% 6.5) but not affected by WIN 55,212-3 up to 10 microM. The concentration-response curve of WIN 55,212-2 was shifted to the right by SR 141716 (0.032-microM) (apparent pA2 8.2), which by itself did not affect the evoked overflow. WIN 55,212-2 1 microM also inhibited the Ca(2+)-evoked tritium overflow in guinea-pig hippocampal slices and the electrically evoked overflow in guinea-pig cerebellar, cerebrocortical and hypothalamic slices as well as in human hippocampal slices but not in rat and mouse hippocampal slices. SR 141716 (0.32 microM) markedly attenuated the WIN 55,212-2-induced inhibition in guinea-pig and human brain slices. SR 141716 0.32 microM by itself increased the electrically evoked tritium overflow in guinea-pig hippocampal slices but failed to do so in slices from the other brain regions of the guinea-pig and in human hippocampal slices but failed to do so in slices from the other brain regions of the guinea-pig and in human hippocampal slices. The cAMP accumulation stimulated by forskolin was reduced by CP-55,940 and WIN 55,212-2. The concentration-response curve of CP 55,940 was shifted to the right by SR 141716 (0.1 microM; apparent pA2 8.3), which by itself did not affect cAMP accumulation. In conclusion, cannabinoid receptors of the CB1 subtype occur in the human hippocampus, where they may contribute to the psychotropic effects of cannabis, and in the guinea-pig hippocampus, cerebellum, cerebral cortex and hypothalamus. The CB1 receptor in the guinea-pig hippocampus is located presynaptically, is activated by endogenous cannabinoids and may be negatively coupled to adenylyl cyclase.

Hippocampal slices were prepared from brain tissue of patients undergoing neurosurgery for epilepsy. The slices were incubated with 3H-serotonin (3H-5-HT) and then superfused with physiological salt solution containing 6-nitroquipazine. Tritium overflow was evoked either electrically (3 Hz) or by K+ 25 mM. The electrically evoked overflow of tritium was almost abolished by tetrodotoxin or by omission of Ca2+ ions. 5-HT 0.1 and 1 microM reduced the evoked overflow by 38 and 55%, respectively. The effect of 5-HT 1 microM was abolished by the 5-HT1/2 receptor antagonist methiothepin 1 microM, which, by itself, increased the evoked overflow by 59%. Tritium overflow evoked by high K+ in slices superfused with medium containing tetrodotoxin was reduced by 5-HT 1 microM by 49%. This effect was markedly attenuated by methiothepin 0.32 microM, which, by itself, tended to increase the evoked overflow. The results show that the serotoninergic neurones of the human hippocampus are endowed with presynaptic inhibitory autoreceptors.

We determined the affinities of 16 newly synthesized H3 receptor antagonists in an H3 receptor binding assay and the potencies of 12 of these compounds at functional H3 receptors in the mouse brain cortex and guinea-pig ileum. The compounds differ from histamine in that the C-C-N side chain is replaced by a chain of the structure C-C-C-O. The two major aims of the study were (1) to investigate whether the two functional H3 receptors are pharmacologically different and (2) to derive structure-activity relationships. The specific binding of 3H-Na-methylhistamine to rat brain cortex membranes was monophasically displaced by each of the 16 compounds at pKi values ranging from 7.30 to 9.48. In superfused mouse brain cortex slices preincubated with 3H-noradrenaline, the electrically evoked tritium overflow was slightly decreased by iodoproxyfan and its deiodo analogue; this effect was counteracted by the H3 receptor antagonist clobenpropit. The other compounds did not affect the evoked tritium overflow by themselves. The concentration-response curve of histamine for its inhibitory effect on the electrically evoked tritium overflow was shifted to the right by the 12 compounds with apparent pA2 values ranging from 7.02 to 9.00. The 12 compounds also shifted to the right the concentration-response curve of R-a-methylhistamine for its inhibitory effect on the electrically induced contraction in guinea-pig ileum strips; the apparent pA2 values ranged from 5.97 to 9.00. Iodoproxyfan decreased the electrically induced contraction by itself and this effect was counteracted by the H3 receptor antagonist thioperamide. The apparent pA2 values in the two functional H3 receptor models showed a highly significant correlation (r = 0.882; P < 0.001). Highly significant correlations were also obtained when the pKi values of the compounds in the binding assay were compared to their apparent pA2 values in the mouse brain (r = 0.799; P < 0.004) and in the guinea-pig ileum (r = 0.851; P < 0.001). In each of the three experimental models, iodoproxyfan was the most potent compound; its deiodo analogue was less potent by more than 1.1 log units. The present results show that the compounds under study possess moderate to high affinity and/or (partial) H3 receptor antagonist potency. The two functional H3 receptors in the mouse brain cortex and the guinea-pig ileum may be slightly different; further studies are necessary to clarify whether this difference is due to H3 receptor heterogeneity, species variants or differences in the efficiency of receptor coupling. The marked difference in the affinity/potency between iodoproxyfan and its deiodo analogue may suggest that a highly lipophilic residue in that part of the molecule favours a high affinity/antagonistic potency at H3 receptors.

We determined the affinity and/or potency of two metabolites of clozapine (clozapine-N-oxide and N-desmethylclozapine) and of five atypical neuroleptics, chemically related (olanzapine) or unrelated to clozapine (remoxipride, risperidone, thioridazine, zotepine), at H3 receptors. The specific binding of 3H-N alpha-methylhistamine to rat brain cortex homogenates was inhibited by the seven compounds; the pKi values were: N-desmethylclozapine (5.33); clozapine-N-oxide (4.18); olanzapine (5.45); thioridazine (4.91); zotepine (4.75); remoxipride (4.51) and risperidone (4.43). Three compounds were examined in a functional H3 receptor model as well. The electrically evoked tritium overflow from superfused mouse brain cortex slices, which represents quasi-physiological noradrenaline release, was not affected by N-desmethylclozapine (3.2 and 10 microM), clozapine-N-oxide (3.2-100 microM) and olanzapine (3.2-32 microM). On the other hand, the three compounds shifted to the right the concentration-response curve of histamine for its inhibitory effect on the evoked overflow; the apparent pA2 values were 5.84, 4.21 and 5.80, respectively. The present study shows that five atypical neuroleptics of different chemical classes and the two major metabolites of clozapine possess a lower affinity and/or antagonistic potency at H3 receptors than clozapine itself (pKi 6.15, pA2 6.33; Kathmann M, Schlicker E, Göthert M (1994). Psychopharmacology 116: 464-468).

Mouse or rat brain cortex slices were preincubated with 3H-noradrenaline and superfused with physiological salt solution containing desipramine. We studied the effects of prostaglandin E2 (PGE2), prostaglandin D2 (PGD2) and related drugs on the electrically evoked (50 mA, 2 ms, 0.3 Hz) tritium overflow. PGE2 inhibited the electrically evoked tritium overflow from mouse brain cortex slices; the maximum effect of PGE2 (79010) was attenuated by the α2-adrenoceptor agonist talipexole (to 52010) and enhanced by the α2-adrenoceptor antagonist rauwolscine (to 92%). Rauwolscine was added to the superfusion medium in all subsequent experiments. The effect of PGE2 was readily reversible upon withdrawal from the medium and remained constant upon prolonged exposure of the tissue to the prostanoid. Studies with EP receptor agonists, mimicking the inhibitory effect of PGE2, showed the following potencies (pIC50): sulprostone (8.22); misoprostol (8.00); PGE2 (7.74); PGEZ (7.61); iloprost (5.86). The concentration-response curve of PGE2 was marginally shifted to the right by the EP1 receptor antagonist AH 6809 (6-isopropoxy-9-oxoxanthene-2-carboxylic acid; apparent pA2 3.97) and by the TP receptor antagonist vapiprost (4.50). AH 6809, by itself, did not affect the evoked overflow whereas vapiprost increased it. PGD2 inhibited the evoked overflow at high concentrations (pIC50 4.90); this effect was not altered by the DP receptor antagonist BW A868C (3-benzyl-5-(6-carboxyhexyl)-1-(2-cyclohexyl-2hydroxyethylamino)hydantoin), which, by itself, did not affect the evoked overflow. Indometacin slightly increased the evoked overflow and tended to increase the inhibitory effect of PGE2. PGE2 inhibited the electrically evoked tritium overflow also in rat brain cortex slices. The maximum effect (obtained in the presence of rauwolscine) was 61%; the pIC30 value was 7.67. The present study suggests that PGE2 inhibits noradrenaline release from mouse brain cortex via EP3 receptors and that its maximum effect is more marked in the mouse than in the rat. The inhibitory effect of PGD2 (in the mouse brain) does not involve DP receptors and may also be related to EP3 receptors. The EP3 receptors interact with a2-adrenoceptors and may be activated by endogenous prostanoids.

The present study was aimed at the identification of mechanisms following the activation of histamine H3 receptors. Mouse brain cortex slices preincubated with 3H-noradrenaline were superfused and the (H3 receptor-mediated) effect of histamine on the electrically evoked tritium overflow was studied under a variety of conditions. The extent of inhibition produced by histamine was inversely related to the frequency of stimulation used to evoke tritium overflow and to the Ca2+ concentration in the superfusion medium. An activator (levcromakalim) and blocker (glibenclamide) of ATP-dependent K+ channels did not affect the electrically evoked tritium overflow and its inhibition by histamine. A blocker of voltage-sensitive K+ channels, tetraethylammonium (TEA), increased the evoked overflow and attenuated the inhibitory effect of histamine. TEA also reduced the inhibitory effect of noradrenaline and prostaglandin E2 on the evoked overflow. When the facilitatory effect of TEA on the evoked overflow was compensated for by reducing the Ca 2+ concentration in the superfusion medium, TEA did no longer attenuate the effect of histamine. Exposure of the slices to the SH group-alkylating agent N-ethylmaleimide increased the evoked overflow and attenuated the inhibitory effect of histamine; both effects were counteracted by the SH group-protecting agent dithiothreitol, which, by itself, did not affect the evoked overflow and its inhibition by histamine. Mouse brain cortex membranes were used to study the effect of the H3 receptor agonist R-(−)α-methylhistamine on the basal cAMP accumulation and on the accumulation stimulated by forskolin or noradrenaline. R-(−)-α-Methylhistamine did not affect basal cAMP accumulation but, at high concentrations, inhibited the forskolin- and noradrenaline-stimulated cAMP accumulation. S-(+)-α-Methylhistamine (which is 100 times less potent than R-(−)-α-methylhistamine at H3 receptors) was equipotent with the R-(−)-enantiomer in inhibiting the forskolin-stimulated CAMP accumulation. The inhibition by R-(−)-α-methylhistamine was not affected by the H3 receptor antagonist clobenpropit but was counteracted by the α2-adrenoceptor antagonist rauwolscine. The present results suggest that the histamine-induced inhibition of noradrenaline release depends on the availability of extracellular Ca2+ ions for stimulus-release coupling; in particular, a decrease in Ca 2+ influx into the varicosities may contribute to this inhibition. The H3 receptors (which may be coupled to a G protein) do not appear to be coupled to adenylate cyclase, to ATP-dependent K+ channels or to (TEA-sensitive) voltage-regulated K+ channels. α-Methylhistamine, in addition to its main action as a stereoselective H3 receptor agonist, proved to be weakly potent as an α2-adrenoceptor agonist.

In superfused rat brain cortex slices and synaptosomes preincubated with [3H]noradrenaline the effect of agonists or antagonists at presynaptic H3 receptors on NMDA-evoked [3H]noradrenaline release was investigated. In experiments on slices, histamine and the preferential H3 receptor agonist R-(-)-alpha-methylhistamine inhibited NMDA-evoked tritium overflow (IC20 values 0.27 mumol/l or 0.032 mumol/l, respectively); S-(+)-alpha-methylhistamine (up to 10 mumol/l) as well as the selective H1 receptor agonist (2-(2-thiazolyl)ethylamine and the selective H2 receptor agonist dimaprit (each up to 10 mumol/l) were ineffective. The H3 receptor antagonist thioperamide abolished the inhibitory effect of histamine whereas the preferential H1 receptor antagonist dimetindene and the preferential H2 receptor antagonist ranitidine were ineffective. In experiments on synaptosomes, histamine and R-(-)-alpha-methylhistamine inhibited NMDA-evoked tritium overflow, whereas 2-(2-thiazolyl)ethylamine or dimaprit had no effect. The inhibitory effect of histamine was abolished by thioperamide. When tritium overflow was stimulated by NMDA in the presence of omega-conotoxin GVIA (which by itself decreased the response to NMDA by about 55%), R-(-)-alpha-methylhistamine did not inhibit NMDA-evoked overflow. It is concluded that NMDA-evoked noradrenaline release in the cerebral cortex can be modulated by inhibitory H3 receptors. NMDA receptors and H3 receptors are both located presynaptically and may interact at the same noradrenergic varicosity. An unimpaired function of the N-type voltage-sensitive calcium channel probably is a prerequisite for the inhibition of NMDA-evoked noradrenaline release by H3 receptor stimulation.

We analyzed the facilitatory effect of the 5-HT3 receptor agonist 1-(m-chlorophenyl)-biguanide (mCPBG) on the electrically evoked noradrenaline release in superfused mouse brain tissue. In addition, we determined the affinities of mCPBG and two other 5-HT receptor ligands, namely 2-methyl-5-hydroxytryptamine (2-methyl-5-HT; also a 5-HT3 receptor agonist) and 5-carboxamidotryptamine (5-CT; a 5-HT1 receptor agonist) for alpha 2 binding sites. The latter two 5-HT receptor agonists were included because of the claimed involvement of alpha 2-adrenoceptors in their effects on noradrenaline release. In superfusion experiments on mouse brain cortex slices preincubated with 3H-noradrenaline, tritium overflow evoked by 2-min periods of electrical field stimulation (3 Hz) was facilitated by mCPBG and, in addition, by rauwolscine (alpha 2-adrenoceptor antagonist) and tetraethylammonium (K+ channel blocker) (which were examined for comparison). The effect of mCPBG was not affected by the 5-HT3 receptor antagonist tropisetron or by desipramine but was abolished by rauwolscine. In slices superfused with medium containing desipramine, the concentration-response curve of unlabelled noradrenaline for its inhibitory effect on the electrically (0.3 Hz) evoked overflow was shifted to the right by mCPBG and rauwolscine (apparent pA2 5.35 and 7.88, respectively). In another series of superfusion experiments, 4 electrical pulses, administered at 100 Hz, were used to evoke tritium overflow. Tritium overflow evoked by this stimulation procedure (under which an endogenous tone of noradrenaline does not develop) was not affected by mCPBG and rauwolscine but still increased by tetraethylammonium.(ABSTRACT TRUNCATED AT 250 WORDS)

We determined the affinities of nordimaprit, homodimaprit, clobenpropit and imetit for H3 binding sites (labelled by 3H-N alpha-methylhistamine) in rat brain cortex homogenates and their potencies at presynaptic H3A receptors on noradrenergic nerve endings in mouse brain cortex slices. 3H-N alpha-Methylhistamine bound saturably to rat brain cortex homogenates with a Kd of 0.70 nmol/l and a Bmax of 98 fmol/mg protein. Binding of 3H-N alpha-methylhistamine was displaced monophasically by dimaprit (pKi 6.55), nordimaprit (5.94), homodimaprit (6.44), clobenpropit (9.16), imetit (9.83), R-(-)-alpha-methylhistamine (8.87) and histamine (8.20), and biphasically by burimamide (pKi high 7.73, pKi low 5.97). In superfused mouse brain cortex slices preincubated with 3H-noradrenaline, the electrically (0.3 Hz) evoked tritium overflow was inhibited by imetit (pIC35 8.93), R-(-)-alpha-methylhistamine (7.87) and histamine (7.03). The effect of histamine was attenuated by nordimaprit, homodimaprit, clobenpropit and N-ethoxycarbonyl-2- ethoxy-1,2-dihydroquinoline (EEDQ); EEDQ (but not nordimaprit, homodimaprit and clobenpropit) attenuated the effect of histamine also in slices pre-exposed to the drug 60-30 min prior to superfusion. The concentration-response curve of histamine was shifted to the right by homodimaprit and clobenpropit; Schild plots yielded straight lines with a slope of unity for both drugs (pA2 5.94 and 9.55, respectively). Nordimaprit depressed the maximum effect of histamine (pD'2 5.55) and also slightly increased the concentration of histamine producing the half-maximum effect.(ABSTRACT TRUNCATED AT 250 WORDS)

In pithed and vagotomized rats the effects of the H3 receptor agonist R-(-)-alpha-methylhistamine, the H1 receptor agonist 2-(2-thiazolyl)ethylamine and the H2 receptor agonist dimaprit on basal diastolic blood pressure, basal heart rate and the electrically induced rise in heart rate were examined. Basal diastolic blood pressure was not altered by low, but increased by high doses of R-(-)-alpha-methylhistamine; the latter effect was not affected by selective H1, H2 or H3 receptor antagonists and by prazosin, but was attenuated by rauwolscine. Rauwolscine also unmasked a vasodepressor response to R-(-)-alpha-methylhistamine not affected by the H3 receptor antagonist thioperamide, but counteracted by the H1 receptor antagonist dimetindene or the H2 receptor antagonist ranitidine. The vasodepressor responses to 2-(2-thiazolyl)ethylamine and dimaprit were antagonized by dimetindene and ranitidine, respectively. The vasodepressor response to 2-(2-thiazolyl)ethylamine was not altered by indomethacin, but reduced by an inhibitor of endothelial nitric oxide synthase, N omega-nitro-L-arginine methyl ester (which, by itself, markedly increased blood pressure). Both drug tools did not alter the effect of dimaprit. Basal heart rate was not affected by 2-(2-thiazolyl)ethylamine (examined after administration of propranolol), dimaprit and R-(-)-alpha-methylhistamine. The electrically induced increase in heart rate (studied in animals which had received rauwolscine) was decreased by R-(-)-alpha-methylhistamine but not affected by 2-(2-thiazolyl)ethylamine and dimaprit. The effect of R-(-)-alpha-methylhistamine was abolished by thioperamide. R-(-)-alpha-methylhistamine did not influence the increase in heart rate produced by isoprenaline.(ABSTRACT TRUNCATED AT 250 WORDS)

Mouse brain cortex slices preincubated with 3H-noradrenaline were superfused with physiological salt solution containing desipramine plus a drug with alpha 2-adrenoceptor antagonist properties, and the effects of histamine receptor ligands on the electrically (0.3 Hz) evoked tritium overflow were studied. The evoked overflow (from slices superfused with phentolamine) was inhibited by histamine (pIC35 6.53), the H3 receptor agonist R-(-)-alpha-methylhistamine (7.47) and its S-(+)-enantiomer (5.82) but not influenced by the H1 receptor agonist 2-(2-thiazolyl)-ethylamine 3.2 mumol/l and the H2 receptor agonist dimaprit 10 mumol/l. The inhibitory effect of histamine was not affected by the H1 receptor antagonist dimetindene 1 mumol/l and the H2 receptor antagonist ranitidine 10 mumol/l. The concentration-response curve of histamine (determined in the presence of rauwolscine) was shifted to the right by the H3 receptor antagonists thioperamide (apparent pA2 8.67), impromidine (7.30) and burimamide (6.82) as well as by dimaprit (6.16). The pA2 values of the four drugs were compared with their affinities for H3A and H3B binding sites in rat brain membranes (West et al. 1990 Mol Pharmacol 38:610); a significant correlation was obtained for the H3A, but not for the H3B sites. The results suggest that noradrenaline release in the mouse brain cortex is inhibited by histamine via H3A receptors and that dimaprit is an H3 receptor antagonist of moderate potency.

Rat brain cortex slices or synaptosomes preincubated with 3H-serotonin were superfused with physiological salt solution (which, in the case of slices, contained citalopram, an inhibitor of serotonin uptake), and the effects of histamine and related drugs on the evoked tritium overflow were studied. The electrically (3 Hz) evoked tritium overflow from slices was inhibited by histamine and the H3 receptor agonists R-(-)-alpha-methylhistamine and N alpha-methylhistamine (pIC12.5 values: 6.41, 7.28 and 6.12, respectively), but not affected by the H1 receptor agonist 2-(2-thiazolyl)ethylamine and the H2 receptor agonist dimaprit (each at 10 mumol/l). The concentration-response curve for histamine was shifted to the right by the H3 receptor antagonists impromidine, burimamide and thioperamide (apparent pA2 values: 7.45, 5.97 and 7.88, respectively); the concentration-response curve of serotonin for its inhibitory effect on the electrically evoked overflow was not affected by the three drugs (apparent pA2 values: less than 5.5, less than 5.5 and less than 6.5). Given alone, impromidine, thioperamide and a low concentration of burimamide facilitated the electrically evoked overflow. In slices superfused with K(+)-rich, Ca2(+)-free solution containing tetrodotoxin throughout and in synaptosomes superfused with Ca2(+)-free solution, histamine inhibited the overflow evoked by introduction of Ca2+ (in synaptosomes, simultaneously with an increased amount of K+). In either tissue, the effect of histamine was counteracted by thioperamide. The results provide evidence that exogenous and probably also endogenous histamine inhibits serotonin release in the rat brain cortex via presynaptic histamine H3 receptors.

Discs of pig retina were preincubated with 3H-noradrenaline, 3H-dopamine or 3H-serotonin and then superfused. Electrical field stimulation increased the outflow of tritium from discs preincubated with 3H-noradrenaline or 3H-dopamine, but no from discs preincubated with 3H-serotonin. The tritium content at the end of superfusion was similar in discs preincubated with 3H-noradrenaline or 3H-dopamine but about tenfold lower in discs preincubated with 3H-serotonin. The tritium content in discs preincubated with 3H-noradrenaline was markedly reduced when desipramine was present during preincubation but was not affected by selective inhibitors of dopamine and serotonin uptake. The tritium content in discs preincubated with 3H-dopamine and 3H-serotonin, in contrast, was reduced or tended to be reduced by a selective dopamine and serotonin uptake inhibitor, respectively. The electrically evoked overflow of tritium from discs preincubated with 3H-noradrenaline was abolished by tetrodotoxin or omission of Ca2+. In discs superfused with desipramine, the electrically evoked overflow was enhanced by phentolamine but not affected by histamine. When both desipramine and phentolamine were present in the superfusion medium, histamine inhibited the evoked overflow (pIC15 6.85). This effect was mimicked by the histamine H3 receptor agonist R-(-)-alpha-methylhistamine as well as by its S-(+)-enantiomer (pIC15 7.85 and 5.30, respectively) but not by the H1 receptor agonist 2-(2-thiazolyl)ethylamine and the H2 receptor agonist dimaprit (each 10 mumol/l).(ABSTRACT TRUNCATED AT 250 WORDS)

Slices and synaptosomes from human cerebral cortex (which had to be removed to reach deeply located tumours) and, for comparison, synaptosomes from guinea-pig and rat cerebral cortex were preincubated with [3H]5-hydroxytryptamine and superfused with physiological salt solution containing an inhibitor of 5-hydroxytryptamine uptake. The effects of alpha-adrenoceptor agonists and antagonists on the electrically (slices) or potassium-evoked (synaptosomes) tritium overflow were studied. In human cerebral cortical slices, the electrically-evoked [3H] overflow was inhibited by noradrenaline (pIC25 value: 6.35); the non-selective alpha-adrenoceptor antagonist phentolamine, at a concentration of 0.32 mumol/l, strongly antagonized the inhibitory effect of noradrenaline (apparent pA2 value: 8.19) but did not affect the evoked overflow by itself. In synaptosomes from humans, guinea-pigs and rats, noradrenaline also inhibited the K(+)-evoked [3H] overflow in a concentration dependent manner; the alpha 2-adrenoceptor clonidine (1 mumol/l), but not the alpha 1-adrenoceptor agonist methoxamine (1 mumol/l), mimicked the effects of noradrenaline; the effect of noradrenaline (0.3 mumol/l) was abolished by the alpha 2-adrenoceptor antagonist idazoxan (0.5 mumol/l), but not by the alpha 1-adrenoceptor antagonist prazosin (1 mumol/l). It is concluded that release-inhibiting adrenoceptors of the alpha 2-subtype exist on 5-hydroxytryptamine terminals innervating the cerebral cortex in human and guinea-pig brain.

Rat brain cortex slices preincubated with 3H-noradrenaline were superfused with Krebs-Henseleit solution with or without Mg2+. In the absence of Mg2+ ions, NMDA evoked 3H-noradrenaline overflow above basal efflux; this effect was concentration-dependently inhibited by Mg2+ (IC50: 19 mumol/l). Despite the presence of 1.2 mmol/l Mg2+, which is known to block cation influx through the ion channel coupled to the NMDA receptor, NMDA evoked 3H-noradrenaline release if the membrane was permanently kept depolarized by 20 or 25 mmol/l K+, 1 mumol/l veratridine or 200 mumol/1 3,4-diaminopyridine; the stimulant effect of NMDA was counteracted by 2-amino-5-phosphonovaleric acid (2-APV), a competitive antagonist at the NMDA receptor and by (+)-5-methyl-10,11-dihydro-5H-dibenzo(a,d)cyclohept-5,10-imine hydrogen maleate (MK 801), an antagonist acting at the cation channel associated with the NMDA receptor. In contrast, no stimulatory effect of NMDA in the presence of 1.2 mmol/l Mg2+ was observed when the membrane of the nerve terminals was intermittently depolarized by electrical impulses of 2 ms duration at a frequency of 1-3 Hz. It is concluded that continuous depolarization of the nerve membrane counteracts the blocking effect of Mg2+ on cation influx through the NMDA receptor-associated ion channel. Under this condition, noradrenaline release can be stimulated by NMDA receptor activation even in the presence of physiological Mg2+ concentrations.