Search

Influenza A viruses (FLUAV) cause respiratory diseases in many host species, including humans and pigs. The spillover of FLUAV between swine and humans has been a concern for both public health and the swine industry. With the emergence of the triple reassortant internal gene (TRIG) constellation, establishment of human-origin FLUAVs in pigs has become more common, leading to increased viral diversity. However, little is known about the adaptation processes that are needed for a human-origin FLUAV to transmit and become established in pigs. We generated a reassortant FLUAV (VIC11pTRIG) containing surface gene segments from a human FLUAV strain and internal gene segments from the 2009 pandemic and TRIG FLUAV lineages and demonstrated that it can replicate and transmit in pigs. Sequencing and variant analysis identified three mutants that emerged during replication in pigs, which were mapped near the receptor binding site of the hemagglutinin (HA). The variants replicated more efficiently in differentiated swine tracheal cells compared to the virus containing the wildtype human-origin HA, and one of them was present in all contact pigs. These results show that variants are selected quickly after replication of human-origin HA in pigs, leading to improved fitness in the swine host, likely contributing to transmission. IMPORTANCE Influenza A viruses cause respiratory disease in several species, including humans and pigs. The bidirectional transmission of FLUAV between humans and pigs plays a significant role in the generation of novel viral strains, greatly impacting viral epidemiology. However, little is known about the evolutionary processes that allow human FLUAV to become established in pigs. In this study, we generated reassortant viruses containing human seasonal HA and neuraminidase (NA) on different constellations of internal genes and tested their ability to replicate and transmit in pigs. We demonstrated that a virus containing a common internal gene constellation currently found in U.S. swine was able to transmit efficiently via the respiratory route. We identified a specific amino acid substitution that was fixed in the respiratory contact pigs that was associated with improved replication in primary swine tracheal epithelial cells, suggesting it was crucial for the transmissibility of the human virus in pigs.

People infected with the mosquito-borne Rift Valley fever virus (RVFV) can suffer from eye-related problems resulting in ongoing vision issues or even permanent blindness. Despite ocular disease being the most frequently reported severe outcome, it is vastly understudied compared to other disease outcomes caused by RVFV. Ocular manifestations of RVFV include blurred vision, uveitis, and retinitis. When an infected individual develops macular or paramacular lesions, there is a 50% chance of permanent vision loss in one or both eyes. The cause of blinding ocular pathology remains unknown in part due to the lack of a tractable animal model. Using 3 relevant exposure routes, both subcutaneous (SC) and aerosol inoculation of Sprague Dawley rats led to RVFV infection of the eye. Surprisingly, direct inoculation of the conjunctiva did not result in successful ocular infection. The posterior segment of the eye, including the optic nerve, choroid, ciliary body, and retina, were all positive for RVFV antigen in SC-infected rats, and live virus was isolated from the eyes. Proinflammatory cytokines and increased leukocyte counts were also found in the eyes of infected rats. Additionally, human ocular cell lines were permissive for Lrp1-dependent RVFV infection. This study experimentally defines viral tropism of RVFV in the posterior segment of the rat eye and characterizes virally-mediated ocular inflammation, providing a foundation for evaluation of vaccines and therapeutics to protect against adverse ocular outcomes.

Influenza A virus (IAV) causes respiratory disease in swine and humans. Vaccines are used to prevent influenza illness in both populations but must be frequently updated due to rapidly evolving strains. Mismatch between the circulating strains and the strains contained in vaccines may cause loss of efficacy. Whole inactivated virus (WIV) vaccines with adjuvant, utilized by the swine industry, are effective against antigenically similar viruses; however, vaccine-associated enhanced respiratory disease (VAERD) may happen when the WIV is antigenically mismatched with the infecting virus. VAERD is a repeatable model in pigs, but had yet to be experimentally demonstrated in other mammalian species. We recapitulated VAERD in ferrets, a standard benchmark animal model for studying human influenza infection, in a direct comparison to VAERD in pigs. Both species were vaccinated with WIV with oil-in-water adjuvant containing a δ-1 H1N2 (1B.2.2) derived from the pre-2009 human seasonal lineage, then challenged with a 2009 pandemic H1N1 (H1N1pdm09, 1A.3.3.2) 5 weeks after vaccination. Nonvaccinated and challenged groups showed typical signs of influenza disease, but the mismatched vaccinated and challenged pigs and ferrets showed elevated clinical signs, despite similar viral loads. VAERD-affected pigs exhibited a 2-fold increase in lung lesions, while VAERD-affected ferrets showed a 4-fold increase. Similar to pigs, antibodies from VAERD-affected ferrets preferentially bound to the HA2 domain of the H1N1pdm09 challenge strain. These results indicate that VAERD is not limited to pigs, as demonstrated here in ferrets, and the need to consider VAERD when evaluating new vaccine platforms and strategies. IMPORTANCE We demonstrated the susceptibility of ferrets, a laboratory model species for human influenza A virus research, to vaccine-associated enhanced respiratory disease (VAERD) using an experimental model previously demonstrated in pigs. Ferrets developed clinical characteristics of VAERD very similar to that in pigs. The hemagglutinin (HA) stalk is a potential vaccine target to develop more efficacious, broadly reactive influenza vaccine platforms and strategies. However, non-neutralizing antibodies directed toward a conserved epitope on the HA stalk induced by an oil-in-water, adjuvanted, whole influenza virus vaccine were previously shown in VAERD-affected pigs and were also identified here in VAERD-affected ferrets. The induction of VAERD in ferrets highlights the potential risk of mismatched influenza vaccines for humans and the need to consider VAERD when designing and evaluating vaccine strategies.

Human-to-swine transmission of influenza A virus (IAV) repeatedly occurs, leading to sustained transmission and increased diversity in swine; human seasonal H3N2 introductions occurred in the 1990s and 2010s and were maintained in North American swine. Swine H3N2 strains were subsequently associated with zoonotic infections, highlighting the need to understand the risk of endemic swine IAV to humans. We quantified antigenic distances between swine H3N2 and human seasonal vaccine strains from 1973 to 2014 using a panel of monovalent antisera raised in pigs in hemagglutination inhibition (HI) assays. Swine H3N2 lineages retained the closest antigenic similarity to human vaccine strains from the decade of incursion. Swine lineages from the 1990s were antigenically more similar to human vaccine strains of the mid-1990s but had substantial distance from recent human vaccine strains. In contrast, lineages from the 2010s were closer to human vaccine strains from 2011 and 2014 and the most antigenically distant from human vaccine strains prior to 2007. HI assays using ferret antisera demonstrated that swine lineages from the 1990s and 2010s had significant fold reductions compared to the homologous HI titer of the nearest pandemic preparedness candidate vaccine virus (CVV) or seasonal vaccine strain. The assessment of postinfection and postvaccination human serum cohorts demonstrated limited cross-reactivity to swine H3N2 from the 1990s, especially in older adults born before the 1970s. We identified swine strains to which humans are likely to lack population immunity or are not protected against by a current human seasonal vaccine or CVV to use in prioritizing future human CVV strain selection. IMPORTANCE Human H3N2 influenza A viruses spread to pigs in North America in the 1990s and more recently in the 2010s. These cross-species events led to sustained circulation and increased H3N2 diversity in pig populations. The evolution of H3N2 in swine led to a reduced similarity to human seasonal H3N2 and the vaccine strains used to protect human populations. We quantified the antigenic phenotypes and found that North American swine H3N2 lineages retained more antigenic similarity to historical human vaccine strains from the decade of incursion but had substantial differences compared to recent human vaccine strains. Additionally, pandemic preparedness vaccine strains demonstrated a loss of similarity to contemporary swine strains. Finally, human sera revealed that although these adults had antibodies against human H3N2 strains, many had limited immunity to swine H3N2, especially older adults born before 1970. Antigenic assessment of swine H3N2 provides critical information for pandemic preparedness and candidate vaccine development.

Two separate introductions of human seasonal N2 neuraminidase genes were sustained in United States swine since 1998 (N2-98) and 2002 (N2-02). Herein, we characterized the antigenic evolution of the N2 of swine influenza A virus (IAV) across two decades following each introduction. The N2-98 and N2-02 expanded in genetic diversity, with two statistically supported monophyletic clades within each lineage. To assess antigenic drift in swine N2 following the human-to-swine spillover events, we generated a panel of swine N2 antisera against representative N2 and quantified the antigenic distance between wild-type viruses using enzyme-linked lectin assay and antigenic cartography. The antigenic distance between swine and human N2 was smallest between human N2 circulating at the time of each introduction and the archetypal swine N2. However, sustained circulation and evolution in swine of the two N2 lineages resulted in significant antigenic drift, and the N2-98 and N2-02 swine N2 lineages were antigenically distinct. Although intra-lineage antigenic diversity was observed, the magnitude of antigenic drift did not consistently correlate with the observed genetic differences. These data represent the first quantification of the antigenic diversity of neuraminidase of IAV in swine and demonstrated significant antigenic drift from contemporary human seasonal strains as well as antigenic variation among N2 detected in swine. These data suggest that antigenic mismatch may occur between circulating swine IAV and vaccine strains. Consequently, consideration of the diversity of N2 in swine IAV for vaccine selection may likely result in more effective control, and aid public health initiatives for pandemic preparedness. Importance Antibodies inhibiting the neuraminidase (NA) of influenza A virus (IAV) reduce clinical disease, virus shedding, and transmission, particularly in the absence of neutralizing immunity against the hemagglutinin. To understand antibody recognition of the genetically diverse NA in U.S. swine IAV, we characterized the antigenic diversity of N2 from swine and humans. N2 detected in swine IAV were derived from two distinct human-to-swine spillovers that persisted, are antigenically distinct, and underwent antigenic drift. These findings highlight the need for continued surveillance and vaccine development in swine with increased focus on the NA. Additionally, human seasonal N2 isolated after 2005 were poorly inhibited by representative swine N2 antisera, suggesting a lack of cross-reactive NA antibody mediated immunity between contemporary swine and human N2. Bidirectional transmission between humans and swine represents a One Health challenge, and determining the correlates of immunity to emerging IAV strains is critical to mitigate zoonotic and reverse-zoonotic transmission.

The potential for emerging mosquito-borne viruses to cause fetal infection in pregnant women was overlooked until the Zika fever outbreak several years ago. Rift Valley fever virus (RVFV) is an emerging arbovirus with a long history of fetal infection and death in pregnant livestock. The effect of RVFV infection on pregnant women is not well understood. This Gem examines the effects that this important emerging pathogen has during pregnancy, its potential impact on pregnant women, and the current research efforts designed to understand and mitigate adverse effects of RVFV infection during pregnancy.

Human-to-swine transmission of seasonal influenza viruses has led to sustained human-like influenza viruses circulating in the U.S. swine population. While some reverse zoonotic-origin viruses adapt and become enzootic in swine, nascent reverse zoonoses may result in virus detections that are difficult to classify as “swine-origin” or “human-origin” due to the genetic similarity of circulating viruses. This is the case for human-origin influenza A(H1N1) pandemic 2009 (pdm09) viruses detected in pigs following numerous reverse zoonosis events since the 2009 pandemic. We report the identification of two human infections with A(H1N1)pdm09 viruses originating from swine hosts and classify them as “swine-origin” variant influenza viruses based on phylogenetic analysis and sequence comparison methods. Phylogenetic analyses of viral genomes from two cases revealed these viruses were reassortants containing A(H1N1)pdm09 hemagglutinin (HA) and neuraminidase (NA) genes with genetic combinations derived from the triple reassortant internal gene cassette. Follow-up investigations determined that one individual had direct exposure to swine in the week preceding illness onset, while another did not report swine exposure. The swine-origin A(H1N1) variant cases were resolved by full genome sequence comparison of the variant viruses to swine influenza genomes. However, if reassortment does not result in the acquisition of swine-associated genes and swine virus genomic sequences are not available from the exposure source, future cases may not be discernible. We have developed a pipeline that performs maximum likelihood analyses, a k-mer-based set difference algorithm, and random forest algorithms to identify swine-associated sequences in the hemagglutinin gene to differentiate between human-origin and swine-origin A(H1N1)pdm09 viruses. IMPORTANCE Influenza virus infects a wide range of hosts, resulting in illnesses that vary from asymptomatic cases to severe pneumonia and death. Viral transfer can occur between human and nonhuman hosts, resulting in human and nonhuman origin viruses circulating in novel hosts. In this work, we have identified the first case of a swine-origin influenza A(H1N1)pdm09 virus resulting in a human infection. This shows that these viruses not only circulate in swine hosts, but are continuing to evolve and distinguish themselves from previously circulating human-origin influenza viruses. The development of techniques for distinguishing human-origin and swine-origin viruses are necessary for the continued surveillance of influenza viruses. We show that unique genetic signatures can differentiate circulating swine-associated strains from circulating human-associated strains of influenza A(H1N1)pdm09, and these signatures can be used to enhance surveillance of swine-origin influenza.

The diversity of influenza A viruses in swine (swIAVs) presents an important pandemic threat. Knowledge of the human-swine interface is particularly important for understanding how viruses with pandemic potential evolve in swine hosts. Through phylogenetic analysis of contemporary swIAVs in the United States, we demonstrate that human-to-swine transmission of pandemic H1N1 (pH1N1) viruses has occurred continuously in the years following the 2009 H1N1 pandemic and has been an important contributor to the genetic diversity of U.S. swIAVs. Although pandemic H1 and N1 segments had been largely removed from the U.S. swine population by 2013 via reassortment with other swIAVs, these antigens reemerged following multiple human-to-swine transmission events during the 2013-2014 seasonal epidemic. These findings indicate that the six internal gene segments from pH1N1 viruses are likely to be sustained long term in the U.S. swine population, with periodic reemergence of pandemic hemagglutinin (HA) and neuraminidase (NA) segments in association with seasonal pH1N1 epidemics in humans. Vaccinating U.S. swine workers may reduce infection of both humans and swine and in turn limit the role of humans as sources of influenza virus diversity in pigs. IMPORTANCE Swine are important hosts in the evolution of influenza A viruses with pandemic potential. Here, we analyze influenza virus sequence data generated by the U.S. Department of Agriculture's national surveillance system to identify the central role of humans in the reemergence of pandemic H1N1 (pH1N1) influenza viruses in U.S. swine herds in 2014. These findings emphasize the important role of humans as continuous sources of influenza virus diversity in swine and indicate that influenza viruses with pandemic HA and NA segments are likely to continue to reemerge in U.S. swine in association with seasonal pH1N1 epidemics in humans.

Translation of influenza A virus PB1-F2 occurs in a second open reading frame (ORF) of the PB1 gene segment. PB1-F2 has been implicated in regulation of polymerase activity, immunopathology, susceptibility to secondary bacterial infection, and induction of apoptosis. Experimental evidence of PB1-F2 molecular function during infection has been collected primarily from human and avian viral isolates. As the 2009 H1N1 (H1N1pdm09) strain highlighted, some swine-derived influenza viruses have the capacity to infect human hosts and emerge as a pandemic. Understanding the impact that virulence factors from swine isolates have on both human and swine health could aid in early identification of viruses with pandemic potential. Studies examining PB1-F2 from swine isolates have focused primarily on H1N1pdm09, which does not encode PB1-F2 but was engineered to carry a full-length PB1-F2 ORF to assess the impact on viral replication and pathogenicity. However, experimental evidence of PB1-F2 protein expression from swine lineage viruses has not been demonstrated. Here, we reveal that during infection, PB1-F2 expression levels are substantially different in swine and human influenza viruses. We provide evidence that PB1-F2 expression is regulated at the translational level, with very low levels of PB1-F2 expression from swine lineage viruses relative to a human isolate PB1-F2. Translational regulation of PB1-F2 expression was partially mapped to two independent regions within the PB1 mRNA, located downstream of the PB1-F2 start site. Our data suggest that carrying a full-length PB1-F2 ORF may not be predictive of PB1-F2 expression in infected cells for all influenza A viruses.

Novel H3N2 influenza viruses (H3N2v) containing seven genome segments from swine lineage triple-reassortant H3N2 viruses and a 2009 pandemic H1N1 (H1N1pdm09) matrix protein segment (pM) were isolated from 12 humans in the United States between August and December 2011. To understand the evolution of these novel H3N2 viruses in swine and humans, we undertook a phylogenetic analysis of 674 M sequences and 388 HA and NA sequences from influenza viruses isolated from North American swine during 2009–2011, as well as HA, NA, and M sequences from eight H3N2v viruses isolated from humans. We identified 34 swine influenza viruses (termed rH3N2p) with the same combination of H3, N2, and pM segments as the H3N2v viruses isolated from humans. Notably, these rH3N2p viruses were generated in swine via reassortment events between H3N2 viruses and the pM segment approximately 4 to 10 times since 2009. The pM segment has also reassorted with multiple distinct lineages of H1 virus, especially H1δ viruses. Importantly, the N2 segment of all H3N2v viruses isolated from humans is derived from a genetically distinct N2 lineage that has circulated in swine since being acquired by reassortment with seasonal human H3N2 viruses in 2001–2002, rather than from the N2 that is associated with the 1998 H3N2 swine lineage. The identification of this N2 variant may have implications for influenza vaccine design and the potential pandemic threat of H3N2v to human age groups with differing levels of prior exposure and immunity.

During the last decade, more than half of humans infected with highly pathogenic avian influenza (HPAI) H5N1 viruses have died, yet virus-induced host signaling has yet to be clearly elucidated. Airway epithelia are known to produce inflammatory mediators that contribute to HPAI H5N1-mediated pathogenicity, but a comprehensive analysis of the host response in this cell type is lacking. Here, we leveraged a system approach to identify and statistically validate signaling subnetworks that define the dynamic transcriptional response of human bronchial epithelial cells after infection with influenza A/Vietnam/1203/2004 (H5N1, VN1203). Importantly, we validated a subset of transcripts from one subnetwork in both Calu-3 cells and mice. A more detailed examination of two subnetworks involved in the immune response and keratinization processes revealed potential novel mediators of HPAI H5N1 pathogenesis and host response signaling. Finally, we show how these results compare to those for a less virulent strain of influenza virus. Using emergent network properties, we provide fresh insight into the host response to HPAI H5N1 virus infection and identify novel avenues for perturbation studies and potential therapeutic interventions for fatal HPAI H5N1 disease.

We previously reported that the cellular protein ZEB1 can repress expression of the Epstein-Barr virus (EBV) BZLF1 gene in transient transfection assays by directly binding its promoter, Zp. We also reported that EBV containing a 2-bp substitution mutation in the ZEB-binding ZV element of Zp spontaneously reactivated out of latency into lytic replication at a higher frequency than did wild-type EBV. Here, using small interfering RNA (siRNA) and short hairpin RNA (shRNA) technologies, we definitively show that ZEB1 is, indeed, a key player in maintaining EBV latency in some epithelial and B-lymphocytic cell lines. However, in other EBV-positive epithelial and B-cell lines, another zinc finger E-box-binding protein, ZEB2/SIP1, is the key player. Both ZEB1 and ZEB2 can bind Zp via the ZV element. In EBV-positive cells containing only ZEB1, knockdown of ZEB1 led to viral reactivation out of latency, with synthesis of EBV immediate-early and early lytic gene products. However, in EBV-positive cells containing both ZEBs, ZEB2, not ZEB1, was the primary ZEB family member bound to Zp. Knockdown of ZEB2, but not ZEB1, led to EBV lytic reactivation. Thus, we conclude that either ZEB1 or ZEB2 can play a central role in the maintenance of EBV latency, doing so in a cell-type-dependent manner.

Herpes simplex virus (HSV) contains more than 40 different virally encoded proteins that are found in three distinct layers: the capsid containing the viral DNA, the host-derived lipid envelope with embedded glycoproteins, and the tegument, an assortment of proteins located between the nucleocapsid and the envelope (22). While these regions are often discussed as separate structures, there is now clear evidence that the virion as a whole is a machine with interconnected parts that quickly rearrange on the inside in response to glycoprotein-binding events on the outside. Specifically, tegument protein UL16 is triggered to be released from the capsid when HSV attaches to host cells prior to membrane fusion, and the signal responsible for this can be sent in a cell-free manner by binding virions to immobilized heparin (21). It appears that glycoprotein C is involved in transmitting the signal (at least in a cell-free system), but all the other molecular “cogs” that drive this part of the HSV machine are unknown. To identify these components, we have been investigating UL16 and the network of molecular interactions in which it participates. Our interest in UL16 began when we identified it as a binding partner of UL11 (17), a small tegument protein (only 96 amino acids) that is conserved among all herpesviruses. UL11 is peripherally bound to membranes via two fatty acids, myristate and palmitate (16), and trafficks through lipid raft domains (6, 12). It accumulates at the trans-Golgi network (TGN), where virus budding takes place (16, 30), and mutants that lack UL11 are defective for the production of virions, resulting in an increased number of unenveloped capsids in the cytoplasm (5, 9, 19). The UL11-UL16 interaction has since been confirmed by other groups (15, 37), and more recently, we have found that the interaction is direct and requires free cysteines present within UL16 (41). That is, chemical modification of free cysteines in UL16 with N-ethylmaleimide (NEM) blocks the interaction with UL11. On the UL11 side of the interaction, LI and acidic cluster motifs are needed for binding (17, 41). UL16 is a 373-amino-acid protein that is also conserved among herpesviruses and exhibits dynamic capsid-binding properties. Although it is found in both the cytoplasm and the nucleus of the infected cell, it is only stably associated with capsids isolated from the cytoplasm (20, 24, 26). This finding, combined with the ability of UL11 to accumulate at the site of budding, led us to hypothesize that the UL11-UL16 interaction provides a bridging function to assist the capsid in acquiring its envelope (17). However, sometime after budding—as the virus egresses from the cell—the interaction of UL16 with the capsid is destabilized (20). And, as mentioned earlier, binding of the virion to its attachment receptors on the host cell surface (heparan sulfate) further disrupts the association of UL16 with the capsid (21). Free cysteines appear to play a critical role in this outside-in signaling event, because treatment of extracellular virions with NEM prior to cell binding prevents the release of UL16 from the capsid (21). While UL16 was the most abundant protein pulled out of infected cell lysates in our search for UL11 binding partners, a much less prominent, but highly reproducible, ∼65-kDa species was also observed (17). Like UL16, this unknown protein was absent when either the LI or acidic cluster motifs were eliminated from the glutathione S-transferase (GST)-UL11 construct used in the experiment. This suggested that the unknown protein was obtained by either (i) competing with UL16 for binding to the same motifs within UL11 or (ii) binding to UL11 indirectly through an interaction with UL16. Because the LI and acidic cluster motifs of UL11 are recognized by host proteins for trafficking through lipid rafts (6, 16), the first hypothesis seemed likely; however, because UL16 participates in a complex signaling pathway within the virion, it was possible that the unknown protein would be a virus-encoded component. The purpose of the experiments described in this report was to identify this unknown protein and to determine how it fits into the UL16 network of interactions.

Rift Valley fever (RVF) virus historically has caused widespread and extensive outbreaks of severe human and livestock disease throughout Africa, Madagascar, and the Arabian Peninsula. Following unusually heavy rainfall during the late autumn of 2006, reports of human and animal illness consistent with RVF virus infection emerged across semiarid regions of the Garissa District of northeastern Kenya and southern Somalia. Following initial RVF virus laboratory confirmation, a high-throughput RVF diagnostic facility was established at the Kenyan Central Veterinary Laboratories in Kabete, Kenya, to support the real-time identification of infected livestock and to facilitate outbreak response and control activities. A total of 3,250 specimens from a variety of animal species, including domesticated livestock (cattle, sheep, goats, and camels) and wildlife collected from a total of 55 of 71 Kenyan administrative districts, were tested by molecular and serologic assays. Evidence of RVF infection was found in 9.2% of animals tested and across 23 districts of Kenya, reflecting the large number of affected livestock and the geographic extent of the outbreak. The complete S, M, and/or L genome segment sequence was obtained from a total of 31 RVF virus specimens spanning the entire known outbreak period (December-May) and geographic areas affected by RVF virus activity. Extensive genomic analyses demonstrated the concurrent circulation of multiple virus lineages, gene segment reassortment, and the common ancestry of the 2006/2007 outbreak viruses with those from the 1997-1998 east African RVF outbreak. Evidence of recent increases in genomic diversity and effective population size 2 to 4 years prior to the 2006-2007 outbreak also was found, indicating ongoing RVF virus activity and evolution during the interepizootic/epidemic period. These findings have implications for further studies of basic RVF virus ecology and the design of future surveillance/diagnostic activities, and they highlight the critical need for safe and effective vaccines and antiviral compounds to combat this significant veterinary and public health threat.

The VP35 protein of Zaire Ebola virus is an essential component of the viral RNA polymerase complex and also functions to antagonize the cellular type I interferon (IFN) response by blocking activation of the transcription factor IRF-3. We previously mapped the IRF-3 inhibitory domain within the C terminus of VP35. In the present study, we show that mutations that disrupt the IRF-3 inhibitory function of VP35 do not disrupt viral transcription/replication, suggesting that the two functions of VP35 are separable. Second, using reverse genetics, we successfully recovered recombinant Ebola viruses containing mutations within the IRF-3 inhibitory domain. Importantly, we show that the recombinant viruses were attenuated for growth in cell culture and that they activated IRF-3 and IRF-3-inducible gene expression at levels higher than that for Ebola virus containing wild-type VP35. In the context of Ebola virus pathogenesis, VP35 may function to limit early IFN-β production and other antiviral signals generated from cells at the primary site of infection, thereby slowing down the host's ability to curb virus replication and induce adaptive immunity.

Integration of a DNA copy of the retroviral genome into cellular DNA is a critical step in the retrovirus life cycle and in the pathogenesis of retrovirus infections. Formation of an integrated provirus requires that the viral integrase act on its two DNA substrates with different levels of specificity. When preparing the viral DNA for integration, two nucleotides that follow conserved CA bases at the 3′ ends of each DNA strand are removed by integrase; this site-specific endonuclease reaction is referred to as processing. In contrast, integrase can insert the processed viral DNA ends into almost any site in cellular DNA; this second endonuclease reaction is referred to as DNA joining or strand transfer. Both of these actions can be modeled in vitro by using purified integrase and oligonucleotides that represent the viral DNA ends (Fig. ​(Fig.1A1A and B) (8, 17, 20). Although any accessible site in nonviral DNA can be used as the target for viral DNA insertion, preferences are noted in vitro and in vivo (7, 19, 32, 33, 39, 43). Characteristics of cellular DNA that affect the susceptibility of target sites were reviewed recently (6, 16, 19). For example, integration preferentially occurs into phosphodiester bonds at areas of DNA distortion on the outside of DNA bends; DNA sequence might play an additional minor role in susceptibility. Understanding how integrase recognizes these features of cellular DNA and identifying the part or parts of integrase responsible for any selectivity in choosing target sites are important for modeling integration, for developing methods of targeted gene delivery that are based on retroviral integration, and for designing a new class of antiretroviral agents that interfere with these enzyme-substrate interactions. FIG. 1. Integrase assays. The names of the assays are shown above the horizontal arrows, and the key aspects of the readouts (e.g., the position of the radiolabel or the pairing of PCR primers) are shown below the arrows. The CA bases near the 3′ ends ... Studies using chimeric integrases involving human immunodeficiency virus type 1 (HIV-1), feline immunodeficiency virus, and visna virus indicate that the central domain of integrase plays a major role in selecting the target sites for insertion of viral DNA ends. This conclusion was based on results obtained with the standard oligonucleotide joining assay (Fig. ​(Fig.1B)1B) (24) as well as with a PCR-based assay that monitors insertion of viral DNA ends into a longer plasmid DNA target (Fig. ​(Fig.1C)1C) (2, 12, 25, 38). Moreover, the central domain of integrase was solely responsible for the selection of nonviral target sites when chimeric integrases used exogenous alcohols, rather than processed viral DNA ends, as the nucleophilic donor for nicking nonviral DNA (Fig. ​(Fig.1D)1D) (22, 24, 25). In fact, the isolated central fragment of HIV-1 integrase (from residues 50 to 186) exhibited the same target site preferences in this nonspecific alcoholysis assay, which has many similarities to the joining reaction (25), as did the full-length 288-amino-acid HIV-1 protein. Thus, this region of approximately 140 amino acids is capable of binding and positioning nonviral DNA for nucleophilic attack. Within the central domain of integrase, many amino acids can be replaced without affecting target site preferences (2, 13). However, we recently identified residue 119, the second amino acid in the α2 helix in the central domain of HIV-1 integrase, as strongly affecting the choice of nonviral target DNA sites (13). This residue was identified by a novel approach that involved screening a large set of patient-derived HIV-1 integrase variants for alterations in nonviral target site selection, comparing the sequences of proteins that exhibited similar target site preferences, and using this information to guide mutagenesis of a laboratory HIV-1 integrase (13). In fact, HIV-1 integrases with any of five different amino acids (Ser, Thr, Gly, Ala, or Lys) at position 119 exhibited five different patterns of target site selection in nonviral DNA. To test the hypothesis that these results are generalizable to other retroviral integrases, we have now assessed the role of the analogous protein residue in the integrases from a nonprimate lentivirus (visna virus) and a more distantly related alpharetrovirus (Rous sarcoma virus [RSV], formerly classified in the Oncovirinae retrovirus subfamily). Because the preferred sites of viral DNA insertion can differ depending on whether Mn2+ or Mg2+ is present during reactions (13), it was important that each of these divalent metal cations be used for these analyses. To introduce amino acid substitutions into integrase, we used the QuikChange site-directed mutagenesis system (Stratagene, La Jolla, Calif.) with pQE-30 plasmids (Qiagen, Chatsworth, Calif.) that encoded the wild-type integrases, as described previously (13, 41). The entire integrase-coding region for all proteins was confirmed by DNA sequencing, and proteins were purified from M15[pREP4] bacteria (Qiagen) (13). The purified proteins were tested under conditions known to optimize activity for visna virus and RSV integrase, including the use of oligonucleotides derived from the U3 end of viral DNA (21, 22, 42). Conditions for the standard oligonucleotide-based assays (Fig. 1A, B, and D) were as described previously (13) but included either 10 mM Mn2+ or 5 mM Mg2+. In the case of visna virus integrase and its derivatives, reactions that included Mg2+ were supplemented with 30% dimethyl sulfoxide (DMSO) because of our previous demonstration that this maneuver enhances the Mg2+-dependent activity of visna virus integrase (31). For the plasmid insertion assays (Fig. ​(Fig.1C)1C) (26, 34), double-stranded 30/32-mers representing the preprocessed U3 end of viral DNA were incubated under the same reaction conditions but in the presence of 0.5 μg of φX174 DNA (Invitrogen, Carlsbad, Calif.) that had been linearized with SstII. The insertion reactions were stopped by fivefold dilution into 40 μl of 10 mM Tris-HCl (pH 8.0)-1 mM EDTA, and 7 μl was transferred to a tube for PCR. PCR was conducted in 25-μl reaction mixtures that contained 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 0.2 or 0.4 mM each deoxynucleoside triphosphate, 2 mM MgCl2, 1 U of Taq polymerase (Fisher, Pittsburgh, Pa.), and 15 pmol each of primer P1, which matched the viral donor DNA strand (for visna virus, 5′CAGGGTAGGCATTTGTTCTCTGTCCTGACA3′; for RSV, 5′AAGACTACAAGAGTATTGCATAAGACTACA3′), and primer P2, which was derived from φX174 (5′GGCGACCATTCAAAGGATAAACAT3′). The reaction mixtures underwent 35 cycles at 95°C for 45 s and 65°C for 3 min, with a final extension at 72°C for 10 min. Subsequently, 3 μl of each PCR was transferred to a 10-ul nested runoff reaction that contained 0.24 pmol of 5′ 32P-labeled φX174 primer P3 (5′GGCAGTCGGGAGGGTAGTCGG3′) and 1 U of Taq polymerase under the same buffer conditions as for PCR but for one cycle of 95°C for 2.5 min, 55°C for 4 min, and 72°C for 20 min. All reactions were analyzed by autoradiography after electrophoresis on denaturing polyacrylamide gels (20% gels for the processing, joining, and alcoholysis assays and 6% gels for the PCR-based insertion assay).

The capacity of influenza A viruses to cross species barriers presents a continual threat to human and animal health. Knowledge of the human-swine interface is particularly important for understanding how viruses with pandemic potential evolve in swine hosts. We sequenced the genomes of 141 influenza viruses collected from North American swine during 2002 to 2011 and identified a swine virus that possessed all eight genome segments of human seasonal A/H3N2 virus origin. A molecular clock analysis indicates that this virus—A/sw/Saskatchewan/02903/2009(H3N2)—has likely circulated undetected in swine for at least 7 years. For historical context, we performed a comprehensive phylogenetic analysis of an additional 1,404 whole-genome sequences from swine influenza A viruses collected globally during 1931 to 2013. Human-to-swine transmission occurred frequently over this time period, with 20 discrete introductions of human seasonal influenza A viruses showing sustained onward transmission in swine for at least 1 year since 1965. Notably, human-origin hemagglutinin (H1 and H3) and neuraminidase (particularly N2) segments were detected in swine at a much higher rate than the six internal gene segments, suggesting an association between the acquisition of swine-origin internal genes via reassortment and the adaptation of human influenza viruses to new swine hosts. Further understanding of the fitness constraints on the adaptation of human viruses to swine, and vice versa, at a genomic level is central to understanding the complex multihost ecology of influenza and the disease threats that swine and humans pose to each other. IMPORTANCE The swine origin of the 2009 A/H1N1 pandemic virus underscored the importance of understanding how influenza A virus evolves in these animals hosts. While the importance of reassortment in generating genetically diverse influenza viruses in swine is well documented, the role of human-to-swine transmission has not been as intensively studied. Through a large-scale sequencing effort, we identified a novel influenza virus of wholly human origin that has been circulating undetected in swine for at least 7 years. In addition, we demonstrate that human-to-swine transmission has occurred frequently on a global scale over the past decades but that there is little persistence of human virus internal gene segments in swine.

IE62, the major transcriptional regulatory protein encoded by varicella-zoster virus (VZV), is associated with the tegument of gradient-purified virions. Here, we show that most, if not all, of the association requires the expression of open reading frame 66 (ORF66), a protein kinase. The association of IE62 with wild-type VZV virions was confirmed using immunoelectron microscopy with IE62-specific antibodies, which reacted with virions in ultrathin sections of VZV-infected cells. Fractionated purified virions from cells infected with recombinant VZV ROka contained substantial levels of the 175-kDa virion IE62 protein and also contained the ORF66 protein. However, virions from cells infected with recombinant VZV ROka66S, in which ORF66 is disrupted, lacked not only the ORF66 protein but also most of the virion 175-kDa IE62 polypeptide. The virion-associated protein kinase activity was still present in ROka66S virions, although the 175-kDa protein substrate for the virion kinase was absent, implying that the virion protein kinase is encoded by genes other than ORF66. The very low levels of IE62 in ROka66S virions indicate that ORF66 protein mediates the redistribution of IE62 to sites of tegument assembly. IE62 was resolved into several species from VZV-infected cells which showed mobility differences between ROka and ROka66S, and a specific form of IE62 was detected in ROka virions. These results are consistent with a role for the ORF66-mediated phosphorylation of IE62 that results in cytoplasmic distribution of the regulatory protein for tegument inclusion. They support a model in which VZV tegument acquisition occurs in the cytoplasm. As such, two unusual features of VZV IE62, namely, its virion inclusion and its phosphorylation and nuclear exclusion by the ORF66 protein kinase, are functionally linked.

To identify parts of retroviral integrase that interact with cellular DNA, we tested patient-derived human immunodeficiency virus type 1 (HIV-1) integrases for alterations in the choice of nonviral target DNA sites. This strategy took advantage of the genetic diversity of HIV-1, which provided 75 integrase variants that differed by a small number of amino acids. Moreover, our hypothesis that biological pressures on the choice of nonviral sites would be minimal was validated when most of the proteins that catalyzed DNA joining exhibited altered target site preferences. Comparison of the sequences of proteins with the same preferences then guided mutagenesis of a laboratory integrase. The results showed that single amino acid substitutions at one particular residue yielded the same target site patterns as naturally occurring integrases that included these substitutions. Similar results were found with DNA joining reactions conducted with Mn 2+ or with Mg 2+ and were confirmed with a nonspecific alcoholysis assay. Other amino acid changes at this position also affected target site preferences. Thus, this novel approach has identified a residue in the central domain of HIV-1 integrase that interacts with or influences interactions with cellular DNA. The data also support a model in which integrase has distinct sites for viral and cellular DNA.

A polymorphism in the gene encoding CCR2 is associated with a delay in progression to AIDS in human immunodeficiency virus (HIV)-infected individuals. The polymorphism, CCR2 -64I, changes valine 64 of CCR2 to isoleucine. However, it is not clear whether the effect on AIDS progression results from the amino acid change or whether the polymorphism marks a genetically linked, yet unidentified mutation that mediates the effect. Because the gene encoding CCR5, the major coreceptor for HIV type 1 primary isolates, lies 15 kb 3′ to CCR2 , linked mutations in the CCR5 promoter or other regulatory sequences could explain the association of CCR2 -64I with slowed AIDS pathogenesis. Here, we show that CCR2 -64I is efficiently expressed on the cell surface but does not have dominant negative activity on CCR5 coreceptor function. A panel of peripheral blood mononuclear cells (PBMC) from uninfected donors representing the various CCR5/CCR2 genotypes was assembled. Activated primary CD4 + T cells of CCR2 64I/64I donors expressed cell surface CCR5 at levels comparable to those of CCR2 +/+ donors. A slight reduction in CCR5 expression was noted, although this was not statistically significant. CCR5 and CCR2 mRNA levels were nearly identical for each of the donor PBMC, regardless of genotype. Cell surface CCR5 and CCR2 levels were more variable than mRNA transcript levels, suggesting that an alternative mechanism may influence CCR5 cell surface levels. CCR2 -64I is linked to the CCR5 promoter polymorphisms 208G, 303A, 627C, and 676A; however, in transfected promoter reporter constructs, these did not affect transcriptional activity. Taken together, these findings suggest that CCR2 -64I does not act by influencing CCR5 transcription or mRNA levels.

On 11 June 2009, the World Health Organization (WHO) declared that the outbreaks caused by novel swine-origin influenza A (H1N1) virus had reached pandemic proportions. The pandemic H1N1 (H1N1pdm) virus is the predominant influenza virus strain in the human population. It has also crossed the species barriers and infected turkeys and swine in several countries. Thus, the development of a vaccine that is effective in multiple animal species is urgently needed. We have previously demonstrated that the introduction of temperature-sensitive mutations into the PB2 and PB1 genes of an avian H9N2 virus, combined with the insertion of a hemagglutinin (HA) tag in PB1, resulted in an attenuated ( att ) vaccine backbone for both chickens and mice. Because the new pandemic strain is a triple-reassortant (TR) virus, we chose to introduce the double attenuating modifications into a swine-like TR virus isolate, A/turkey/OH/313053/04 (H3N2) (ty/04), with the goal of producing live attenuated influenza vaccines (LAIV). This genetically modified backbone had impaired polymerase activity and restricted virus growth at elevated temperatures. In vivo characterization of two H1N1 vaccine candidates generated using the ty/04 att backbone demonstrated that this vaccine is highly attenuated in mice, as indicated by the absence of signs of disease, limited replication, and minimum histopathological alterations in the respiratory tract. A single immunization with the ty/04 att -based vaccines conferred complete protection against a lethal H1N1pdm virus infection in mice. More importantly, vaccination of pigs with a ty/04 att -H1N1 vaccine candidate resulted in sterilizing immunity upon an aggressive intratracheal challenge with the 2009 H1N1 pandemic virus. Our studies highlight the safety of the ty/04 att vaccine platform and its potential as a master donor strain for the generation of live attenuated vaccines for humans and livestock.

We previously showed that the cellular proteins ZEB1 and ZEB2/SIP1 both play key roles in regulating the latent-lytic switch of Epstein-Barr Virus (EBV) by repressing BZLF1 gene expression. We investigated here the effects of cellular microRNA (miRNA) 200 (miR200) family members on the EBV infection status of cells. We show that miR200b and miR429, but not miR200a, can induce EBV-positive cells into lytic replication by downregulating expression of ZEB1 and ZEB2, leading to production of infectious virus. The levels of miR200 family members in EBV-infected cells strongly negatively correlated with the levels of the ZEBs (e.g., −0.89 [ P < 0.001] for miR429 versus ZEB1) and positively correlated with the degree of EBV lytic gene expression (e.g., 0.73 [ P < 0.01] for miR429 versus BZLF1). The addition of either miR200b or miR429 to EBV-positive cells led to EBV lytic reactivation in a ZEB-dependent manner; inhibition of these miRNAs led to decreased EBV lytic gene expression. The degree of latent infection by an EBV mutant defective in the primary ZEB-binding site of the EBV BZLF1 promoter was not affected by the addition of these miRNAs. Furthermore, EBV infection of primary blood B cells led to downregulation of these miRNAs and upregulation of ZEB levels. Thus, we conclude that miRNAs 200b and 429 are key regulators via their effects on expression of ZEB1 and ZEB2 of the switch between latent and lytic infection by EBV and, therefore, potential targets for development of new lytic induction therapeutics with which to treat patients with EBV-associated malignancies.

Ebola hemorrhagic fever is a rapidly progressing acute febrile illness characterized by high virus replication, severe immunosuppression, and case fatalities of ca. 80%. Inhibition of phosphorylation of interferon regulatory factor 3 (IRF-3) by the Ebola VP35 protein may block the host innate immune response and play an important role in the severity of disease. We used two precisely defined reverse genetics-generated Ebola viruses to investigate global host cell responses resulting from the inhibition of IRF-3 phosphorylation. The two viruses encoded either wild-type (WT) VP35 protein (recEbo-VP35/WT) or VP35 with an arginine (R)-to-alanine (A) amino acid substitution at position 312 (recEbo-VP35/R312A) within a previously defined IRF-3 inhibitory domain. When sucrose-gradient purified virus was used for infection, host cell whole-genome expression profiling revealed striking differences in human liver cell responses to these viruses differing by a single amino acid. The inhibition of host innate immune responses by WT Ebola virus was so potent that little difference in interferon and antiviral gene expression could be discerned between cells infected with purified WT, inactivated virus, or mock-infected cells. However, infection with recEbo-VP35/R312A virus resulted in a strong innate immune response including increased expression of MDA-5, RIG-I, RANTES, MCP-1, ISG-15, ISG-54, ISG-56, ISG-60, STAT1, IRF-9, OAS, and Mx1. The clear gene expression differences were obscured if unpurified virus stocks were used to initiate infection, presumably due to soluble factors present in virus-infected cell supernatant preparations. Ebola virus VP35 protein clearly plays a pivotal role in the potent inhibition of the host innate immune responses, and the present study indicates that VP35 has a wider effect on host cell responses than previously shown. The ability to eliminate this inhibitory effect with a single amino acid change in VP35 demonstrates the critical role this protein must play in the severe aspects this highly fatal disease.

Epstein-Barr virus (EBV) is a human herpesvirus that causes infectious mononucleosis and is associated with several types of cancers, including nasopharyngeal carcinoma and Burkitt's lymphoma. An EBV protein that plays an integral role during lytic replication is the immediate-early protein BZLF1. Our laboratory has found that BZLF1 (Z) localizes to host chromosomes during mitosis. Two Z-interacting proteins are also found localized to mitotic chromosomes in the presence of Z. The association between Z and mitotic chromosomes may lead to the sequestering of Z-interacting proteins within the cell and potentially cause an alteration of chromosome compaction or chromatin structure.

Although the immediate-early proteins of both herpes simplex virus (HSV) and cytomegalovirus (CMV) are known to modify promyelocytic leukemia (PML) (ND10) bodies in the nucleus of the host cell, it has been unclear whether lytic infection with gamma herpesviruses induces a similar effect. The PML protein is induced by interferon, involved in major histocompatibility complex class I presentation, and necessary for certain types of apoptosis. Therefore, it is likely that PML bodies function in an antiviral capacity. SUMO-1 modification of PML is known to be required for the formation of PML bodies. To examine whether Epstein-Barr virus (EBV) lytic replication interferes with PML bodies, we expressed the EBV immediate-early genes BZLF1 (Z) and BRLF1 (R) in EBV-positive cell lines and examined PML localization. Both Z and R expression resulted in PML dispersion in EBV-positive cells. Z but not R expression is sufficient to disrupt PML bodies in EBV-negative cell lines. We show that dispersion of PML bodies by Z requires a portion of the transcriptional activation domain of Z but not the DNA-binding function. As was previously reported for the HSV-1 ICP0 and CMV IE1 proteins, Z reduces the amount of SUMO-1-modified PML. We also found that Z itself is SUMO-1 modified (through amino acid 12) and that Z competes with PML for limiting amounts of SUMO-1. These results suggest that disruption of PML bodies is important for efficient lytic replication of EBV. Furthermore, Z may potentially alter the function of a variety of cellular proteins by inhibiting SUMO-1 modification.

Expression of either Epstein-Barr virus (EBV) immediate-early protein BZLF1 (Z) or BRLF1 (R) is sufficient to convert EBV infection from the latent to lytic form. Disruption of viral latency requires transcriptional activation of the Z and R promoters. The Z and R proteins are transcriptional activators, and each immediate-early protein activates expression of the other immediate-early protein. Z activates the R promoter through a direct binding mechanism. However, R does not bind directly to the Z promoter. In this study, we demonstrate that the ZII element (a cyclic AMP response element site) in the Z promoter is required for efficient activation by R. The ZII element has been shown to be important for induction of lytic EBV infection by tetradecanoyl phorbol acetate and surface immunoglobulin cross-linking and is activated by Z through an indirect mechanism. We demonstrate that both R and Z activate the cellular stress mitogen-activated protein (MAP) kinases, p38 and JNK, resulting in phosphorylation (and activation) of the cellular transcription factor ATF2. Furthermore, we show that the ability of R to induce lytic EBV infection in latently infected cells is significantly reduced by inhibition of either the p38 kinase or JNK pathways. In contrast, inhibition of stress MAP kinase pathways does not impair the ability of Z expression vectors to disrupt viral latency, presumably because expression of Z under the control of a strong heterologous promoter bypasses the need to activate Z transcription. Thus, both R and Z can activate the Z promoter indirectly by inducing ATF2 phosphorylation, and this activity appears to be important for R-induced disruption of viral latency.