Search

Background: Deficiency of natural anticoagulant antithrombin was first reported as a genetic risk factor for venous thromboembolism, antithrombin III (AT III) is encoded by the serpin family C member 1 (SERPINC1) gene, consisting of 432 amino acids, including 3 disulfide bonds and 4 possible glycosylation sites. Studies have shown that hereditary AT deficiency increases the incidence of venous thromboembolism by up to 20 times., Case Presentation: The case presented a 27-year-old young man with no acquired risk factors and a sudden onset of right lower extremity venous thrombosis and pulmonary embolism. A heterozygous mutation in gene SERPINC1 of c.1154-14G>A was detected in the patient, which is a deleterious mutation resulting in reduced AT III activity and increased risk of thrombotic events. The patient received anticoagulant therapy for approximately 5 months, and the thrombus gradually dissolved and no recurrent thrombotic events occurred during follow-up., Discussion: AT deficiency is a rare autosomal dominant genetic disease, they are mainly divided into 2 types according to the different effects on the structure or function of the encoded protein. The patient had a mutation in the SERPINC1 gene (c.1154-14G>A). Several cases of this type of mutation have been reported since 1991, and it is classified as AT deficiency type I., Conclusion: Thrombosis in patients with antithrombin deficiency is often unpredictable and can lead to fatal pulmonary embolism. Early genetic testing for hereditary thrombophilia in venous thromboembolism patients without obvious high-risk factors is critical. Long-term anticoagulation treatment is an effective treatment, for this type of type I AT III deficiency combined with pulmonary embolism patients, warfarin is an effective anticoagulant drug., Competing Interests: The authors have no funding and conflicts of interest to disclose., (Copyright © 2024 the Author(s). Published by Wolters Kluwer Health, Inc.)

Rationale: White matter lesions (WMLs) are structural changes in the brain that manifest as demyelination in the central nervous system pathologically. Vasogenic WMLs are the most prevalent type, primarily associated with advanced age and cerebrovascular risk factors. Conversely, immunogenic WMLs, typified by multiple sclerosis (MS), are more frequently observed in younger patients. It is crucial to distinguish between these 2 etiologies. Furthermore, in cases where multiple individuals exhibit WMLs within 1 family, genetic testing may offer a significant diagnostic perspective., Patient Concerns: A 25-year-old male presented to the Department of Neurology with recurrent headaches. He was healthy previously and the neurological examination was negative. Brain magnetic resonance imaging (MRI) showed widespread white matter hyperintensity lesions surrounding the ventricles and subcortical regions on T2-weighted and T2 fluid-attenuated inversion recovery images, mimicking immunogenic disease-MS., Diagnoses: The patient was diagnosed with a patent foramen ovale, which could explain his headache syndrome. Genetic testing unveiled a previously unidentified missense mutation in the SERPINC1 gene in the patient and his father. The specific abnormal laboratory finding was a reduction in antithrombin III activity, and the decrease may serve as the underlying cause for the presence of multiple intracranial WMLs observed in both the patient and his father., Interventions: The patient received percutaneous patent foramen ovale closure surgery and took antiplatelet drug recommended by cardiologists and was followed up for 1 month and 6 months after operation., Outcomes: While the lesions on MRI remain unchanging during follow-up, the patient reported a significant relief in headaches compared to the initial presentation., Lessons: This case introduces a novel perspective on the etiology of cerebral WMLs, suggesting that hereditary antithrombin deficiency (ATD) could contribute to altered blood composition and may serve as an underlying cause in certain individuals with asymptomatic WMLs., Competing Interests: The authors have no conflicts of interest to disclose., (Copyright © 2024 the Author(s). Published by Wolters Kluwer Health, Inc.)

Background: Thrombophilia is a coagulation disorder closely associated with venous thromboembolism. Hereditary antithrombin III (AT III) deficiency is a type of genetic thrombophilia. In China, genetic thrombophilia patients mainly suffer from deficiencies in AT III, protein S, and protein C. Multiple mutations in the serpin family C member 1 (SERPINC1) can affect AT III activity, resulting in thrombosis., Case Presentation: This case presented a 17-year-old adolescent female who developed lower extremity venous thrombosis and subsequently pulmonary embolism (PE) following a right leg injury. A missense mutation in gene SERPINC1 of c.331 T > C, p.S111P was detected on the patient, resulting in a decreased AT III activity and an elevated risk of thrombosis. The patient received anticoagulation treatment for approximately 5 months. During follow-up, the blood clot gradually dissolved, and there have been no recurrent thrombotic events reported thus far., Discussion: Hereditary AT deficiency can be classified into two types based on the plasma levels of the enzymatic activity and antigen. Type I is a quantitative defect, while Type II is a qualitive defect. Until 2021, 486 SERPINC1 gene mutations have been registered, more than 18% of which are point mutations. The SERPINC1 mutation c.331 T > C in was firstly reported in 2017, which was classified into type I AT III deficiency., Conclusion: Hereditary thrombophilia is a coagulation disorder with a high omission diagnostic rate. Minor mutations in the SERPINC1 gene can also lead to hereditary AT III deficiency, which in turn can cause PE. We emphasized the importance of etiological screening for hereditary thrombophilia in venous thromboembolism patients without obvious high-risk factors. Long-term anticoagulation treatment and avoidance of potential thrombosis risk factors are critical for such patients., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 the Author(s). Published by Wolters Kluwer Health, Inc.)

Rationale: Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia., Patient Concerns: A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain., Diagnoses: The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4)., Interventions: An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy., Outcomes: The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed., Lessons: By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD., Competing Interests: The authors have no conflicts of interest to disclose., (Copyright © 2022 the Author(s). Published by Wolters Kluwer Health, Inc.)