Search

The IL-15 superagonist N-803 has been shown to enhance the function of CD8 T cells and NK cells. We previously found that in a subset of vaccinated, ART-naive, SIV(+) rhesus macaques, N-803 treatment led to a rapid but transient decline in plasma viremia that positively correlated with an increase in the frequency of CD8 T cells. Here, we tested the hypothesis that prophylactic vaccination was required for the N-803 mediated suppression of SIV plasma viremia. We either vaccinated rhesus macaques with a DNA prime/Ad5 boost regimen using vectors expressing SIVmac239 gag with or without a plasmid expressing IL-12 or left them unvaccinated. The animals were then intravenously infected with SIVmac239M. 6 months after infection, the animals were treated with N-803. We found no differences in the control of plasma viremia during N-803 treatment between vaccinated and unvaccinated macaques. Interestingly, when we divided the SIV(+) animals based on their plasma viral load set-points prior to the N-803 treatment, N-803 increased the frequency of SIV-specific T cells expressing ki-67(+) and granzyme B(+) in animals with low plasma viremia (10(4) copies/mL; SIV noncontrollers). In addition, Gag-specific CD8 T cells from the SIV(+) controllers had a greater increase in CD8(+)CD107a(+) T cells in ex vivo functional assays than did the SIV(+) noncontrollers. Overall, our results indicate that N-803 is most effective in SIV(+) animals with a preexisting immunological ability to control SIV replication. IMPORTANCE N-803 is a drug that boosts the immune cells involved in combating HIV/SIV infection. Here, we found that in SIV(+) rhesus macaques that were not on antiretroviral therapy, N-803 increased the proliferation and potential capacity for killing of the SIV-specific immune cells to a greater degree in animals that spontaneously controlled SIV than in animals that did not control SIV. Understanding the mechanism of how N-803 might function differently in individuals that control HIV/SIV (for example, individuals on antiretroviral therapy or spontaneous controllers) compared to settings where HIV/SIV are not controlled, could impact the efficacy of N-803 utilization in the field of HIV cure.

Vaccine strategies aimed at eliciting human immunodeficiency virus (HIV)-specific CD8(+) T cells are one major target of interest in HIV functional cure strategies. We hypothesized that CD8(+) T cells elicited by therapeutic vaccination during antiretroviral therapy (ART) would be recalled and boosted by treatment with the interleukin 15 (IL-15) superagonist N-803 after ART discontinuation. We intravenously immunized four simian immunodeficiency virus-positive (SIV(+)) Mauritian cynomolgus macaques receiving ART with vesicular stomatitis virus (VSV), modified vaccinia virus Ankara strain (MVA), and recombinant adenovirus serotype 5 (rAd-5) vectors all expressing SIVmac239 Gag. Immediately after ART cessation, these animals received three doses of N-803. Four control animals received no vaccines or N-803. The vaccine regimen generated a high-magnitude response involving Gag-specific CD8(+) T cells that were proliferative and biased toward an effector memory phenotype. We then compared cells elicited by vaccination (Gag specific) to cells elicited by SIV infection and unaffected by vaccination (Nef specific). We found that N-803 treatment enhanced the frequencies of both bulk and proliferating antigen-specific CD8(+) T cells elicited by vaccination and the antigen-specific CD8(+) T cells elicited by SIV infection. In sum, we demonstrate that a therapeutic heterologous prime-boost-boost (HPBB) vaccine can elicit antigen-specific effector memory CD8(+) T cells that are boosted by N-803. IMPORTANCE While antiretroviral therapy (ART) can suppress HIV replication, it is not a cure. It is therefore essential to develop therapeutic strategies to enhance the immune system to better become activated and recognize virus-infected cells. Here, we evaluated a novel therapeutic vaccination strategy delivered to SIV(+) Mauritian cynomolgus macaques receiving ART. ART was then discontinued and we delivered an immunotherapeutic agent (N-803) after ART withdrawal with the goal of eliciting and boosting anti-SIV cellular immunity. Immunologic and virologic analysis of peripheral blood and lymph nodes collected from these animals revealed transient boosts in the frequency, activation, proliferation, and memory phenotype of CD4(+) and CD8(+) T cells following each intervention. Overall, these results are important in educating the field of the transient nature of the immunological responses to this particular therapeutic regimen and the similar effects of N-803 on boosting T cells elicited by vaccination or elicited naturally by infection.

Influenza A viruses (FLUAV) cause respiratory diseases in many host species, including humans and pigs. The spillover of FLUAV between swine and humans has been a concern for both public health and the swine industry. With the emergence of the triple reassortant internal gene (TRIG) constellation, establishment of human-origin FLUAVs in pigs has become more common, leading to increased viral diversity. However, little is known about the adaptation processes that are needed for a human-origin FLUAV to transmit and become established in pigs. We generated a reassortant FLUAV (VIC11pTRIG) containing surface gene segments from a human FLUAV strain and internal gene segments from the 2009 pandemic and TRIG FLUAV lineages and demonstrated that it can replicate and transmit in pigs. Sequencing and variant analysis identified three mutants that emerged during replication in pigs, which were mapped near the receptor binding site of the hemagglutinin (HA). The variants replicated more efficiently in differentiated swine tracheal cells compared to the virus containing the wildtype human-origin HA, and one of them was present in all contact pigs. These results show that variants are selected quickly after replication of human-origin HA in pigs, leading to improved fitness in the swine host, likely contributing to transmission. IMPORTANCE Influenza A viruses cause respiratory disease in several species, including humans and pigs. The bidirectional transmission of FLUAV between humans and pigs plays a significant role in the generation of novel viral strains, greatly impacting viral epidemiology. However, little is known about the evolutionary processes that allow human FLUAV to become established in pigs. In this study, we generated reassortant viruses containing human seasonal HA and neuraminidase (NA) on different constellations of internal genes and tested their ability to replicate and transmit in pigs. We demonstrated that a virus containing a common internal gene constellation currently found in U.S. swine was able to transmit efficiently via the respiratory route. We identified a specific amino acid substitution that was fixed in the respiratory contact pigs that was associated with improved replication in primary swine tracheal epithelial cells, suggesting it was crucial for the transmissibility of the human virus in pigs.

People infected with the mosquito-borne Rift Valley fever virus (RVFV) can suffer from eye-related problems resulting in ongoing vision issues or even permanent blindness. Despite ocular disease being the most frequently reported severe outcome, it is vastly understudied compared to other disease outcomes caused by RVFV. Ocular manifestations of RVFV include blurred vision, uveitis, and retinitis. When an infected individual develops macular or paramacular lesions, there is a 50% chance of permanent vision loss in one or both eyes. The cause of blinding ocular pathology remains unknown in part due to the lack of a tractable animal model. Using 3 relevant exposure routes, both subcutaneous (SC) and aerosol inoculation of Sprague Dawley rats led to RVFV infection of the eye. Surprisingly, direct inoculation of the conjunctiva did not result in successful ocular infection. The posterior segment of the eye, including the optic nerve, choroid, ciliary body, and retina, were all positive for RVFV antigen in SC-infected rats, and live virus was isolated from the eyes. Proinflammatory cytokines and increased leukocyte counts were also found in the eyes of infected rats. Additionally, human ocular cell lines were permissive for Lrp1-dependent RVFV infection. This study experimentally defines viral tropism of RVFV in the posterior segment of the rat eye and characterizes virally-mediated ocular inflammation, providing a foundation for evaluation of vaccines and therapeutics to protect against adverse ocular outcomes.

Influenza A virus (IAV) causes respiratory disease in swine and humans. Vaccines are used to prevent influenza illness in both populations but must be frequently updated due to rapidly evolving strains. Mismatch between the circulating strains and the strains contained in vaccines may cause loss of efficacy. Whole inactivated virus (WIV) vaccines with adjuvant, utilized by the swine industry, are effective against antigenically similar viruses; however, vaccine-associated enhanced respiratory disease (VAERD) may happen when the WIV is antigenically mismatched with the infecting virus. VAERD is a repeatable model in pigs, but had yet to be experimentally demonstrated in other mammalian species. We recapitulated VAERD in ferrets, a standard benchmark animal model for studying human influenza infection, in a direct comparison to VAERD in pigs. Both species were vaccinated with WIV with oil-in-water adjuvant containing a δ-1 H1N2 (1B.2.2) derived from the pre-2009 human seasonal lineage, then challenged with a 2009 pandemic H1N1 (H1N1pdm09, 1A.3.3.2) 5 weeks after vaccination. Nonvaccinated and challenged groups showed typical signs of influenza disease, but the mismatched vaccinated and challenged pigs and ferrets showed elevated clinical signs, despite similar viral loads. VAERD-affected pigs exhibited a 2-fold increase in lung lesions, while VAERD-affected ferrets showed a 4-fold increase. Similar to pigs, antibodies from VAERD-affected ferrets preferentially bound to the HA2 domain of the H1N1pdm09 challenge strain. These results indicate that VAERD is not limited to pigs, as demonstrated here in ferrets, and the need to consider VAERD when evaluating new vaccine platforms and strategies. IMPORTANCE We demonstrated the susceptibility of ferrets, a laboratory model species for human influenza A virus research, to vaccine-associated enhanced respiratory disease (VAERD) using an experimental model previously demonstrated in pigs. Ferrets developed clinical characteristics of VAERD very similar to that in pigs. The hemagglutinin (HA) stalk is a potential vaccine target to develop more efficacious, broadly reactive influenza vaccine platforms and strategies. However, non-neutralizing antibodies directed toward a conserved epitope on the HA stalk induced by an oil-in-water, adjuvanted, whole influenza virus vaccine were previously shown in VAERD-affected pigs and were also identified here in VAERD-affected ferrets. The induction of VAERD in ferrets highlights the potential risk of mismatched influenza vaccines for humans and the need to consider VAERD when designing and evaluating vaccine strategies.

Human-to-swine transmission of influenza A virus (IAV) repeatedly occurs, leading to sustained transmission and increased diversity in swine; human seasonal H3N2 introductions occurred in the 1990s and 2010s and were maintained in North American swine. Swine H3N2 strains were subsequently associated with zoonotic infections, highlighting the need to understand the risk of endemic swine IAV to humans. We quantified antigenic distances between swine H3N2 and human seasonal vaccine strains from 1973 to 2014 using a panel of monovalent antisera raised in pigs in hemagglutination inhibition (HI) assays. Swine H3N2 lineages retained the closest antigenic similarity to human vaccine strains from the decade of incursion. Swine lineages from the 1990s were antigenically more similar to human vaccine strains of the mid-1990s but had substantial distance from recent human vaccine strains. In contrast, lineages from the 2010s were closer to human vaccine strains from 2011 and 2014 and the most antigenically distant from human vaccine strains prior to 2007. HI assays using ferret antisera demonstrated that swine lineages from the 1990s and 2010s had significant fold reductions compared to the homologous HI titer of the nearest pandemic preparedness candidate vaccine virus (CVV) or seasonal vaccine strain. The assessment of postinfection and postvaccination human serum cohorts demonstrated limited cross-reactivity to swine H3N2 from the 1990s, especially in older adults born before the 1970s. We identified swine strains to which humans are likely to lack population immunity or are not protected against by a current human seasonal vaccine or CVV to use in prioritizing future human CVV strain selection. IMPORTANCE Human H3N2 influenza A viruses spread to pigs in North America in the 1990s and more recently in the 2010s. These cross-species events led to sustained circulation and increased H3N2 diversity in pig populations. The evolution of H3N2 in swine led to a reduced similarity to human seasonal H3N2 and the vaccine strains used to protect human populations. We quantified the antigenic phenotypes and found that North American swine H3N2 lineages retained more antigenic similarity to historical human vaccine strains from the decade of incursion but had substantial differences compared to recent human vaccine strains. Additionally, pandemic preparedness vaccine strains demonstrated a loss of similarity to contemporary swine strains. Finally, human sera revealed that although these adults had antibodies against human H3N2 strains, many had limited immunity to swine H3N2, especially older adults born before 1970. Antigenic assessment of swine H3N2 provides critical information for pandemic preparedness and candidate vaccine development.

Two separate introductions of human seasonal N2 neuraminidase genes were sustained in United States swine since 1998 (N2-98) and 2002 (N2-02). Herein, we characterized the antigenic evolution of the N2 of swine influenza A virus (IAV) across two decades following each introduction. The N2-98 and N2-02 expanded in genetic diversity, with two statistically supported monophyletic clades within each lineage. To assess antigenic drift in swine N2 following the human-to-swine spillover events, we generated a panel of swine N2 antisera against representative N2 and quantified the antigenic distance between wild-type viruses using enzyme-linked lectin assay and antigenic cartography. The antigenic distance between swine and human N2 was smallest between human N2 circulating at the time of each introduction and the archetypal swine N2. However, sustained circulation and evolution in swine of the two N2 lineages resulted in significant antigenic drift, and the N2-98 and N2-02 swine N2 lineages were antigenically distinct. Although intra-lineage antigenic diversity was observed, the magnitude of antigenic drift did not consistently correlate with the observed genetic differences. These data represent the first quantification of the antigenic diversity of neuraminidase of IAV in swine and demonstrated significant antigenic drift from contemporary human seasonal strains as well as antigenic variation among N2 detected in swine. These data suggest that antigenic mismatch may occur between circulating swine IAV and vaccine strains. Consequently, consideration of the diversity of N2 in swine IAV for vaccine selection may likely result in more effective control, and aid public health initiatives for pandemic preparedness. Importance Antibodies inhibiting the neuraminidase (NA) of influenza A virus (IAV) reduce clinical disease, virus shedding, and transmission, particularly in the absence of neutralizing immunity against the hemagglutinin. To understand antibody recognition of the genetically diverse NA in U.S. swine IAV, we characterized the antigenic diversity of N2 from swine and humans. N2 detected in swine IAV were derived from two distinct human-to-swine spillovers that persisted, are antigenically distinct, and underwent antigenic drift. These findings highlight the need for continued surveillance and vaccine development in swine with increased focus on the NA. Additionally, human seasonal N2 isolated after 2005 were poorly inhibited by representative swine N2 antisera, suggesting a lack of cross-reactive NA antibody mediated immunity between contemporary swine and human N2. Bidirectional transmission between humans and swine represents a One Health challenge, and determining the correlates of immunity to emerging IAV strains is critical to mitigate zoonotic and reverse-zoonotic transmission.

The potential for emerging mosquito-borne viruses to cause fetal infection in pregnant women was overlooked until the Zika fever outbreak several years ago. Rift Valley fever virus (RVFV) is an emerging arbovirus with a long history of fetal infection and death in pregnant livestock. The effect of RVFV infection on pregnant women is not well understood. This Gem examines the effects that this important emerging pathogen has during pregnancy, its potential impact on pregnant women, and the current research efforts designed to understand and mitigate adverse effects of RVFV infection during pregnancy.

Human-to-swine transmission of seasonal influenza viruses has led to sustained human-like influenza viruses circulating in the U.S. swine population. While some reverse zoonotic-origin viruses adapt and become enzootic in swine, nascent reverse zoonoses may result in virus detections that are difficult to classify as “swine-origin” or “human-origin” due to the genetic similarity of circulating viruses. This is the case for human-origin influenza A(H1N1) pandemic 2009 (pdm09) viruses detected in pigs following numerous reverse zoonosis events since the 2009 pandemic. We report the identification of two human infections with A(H1N1)pdm09 viruses originating from swine hosts and classify them as “swine-origin” variant influenza viruses based on phylogenetic analysis and sequence comparison methods. Phylogenetic analyses of viral genomes from two cases revealed these viruses were reassortants containing A(H1N1)pdm09 hemagglutinin (HA) and neuraminidase (NA) genes with genetic combinations derived from the triple reassortant internal gene cassette. Follow-up investigations determined that one individual had direct exposure to swine in the week preceding illness onset, while another did not report swine exposure. The swine-origin A(H1N1) variant cases were resolved by full genome sequence comparison of the variant viruses to swine influenza genomes. However, if reassortment does not result in the acquisition of swine-associated genes and swine virus genomic sequences are not available from the exposure source, future cases may not be discernible. We have developed a pipeline that performs maximum likelihood analyses, a k-mer-based set difference algorithm, and random forest algorithms to identify swine-associated sequences in the hemagglutinin gene to differentiate between human-origin and swine-origin A(H1N1)pdm09 viruses. IMPORTANCE Influenza virus infects a wide range of hosts, resulting in illnesses that vary from asymptomatic cases to severe pneumonia and death. Viral transfer can occur between human and nonhuman hosts, resulting in human and nonhuman origin viruses circulating in novel hosts. In this work, we have identified the first case of a swine-origin influenza A(H1N1)pdm09 virus resulting in a human infection. This shows that these viruses not only circulate in swine hosts, but are continuing to evolve and distinguish themselves from previously circulating human-origin influenza viruses. The development of techniques for distinguishing human-origin and swine-origin viruses are necessary for the continued surveillance of influenza viruses. We show that unique genetic signatures can differentiate circulating swine-associated strains from circulating human-associated strains of influenza A(H1N1)pdm09, and these signatures can be used to enhance surveillance of swine-origin influenza.

We evaluated the contribution of CD8αβ(+) T cells to control of live-attenuated simian immunodeficiency virus (LASIV) replication during chronic infection and subsequent protection from pathogenic SIV challenge. Unlike previous reports with a CD8α-specific depleting monoclonal antibody (mAb), the CD8β-specific mAb CD8β255R1 selectively depleted CD8αβ(+) T cells without also depleting non-CD8(+) T cell populations that express CD8α, such as natural killer (NK) cells and γδ T cells. Following infusion with CD8β255R1, plasma viremia transiently increased coincident with declining peripheral CD8αβ(+) T cells. Interestingly, plasma viremia returned to predepletion levels even when peripheral CD8αβ(+) T cells did not. Although depletion of CD8αβ(+) T cells in the lymph node (LN) was incomplete, frequencies of these cells were 3-fold lower (P = 0.006) in animals that received CD8β255R1 than in those that received control IgG. It is possible that these residual SIV-specific CD8αβ(+) T cells may have contributed to suppression of viremia during chronic infection. We also determined whether infusion of CD8β255R1 in the LASIV-vaccinated animals increased their susceptibility to infection following intravenous challenge with pathogenic SIVmac239. We found that 7/8 animals infused with CD8β255R1, and 3/4 animals infused with the control IgG, were resistant to SIVmac239 infection. These results suggest that infusion with CD8β255R1 did not eliminate the protection afforded to LASIV vaccination. This provides a comprehensive description of the impact of CD8β255R1 infusion on the immunological composition in cynomolgus macaques, compared to an isotype-matched control IgG, while showing that the control of LASIV viremia and protection from challenge can occur even after CD8β255R1 administration. IMPORTANCE Studies of SIV-infected macaques that deplete CD8(+) T cells in vivo with monoclonal antibodies have provided compelling evidence for their direct antiviral role. These studies utilized CD8α-specific mAbs that target both the major (CD8αβ(+)) and minor (CD8αα(+)) populations of CD8(+) T cells but additionally deplete non-CD8(+) T cell populations that express CD8α, such as NK cells and γδ T cells. In the current study, we administered the CD8β-specific depleting mAb CD8β255R1 to cynomolgus macaques chronically infected with a LASIV to selectively deplete CD8αβ(+) T cells without removing CD8αα(+) lymphocytes. We evaluated the impact on control of virus replication and protection from pathogenic SIVmac239 challenge. These results underscore the utility of CD8β255R1 for studying the direct contribution of CD8αβ(+) T cells in various disease states.

Influenza A viruses in swine (IAV-S) circulating in the United States of America are phylogenetically and antigenically distinct. A human H3 hemagglutinin (HA) was introduced into the IAV-S gene pool in the late 1990s, sustained continued circulation, and evolved into five monophyletic genetic clades, H3 clades IV-A to -E, after 2009. Across these phylogenetic clades, distinct antigenic clusters were identified, with three clusters (cyan, red, and green antigenic cluster) among the most frequently detected antigenic phenotypes (Abente EJ, Santos J, Lewis NS, Gauger PC, Stratton J, et al. J Virol 90:8266-8280, 2016, https://doi.org/10.1128/JVI.01002-16). Although it was demonstrated that antigenic diversity of H3N2 IAV-S was associated with changes at a few amino acid positions in the head of the HA, the implications of this diversity for vaccine efficacy were not tested. Using antigenically representative H3N2 viruses, we compared whole inactivated virus (WIV) and live-attenuated influenza virus (LAIV) vaccines for protection against challenge with antigenically distinct H3N2 viruses in pigs. WIV provided partial protection against antigenically distinct viruses but did not prevent virus replication in the upper respiratory tract. In contrast, LAIV provided complete protection from disease and virus was not detected after challenge with antigenically distinct viruses.IMPORTANCE Due to the rapid evolution of the influenza A virus, vaccines require continuous strain updates. Additionally, the platform used to deliver the vaccine can have an impact on the breadth of protection. Currently, there are various vaccine platforms available to prevent influenza A virus infection in swine, and we experimentally tested two: adjuvanted-whole inactivated virus and live-attenuated virus. When challenged with an antigenically distinct virus, adjuvanted-whole inactivated virus provided partial protection, while live-attenuated virus provided effective protection. Additional strategies are required to broaden the protective properties of inactivated virus vaccines, given the dynamic antigenic landscape of cocirculating strains in North America, whereas live-attenuated vaccines may require less frequent strain updates, based on demonstrated cross-protection. Enhancing vaccine efficacy to control influenza infections in swine will help reduce the impact they have on swine production and reduce the risk of swine-to-human transmission.

We manipulated SIVmac239Δnef, a model of major histocompatibility complex (MHC)-independent viral control, to evaluate characteristics of effective cellular responses mounted by Mauritian cynomolgus macaques (MCMs) that express the M3 MHC haplotype, which has been associated with poor control of pathogenic simian immunodeficiency virus (SIV). We created SIVΔnef-8x to test the hypothesis that effective SIV-specific T cell responses targeting invariant viral regions can emerge in the absence of immunodominant CD8(+) T cell responses targeting variable epitopes and that control is achievable in individuals lacking known “protective” MHC alleles. Full-proteome gamma interferon (IFN-γ) enzyme-linked immunospot (ELISPOT) assays identified six newly targeted immunogenic regions following SIVΔnef-8x infection of M3/M3 MCMs. We deep sequenced circulating virus and found that four of the six newly targeted regions rarely accumulated mutations. Six animals infected with SIVΔnef-8x had T cell responses that targeted at least one of the four invariant regions and had a lower set point viral load than two animals that did not have T cell responses that targeted any invariant regions. We found that MHC class II molecules restricted all four of the invariant peptide regions, while the two variable regions were restricted by MHC class I molecules. Therefore, in the absence of immunodominant CD8(+) T cell responses that target variable regions during SIVmac239Δnef infection, individuals without protective MHC alleles developed predominantly CD4(+) T cell responses specific for invariant regions that may improve control of virus replication. Our results provide some evidence that antiviral CD4(+) T cells during acute SIV infection can contribute to effective viral control and should be considered in strategies to combat HIV infection. IMPORTANCE Studies defining effective cellular immune responses to human immunodeficiency virus (HIV) and SIV have largely focused on a rare population that express specific MHC class I alleles and control virus replication in the absence of antiretroviral treatment. This leaves in question whether similar effective immune responses can be achieved in the larger population. The majority of HIV-infected individuals mount CD8(+) T cell responses that target variable viral regions that accumulate high-frequency escape mutations. Limiting T cell responses to these variable regions and targeting invariant viral regions, similar to observations in rare “elite controllers,” may provide an ideal strategy for the development of effective T cell responses in individuals with diverse MHC genetics. Therefore, it is of paramount importance to determine whether T cell responses can be redirected toward invariant viral regions in individuals without protective MHC alleles and if these responses improve control of virus replication.

Avian-origin H3N2 canine influenza virus (CIV) transferred to dogs in Asia around 2005, becoming enzootic throughout China and South Korea before reaching the United States in early 2015. To understand the posttransfer evolution and epidemiology of this virus, particularly the cause of recent and ongoing increases in incidence in the United States, we performed an integrated analysis of whole-genome sequence data from 64 newly sequenced viruses and comprehensive surveillance data. This revealed that the circulation of H3N2 CIV within the United States is typified by recurrent epidemic burst–fade-out dynamics driven by multiple introductions of virus from Asia. Although all major viral lineages displayed similar rates of genomic sequence evolution, H3N2 CIV consistently exhibited proportionally more nonsynonymous substitutions per site than those in avian reservoir viruses, which is indicative of a large-scale change in selection pressures. Despite these genotypic differences, we found no evidence of adaptive evolution or increased viral transmission, with epidemiological models indicating a basic reproductive number, R0, of between 1 and 1.5 across nearly all U.S. outbreaks, consistent with maintained but heterogeneous circulation. We propose that CIV9s mode of viral circulation may have resulted in evolutionary cul-de-sacs, in which there is little opportunity for the selection of the more transmissible H3N2 CIV phenotypes necessary to enable circulation through a general dog population characterized by widespread contact heterogeneity. CIV must therefore rely on metapopulations of high host density (such as animal shelters and kennels) within the greater dog population and reintroduction from other populations or face complete epidemic extinction. IMPORTANCE The relatively recent appearance of influenza A virus (IAV) epidemics in dogs expands our understanding of IAV host range and ecology, providing useful and relevant models for understanding critical factors involved in viral emergence. Here we integrate viral whole-genome sequence analysis and comprehensive surveillance data to examine the evolution of the emerging avian-origin H3N2 canine influenza virus (CIV), particularly the factors driving ongoing circulation and recent increases in incidence of the virus within the United States. Our results provide a detailed understanding of how H3N2 CIV achieves sustained circulation within the United States despite widespread host contact heterogeneity and recurrent epidemic fade-out. Moreover, our findings suggest that the types and intensities of selection pressures an emerging virus experiences are highly dependent on host population structure and ecology and may inhibit an emerging virus from acquiring sustained epidemic or pandemic circulation.

Developing biological interventions to control human immunodeficiency virus (HIV) replication in the absence of antiretroviral therapy (ART) could contribute to the development of a functional cure. As a potential alternative to ART, the interleukin-15 (IL-15) superagonist ALT-803 has been shown to boost the number and function of HIV-specific CD8 + T and NK cell populations in vitro . Four simian immunodeficiency virus (SIV)-positive rhesus macaques, three of whom possessed major histocompatibility complex alleles associated with control of SIV and all of whom had received SIV vaccine vectors that had the potential to elicit CD8 + T cell responses, were given ALT-803 in three treatment cycles. The first and second cycles of treatment were separated by 2 weeks, while the third cycle was administered after a 29-week break. ALT-803 transiently elevated the total CD8 + effector and central memory T cell and NK cell populations in peripheral blood, while viral loads transiently decreased by ∼2 logs in all animals. Virus suppression was not sustained as T cells became less responsive to ALT-803 and waned in numbers. No effect on viral loads was observed in the second cycle of ALT-803, concurrent with downregulation of the IL-2/15 common γC and β chain receptors on both CD8 + T cells and NK cells. Furthermore, populations of immunosuppressive T cells increased during the second cycle of ALT-803 treatment. During the third treatment cycle, responsiveness to ALT-803 was restored. CD8 + T cells and NK cells increased again 3- to 5-fold, and viral loads transiently decreased again by 1 to 2 logs. IMPORTANCE Overall, our data show that ALT-803 has the potential to be used as an immunomodulatory agent to elicit effective immune control of HIV/SIV replication. We identify mechanisms to explain why virus control is transient, so that this model can be used to define a clinically appropriate treatment regimen.

The diversity of influenza A viruses in swine (swIAVs) presents an important pandemic threat. Knowledge of the human-swine interface is particularly important for understanding how viruses with pandemic potential evolve in swine hosts. Through phylogenetic analysis of contemporary swIAVs in the United States, we demonstrate that human-to-swine transmission of pandemic H1N1 (pH1N1) viruses has occurred continuously in the years following the 2009 H1N1 pandemic and has been an important contributor to the genetic diversity of U.S. swIAVs. Although pandemic H1 and N1 segments had been largely removed from the U.S. swine population by 2013 via reassortment with other swIAVs, these antigens reemerged following multiple human-to-swine transmission events during the 2013-2014 seasonal epidemic. These findings indicate that the six internal gene segments from pH1N1 viruses are likely to be sustained long term in the U.S. swine population, with periodic reemergence of pandemic hemagglutinin (HA) and neuraminidase (NA) segments in association with seasonal pH1N1 epidemics in humans. Vaccinating U.S. swine workers may reduce infection of both humans and swine and in turn limit the role of humans as sources of influenza virus diversity in pigs. IMPORTANCE Swine are important hosts in the evolution of influenza A viruses with pandemic potential. Here, we analyze influenza virus sequence data generated by the U.S. Department of Agriculture's national surveillance system to identify the central role of humans in the reemergence of pandemic H1N1 (pH1N1) influenza viruses in U.S. swine herds in 2014. These findings emphasize the important role of humans as continuous sources of influenza virus diversity in swine and indicate that influenza viruses with pandemic HA and NA segments are likely to continue to reemerge in U.S. swine in association with seasonal pH1N1 epidemics in humans.

The process of vaccination introduced by Jenner generated immunity against smallpox and ultimately led to the eradication of the disease. Procedurally, in modern times, the virus is introduced into patients via a process called scarification, performed with a bifurcated needle containing a small amount of virus. What was unappreciated was the role that scarification itself plays in generating protective immunity. In rabbits, protection from lethal disease is induced by intradermal injection of vaccinia virus, whereas a protective response occurs within the first 2 min after scarification with or without virus, suggesting that the scarification process itself is a major contributor to immunoprotection. IMPORTANCE These results show the importance of local nonspecific immunity in controlling poxvirus infections and indicate that the process of scarification should be critically considered during the development of vaccination protocols for other infectious agents.

Swine influenza A virus is an endemic and economically important pathogen in pigs, with the potential to infect other host species. The hemagglutinin (HA) protein is the primary target of protective immune responses and the major component in swine influenza A vaccines. However, as a result of antigenic drift, vaccine strains must be regularly updated to reflect currently circulating strains. Characterizing the cross-reactivity between strains in pigs and seasonal influenza virus strains in humans is also important in assessing the relative risk of interspecies transmission of viruses from one host population to the other. Hemagglutination inhibition (HI) assay data for swine and human H3N2 viruses were used with antigenic cartography to quantify the antigenic differences among H3N2 viruses isolated from pigs in the United States from 1998 to 2013 and the relative cross-reactivity between these viruses and current human seasonal influenza A virus strains. Two primary antigenic clusters were found circulating in the pig population, but with enough diversity within and between the clusters to suggest updates in vaccine strains are needed. We identified single amino acid substitutions that are likely responsible for antigenic differences between the two primary antigenic clusters and between each antigenic cluster and outliers. The antigenic distance between current seasonal influenza virus H3 strains in humans and those endemic in swine suggests that population immunity may not prevent the introduction of human viruses into pigs, and possibly vice versa, reinforcing the need to monitor and prepare for potential incursions. IMPORTANCE Influenza A virus (IAV) is an important pathogen in pigs and humans. The hemagglutinin (HA) protein is the primary target of protective immune responses and the major target of vaccines. However, vaccine strains must be updated to reflect current strains. Characterizing the differences between seasonal IAV in humans and swine IAV is important in assessing the relative risk of interspecies transmission of viruses. We found two primary antigenic clusters of H3N2 in the U.S. pig population, with enough diversity to suggest updates in swine vaccine strains are needed. We identified changes in the HA protein that are likely responsible for these differences and that may be useful in predicting when vaccines need to be updated. The difference between human H3N2 viruses and those in swine is enough that population immunity is unlikely to prevent new introductions of human IAV into pigs or vice versa, reinforcing the need to monitor and prepare for potential introductions.

Translation of influenza A virus PB1-F2 occurs in a second open reading frame (ORF) of the PB1 gene segment. PB1-F2 has been implicated in regulation of polymerase activity, immunopathology, susceptibility to secondary bacterial infection, and induction of apoptosis. Experimental evidence of PB1-F2 molecular function during infection has been collected primarily from human and avian viral isolates. As the 2009 H1N1 (H1N1pdm09) strain highlighted, some swine-derived influenza viruses have the capacity to infect human hosts and emerge as a pandemic. Understanding the impact that virulence factors from swine isolates have on both human and swine health could aid in early identification of viruses with pandemic potential. Studies examining PB1-F2 from swine isolates have focused primarily on H1N1pdm09, which does not encode PB1-F2 but was engineered to carry a full-length PB1-F2 ORF to assess the impact on viral replication and pathogenicity. However, experimental evidence of PB1-F2 protein expression from swine lineage viruses has not been demonstrated. Here, we reveal that during infection, PB1-F2 expression levels are substantially different in swine and human influenza viruses. We provide evidence that PB1-F2 expression is regulated at the translational level, with very low levels of PB1-F2 expression from swine lineage viruses relative to a human isolate PB1-F2. Translational regulation of PB1-F2 expression was partially mapped to two independent regions within the PB1 mRNA, located downstream of the PB1-F2 start site. Our data suggest that carrying a full-length PB1-F2 ORF may not be predictive of PB1-F2 expression in infected cells for all influenza A viruses.

Control of swine influenza A virus (IAV) in the United States is hindered because inactivated vaccines do not provide robust cross-protection against the multiple antigenic variants cocirculating in the field. Vaccine efficacy can be limited further for vaccines administered to young pigs that possess maternally derived immunity. We previously demonstrated that a recombinant A/sw/Texas/4199-2/1998 (TX98) (H3N2) virus expressing a truncated NS1 protein is attenuated in swine and has potential for use as an intranasal live attenuated influenza virus (LAIV) vaccine. In the present study, we compared 1 dose of intranasal LAIV with 2 intramuscular doses of TX98 whole inactivated virus (WIV) with adjuvant in weanling pigs with and without TX98-specific maternally derived antibodies (MDA). Pigs were subsequently challenged with wild-type homologous TX98 H3N2 virus or with an antigenic variant, A/sw/Colorado/23619/1999 (CO99) (H3N2). In the absence of MDA, both vaccines protected against homologous TX98 and heterologous CO99 shedding, although the LAIV elicited lower hemagglutination inhibition (HI) antibody titers in serum. The efficacy of both vaccines was reduced by the presence of MDA; however, WIV vaccination of MDA-positive pigs led to dramatically enhanced pneumonia following heterologous challenge, a phenomenon known as vaccine-associated enhanced respiratory disease (VAERD). A single dose of LAIV administered to MDA-positive pigs still provided partial protection from CO99 and may be a safer vaccine for young pigs under field conditions, where dams are routinely vaccinated and diverse IAV strains are in circulation. These results have implications not only for pigs but also for other influenza virus host species.

Novel H3N2 influenza viruses (H3N2v) containing seven genome segments from swine lineage triple-reassortant H3N2 viruses and a 2009 pandemic H1N1 (H1N1pdm09) matrix protein segment (pM) were isolated from 12 humans in the United States between August and December 2011. To understand the evolution of these novel H3N2 viruses in swine and humans, we undertook a phylogenetic analysis of 674 M sequences and 388 HA and NA sequences from influenza viruses isolated from North American swine during 2009–2011, as well as HA, NA, and M sequences from eight H3N2v viruses isolated from humans. We identified 34 swine influenza viruses (termed rH3N2p) with the same combination of H3, N2, and pM segments as the H3N2v viruses isolated from humans. Notably, these rH3N2p viruses were generated in swine via reassortment events between H3N2 viruses and the pM segment approximately 4 to 10 times since 2009. The pM segment has also reassorted with multiple distinct lineages of H1 virus, especially H1δ viruses. Importantly, the N2 segment of all H3N2v viruses isolated from humans is derived from a genetically distinct N2 lineage that has circulated in swine since being acquired by reassortment with seasonal human H3N2 viruses in 2001–2002, rather than from the N2 that is associated with the 1998 H3N2 swine lineage. The identification of this N2 variant may have implications for influenza vaccine design and the potential pandemic threat of H3N2v to human age groups with differing levels of prior exposure and immunity.

PB1-F2 is an 87- to 90-amino-acid-long protein expressed by certain influenza A viruses. Previous studies have shown that PB1-F2 contributes to virulence in the mouse model; however, its role in natural hosts—pigs, humans, or birds—remains largely unknown. Outbreaks of domestic pigs infected with the 2009 pandemic H1N1 influenza virus (pH1N1) have been detected worldwide. Unlike previous pandemic strains, pH1N1 viruses do not encode a functional PB1-F2 due to the presence of three stop codons resulting in premature truncation after codon 11. However, pH1N1s have the potential to acquire the full-length form of PB1-F2 through mutation or reassortment. In this study, we assessed whether restoring the full-length PB1-F2 open reading frame (ORF) in the pH1N1 background would have an effect on virus replication and virulence in pigs. Restoring the PB1-F2 ORF resulted in upregulation of viral polymerase activity at early time points in vitro and enhanced virus yields in porcine respiratory explants and in the lungs of infected pigs. There was an increase in the severity of pneumonia in pigs infected with isogenic virus expressing PB1-F2 compared to the wild-type (WT) pH1N1. The extent of microscopic pneumonia correlated with increased pulmonary levels of alpha interferon and interleukin-1β in pigs infected with pH1N1 encoding a functional PB1-F2 but only early in the infection. Together, our results indicate that PB1-F2 in the context of pH1N1 moderately modulates viral replication, lung histopathology, and local cytokine response in pigs.

During the last decade, more than half of humans infected with highly pathogenic avian influenza (HPAI) H5N1 viruses have died, yet virus-induced host signaling has yet to be clearly elucidated. Airway epithelia are known to produce inflammatory mediators that contribute to HPAI H5N1-mediated pathogenicity, but a comprehensive analysis of the host response in this cell type is lacking. Here, we leveraged a system approach to identify and statistically validate signaling subnetworks that define the dynamic transcriptional response of human bronchial epithelial cells after infection with influenza A/Vietnam/1203/2004 (H5N1, VN1203). Importantly, we validated a subset of transcripts from one subnetwork in both Calu-3 cells and mice. A more detailed examination of two subnetworks involved in the immune response and keratinization processes revealed potential novel mediators of HPAI H5N1 pathogenesis and host response signaling. Finally, we show how these results compare to those for a less virulent strain of influenza virus. Using emergent network properties, we provide fresh insight into the host response to HPAI H5N1 virus infection and identify novel avenues for perturbation studies and potential therapeutic interventions for fatal HPAI H5N1 disease.

We previously reported that the cellular protein ZEB1 can repress expression of the Epstein-Barr virus (EBV) BZLF1 gene in transient transfection assays by directly binding its promoter, Zp. We also reported that EBV containing a 2-bp substitution mutation in the ZEB-binding ZV element of Zp spontaneously reactivated out of latency into lytic replication at a higher frequency than did wild-type EBV. Here, using small interfering RNA (siRNA) and short hairpin RNA (shRNA) technologies, we definitively show that ZEB1 is, indeed, a key player in maintaining EBV latency in some epithelial and B-lymphocytic cell lines. However, in other EBV-positive epithelial and B-cell lines, another zinc finger E-box-binding protein, ZEB2/SIP1, is the key player. Both ZEB1 and ZEB2 can bind Zp via the ZV element. In EBV-positive cells containing only ZEB1, knockdown of ZEB1 led to viral reactivation out of latency, with synthesis of EBV immediate-early and early lytic gene products. However, in EBV-positive cells containing both ZEBs, ZEB2, not ZEB1, was the primary ZEB family member bound to Zp. Knockdown of ZEB2, but not ZEB1, led to EBV lytic reactivation. Thus, we conclude that either ZEB1 or ZEB2 can play a central role in the maintenance of EBV latency, doing so in a cell-type-dependent manner.

Herpes simplex virus (HSV) contains more than 40 different virally encoded proteins that are found in three distinct layers: the capsid containing the viral DNA, the host-derived lipid envelope with embedded glycoproteins, and the tegument, an assortment of proteins located between the nucleocapsid and the envelope (22). While these regions are often discussed as separate structures, there is now clear evidence that the virion as a whole is a machine with interconnected parts that quickly rearrange on the inside in response to glycoprotein-binding events on the outside. Specifically, tegument protein UL16 is triggered to be released from the capsid when HSV attaches to host cells prior to membrane fusion, and the signal responsible for this can be sent in a cell-free manner by binding virions to immobilized heparin (21). It appears that glycoprotein C is involved in transmitting the signal (at least in a cell-free system), but all the other molecular “cogs” that drive this part of the HSV machine are unknown. To identify these components, we have been investigating UL16 and the network of molecular interactions in which it participates. Our interest in UL16 began when we identified it as a binding partner of UL11 (17), a small tegument protein (only 96 amino acids) that is conserved among all herpesviruses. UL11 is peripherally bound to membranes via two fatty acids, myristate and palmitate (16), and trafficks through lipid raft domains (6, 12). It accumulates at the trans-Golgi network (TGN), where virus budding takes place (16, 30), and mutants that lack UL11 are defective for the production of virions, resulting in an increased number of unenveloped capsids in the cytoplasm (5, 9, 19). The UL11-UL16 interaction has since been confirmed by other groups (15, 37), and more recently, we have found that the interaction is direct and requires free cysteines present within UL16 (41). That is, chemical modification of free cysteines in UL16 with N-ethylmaleimide (NEM) blocks the interaction with UL11. On the UL11 side of the interaction, LI and acidic cluster motifs are needed for binding (17, 41). UL16 is a 373-amino-acid protein that is also conserved among herpesviruses and exhibits dynamic capsid-binding properties. Although it is found in both the cytoplasm and the nucleus of the infected cell, it is only stably associated with capsids isolated from the cytoplasm (20, 24, 26). This finding, combined with the ability of UL11 to accumulate at the site of budding, led us to hypothesize that the UL11-UL16 interaction provides a bridging function to assist the capsid in acquiring its envelope (17). However, sometime after budding—as the virus egresses from the cell—the interaction of UL16 with the capsid is destabilized (20). And, as mentioned earlier, binding of the virion to its attachment receptors on the host cell surface (heparan sulfate) further disrupts the association of UL16 with the capsid (21). Free cysteines appear to play a critical role in this outside-in signaling event, because treatment of extracellular virions with NEM prior to cell binding prevents the release of UL16 from the capsid (21). While UL16 was the most abundant protein pulled out of infected cell lysates in our search for UL11 binding partners, a much less prominent, but highly reproducible, ∼65-kDa species was also observed (17). Like UL16, this unknown protein was absent when either the LI or acidic cluster motifs were eliminated from the glutathione S-transferase (GST)-UL11 construct used in the experiment. This suggested that the unknown protein was obtained by either (i) competing with UL16 for binding to the same motifs within UL11 or (ii) binding to UL11 indirectly through an interaction with UL16. Because the LI and acidic cluster motifs of UL11 are recognized by host proteins for trafficking through lipid rafts (6, 16), the first hypothesis seemed likely; however, because UL16 participates in a complex signaling pathway within the virion, it was possible that the unknown protein would be a virus-encoded component. The purpose of the experiments described in this report was to identify this unknown protein and to determine how it fits into the UL16 network of interactions.

Recent studies have established that several nonenveloped viruses utilize virus-encoded lytic peptides for host membrane disruption. We investigated this mechanism with the “gamma” peptide of the insect virus Flock House virus (FHV). We demonstrate that the C terminus of gamma is essential for membrane disruption in vitro and the rescue of immature virus infectivity in vivo, and the amphipathic N terminus of gamma alone is not sufficient. We also show that deletion of the C-terminal domain disrupts icosahedral ordering of the amphipathic helices of gamma in the virus. Our results have broad implications for understanding membrane lysis during nonenveloped virus entry.

Rift Valley fever (RVF) virus historically has caused widespread and extensive outbreaks of severe human and livestock disease throughout Africa, Madagascar, and the Arabian Peninsula. Following unusually heavy rainfall during the late autumn of 2006, reports of human and animal illness consistent with RVF virus infection emerged across semiarid regions of the Garissa District of northeastern Kenya and southern Somalia. Following initial RVF virus laboratory confirmation, a high-throughput RVF diagnostic facility was established at the Kenyan Central Veterinary Laboratories in Kabete, Kenya, to support the real-time identification of infected livestock and to facilitate outbreak response and control activities. A total of 3,250 specimens from a variety of animal species, including domesticated livestock (cattle, sheep, goats, and camels) and wildlife collected from a total of 55 of 71 Kenyan administrative districts, were tested by molecular and serologic assays. Evidence of RVF infection was found in 9.2% of animals tested and across 23 districts of Kenya, reflecting the large number of affected livestock and the geographic extent of the outbreak. The complete S, M, and/or L genome segment sequence was obtained from a total of 31 RVF virus specimens spanning the entire known outbreak period (December-May) and geographic areas affected by RVF virus activity. Extensive genomic analyses demonstrated the concurrent circulation of multiple virus lineages, gene segment reassortment, and the common ancestry of the 2006/2007 outbreak viruses with those from the 1997-1998 east African RVF outbreak. Evidence of recent increases in genomic diversity and effective population size 2 to 4 years prior to the 2006-2007 outbreak also was found, indicating ongoing RVF virus activity and evolution during the interepizootic/epidemic period. These findings have implications for further studies of basic RVF virus ecology and the design of future surveillance/diagnostic activities, and they highlight the critical need for safe and effective vaccines and antiviral compounds to combat this significant veterinary and public health threat.

Rift Valley fever (RVF) virus is a mosquito-borne human and veterinary pathogen associated with large outbreaks of severe disease throughout Africa and more recently the Arabian peninsula. Infection of livestock can result in sweeping “abortion storms” and high mortality among young animals. Human infection results in self-limiting febrile disease that in ∼1 to 2% of patients progresses to more serious complications including hepatitis, encephalitis, and retinitis or a hemorrhagic syndrome with high fatality. The virus S segment-encoded NSs and the M segment-encoded NSm proteins are important virulence factors. The development of safe, effective vaccines and tools to screen and evaluate antiviral compounds is critical for future control strategies. Here, we report the successful reverse genetics generation of multiple recombinant enhanced green fluorescent protein-tagged RVF viruses containing either the full-length, complete virus genome or precise deletions of the NSs gene alone or the NSs/NSm genes in combination, thus creating attenuating deletions on multiple virus genome segments. These viruses were highly attenuated, with no detectable viremia or clinical illness observed with high challenge dosages (1.0 × 104PFU) in the rat lethal disease model. A single-dose immunization regimen induced robust anti-RVF virus immunoglobulin G antibodies (titer, ∼1:6,400) by day 26 postvaccination. All vaccinated animals that were subsequently challenged with a high dose of virulent RVF virus survived infection and could be serologically differentiated from naïve, experimentally infected animals by the lack of NSs antibodies. These rationally designed marker RVF vaccine viruses will be useful tools for in vitro screening of therapeutic compounds and will provide a basis for further development of RVF virus marker vaccines for use in endemic regions or following the natural or intentional introduction of the virus into previously unaffected areas.

Zaire ebolavirus causes a rapidly progressing hemorrhagic disease with high mortality. Identification of the viral virulence factors that contribute to the severity of disease induced by Ebola virus is critical for the design of therapeutics and vaccines against the disease. Given the rapidity of disease progression, virus interaction with the innate immune system early in the course of infection likely plays an important role in determining the outcome of the disease. The Ebola virus VP35 protein inhibits the activation of IRF-3, a critical transcription factor for the induction of early antiviral immunity. Previous studies revealed that a single amino acid change (R312A) in VP35 renders the protein unable to inhibit IRF-3 activation. A reverse-genetics-generated, mouse-adapted, recombinant Ebola virus that encodes the R312A mutation in VP35 was produced. We found that relative to the case for wild-type virus containing the authentic VP35 sequence, this single amino acid change in VP35 renders the virus completely attenuated in mice. Given that these viruses differ by only a single amino acid in the IRF-3 inhibitory domain of VP35, the level of alteration of virulence is remarkable and highlights the importance of VP35 for the pathogenesis of Ebola virus.

The VP35 protein of Zaire Ebola virus is an essential component of the viral RNA polymerase complex and also functions to antagonize the cellular type I interferon (IFN) response by blocking activation of the transcription factor IRF-3. We previously mapped the IRF-3 inhibitory domain within the C terminus of VP35. In the present study, we show that mutations that disrupt the IRF-3 inhibitory function of VP35 do not disrupt viral transcription/replication, suggesting that the two functions of VP35 are separable. Second, using reverse genetics, we successfully recovered recombinant Ebola viruses containing mutations within the IRF-3 inhibitory domain. Importantly, we show that the recombinant viruses were attenuated for growth in cell culture and that they activated IRF-3 and IRF-3-inducible gene expression at levels higher than that for Ebola virus containing wild-type VP35. In the context of Ebola virus pathogenesis, VP35 may function to limit early IFN-β production and other antiviral signals generated from cells at the primary site of infection, thereby slowing down the host's ability to curb virus replication and induce adaptive immunity.

Ebola virus (EBOV) infection blocks cellular production of alpha/beta interferon (IFN-alpha/beta) and the ability of cells to respond to IFN-alpha/beta or IFN-gamma. The EBOV VP35 protein has previously been identified as an EBOV-encoded inhibitor of IFN-alpha/beta production. However, the mechanism by which EBOV infection inhibits responses to IFNs has not previously been defined. Here we demonstrate that the EBOV VP24 protein functions as an inhibitor of IFN-alpha/beta and IFN-gamma signaling. Expression of VP24 results in an inhibition of IFN-induced gene expression and an inability of IFNs to induce an antiviral state. The VP24-mediated inhibition of cellular responses to IFNs correlates with the impaired nuclear accumulation of tyrosine-phosphorylated STAT1 (PY-STAT1), a key step in both IFN-alpha/beta and IFN-gamma signaling. Consistent with this proposed function for VP24, infection of cells with EBOV also confers a block to the IFN-induced nuclear accumulation of PY-STAT1. Further, VP24 is found to specifically interact with karyopherin alpha1, the nuclear localization signal receptor for PY-STAT1, but not with karyopherin alpha2, alpha3, or alpha4. Overexpression of VP24 results in a loss of karyopherin alpha1-PY-STAT1 interaction, indicating that the VP24-karyopherin alpha1 interaction contributes to the block to IFN signaling. These data suggest that VP24 is likely to be an important virulence determinant that allows EBOV to evade the antiviral effects of IFNs.

Integration of a DNA copy of the retroviral genome into cellular DNA is a critical step in the retrovirus life cycle and in the pathogenesis of retrovirus infections. Formation of an integrated provirus requires that the viral integrase act on its two DNA substrates with different levels of specificity. When preparing the viral DNA for integration, two nucleotides that follow conserved CA bases at the 3′ ends of each DNA strand are removed by integrase; this site-specific endonuclease reaction is referred to as processing. In contrast, integrase can insert the processed viral DNA ends into almost any site in cellular DNA; this second endonuclease reaction is referred to as DNA joining or strand transfer. Both of these actions can be modeled in vitro by using purified integrase and oligonucleotides that represent the viral DNA ends (Fig. ​(Fig.1A1A and B) (8, 17, 20). Although any accessible site in nonviral DNA can be used as the target for viral DNA insertion, preferences are noted in vitro and in vivo (7, 19, 32, 33, 39, 43). Characteristics of cellular DNA that affect the susceptibility of target sites were reviewed recently (6, 16, 19). For example, integration preferentially occurs into phosphodiester bonds at areas of DNA distortion on the outside of DNA bends; DNA sequence might play an additional minor role in susceptibility. Understanding how integrase recognizes these features of cellular DNA and identifying the part or parts of integrase responsible for any selectivity in choosing target sites are important for modeling integration, for developing methods of targeted gene delivery that are based on retroviral integration, and for designing a new class of antiretroviral agents that interfere with these enzyme-substrate interactions. FIG. 1. Integrase assays. The names of the assays are shown above the horizontal arrows, and the key aspects of the readouts (e.g., the position of the radiolabel or the pairing of PCR primers) are shown below the arrows. The CA bases near the 3′ ends ... Studies using chimeric integrases involving human immunodeficiency virus type 1 (HIV-1), feline immunodeficiency virus, and visna virus indicate that the central domain of integrase plays a major role in selecting the target sites for insertion of viral DNA ends. This conclusion was based on results obtained with the standard oligonucleotide joining assay (Fig. ​(Fig.1B)1B) (24) as well as with a PCR-based assay that monitors insertion of viral DNA ends into a longer plasmid DNA target (Fig. ​(Fig.1C)1C) (2, 12, 25, 38). Moreover, the central domain of integrase was solely responsible for the selection of nonviral target sites when chimeric integrases used exogenous alcohols, rather than processed viral DNA ends, as the nucleophilic donor for nicking nonviral DNA (Fig. ​(Fig.1D)1D) (22, 24, 25). In fact, the isolated central fragment of HIV-1 integrase (from residues 50 to 186) exhibited the same target site preferences in this nonspecific alcoholysis assay, which has many similarities to the joining reaction (25), as did the full-length 288-amino-acid HIV-1 protein. Thus, this region of approximately 140 amino acids is capable of binding and positioning nonviral DNA for nucleophilic attack. Within the central domain of integrase, many amino acids can be replaced without affecting target site preferences (2, 13). However, we recently identified residue 119, the second amino acid in the α2 helix in the central domain of HIV-1 integrase, as strongly affecting the choice of nonviral target DNA sites (13). This residue was identified by a novel approach that involved screening a large set of patient-derived HIV-1 integrase variants for alterations in nonviral target site selection, comparing the sequences of proteins that exhibited similar target site preferences, and using this information to guide mutagenesis of a laboratory HIV-1 integrase (13). In fact, HIV-1 integrases with any of five different amino acids (Ser, Thr, Gly, Ala, or Lys) at position 119 exhibited five different patterns of target site selection in nonviral DNA. To test the hypothesis that these results are generalizable to other retroviral integrases, we have now assessed the role of the analogous protein residue in the integrases from a nonprimate lentivirus (visna virus) and a more distantly related alpharetrovirus (Rous sarcoma virus [RSV], formerly classified in the Oncovirinae retrovirus subfamily). Because the preferred sites of viral DNA insertion can differ depending on whether Mn2+ or Mg2+ is present during reactions (13), it was important that each of these divalent metal cations be used for these analyses. To introduce amino acid substitutions into integrase, we used the QuikChange site-directed mutagenesis system (Stratagene, La Jolla, Calif.) with pQE-30 plasmids (Qiagen, Chatsworth, Calif.) that encoded the wild-type integrases, as described previously (13, 41). The entire integrase-coding region for all proteins was confirmed by DNA sequencing, and proteins were purified from M15[pREP4] bacteria (Qiagen) (13). The purified proteins were tested under conditions known to optimize activity for visna virus and RSV integrase, including the use of oligonucleotides derived from the U3 end of viral DNA (21, 22, 42). Conditions for the standard oligonucleotide-based assays (Fig. 1A, B, and D) were as described previously (13) but included either 10 mM Mn2+ or 5 mM Mg2+. In the case of visna virus integrase and its derivatives, reactions that included Mg2+ were supplemented with 30% dimethyl sulfoxide (DMSO) because of our previous demonstration that this maneuver enhances the Mg2+-dependent activity of visna virus integrase (31). For the plasmid insertion assays (Fig. ​(Fig.1C)1C) (26, 34), double-stranded 30/32-mers representing the preprocessed U3 end of viral DNA were incubated under the same reaction conditions but in the presence of 0.5 μg of φX174 DNA (Invitrogen, Carlsbad, Calif.) that had been linearized with SstII. The insertion reactions were stopped by fivefold dilution into 40 μl of 10 mM Tris-HCl (pH 8.0)-1 mM EDTA, and 7 μl was transferred to a tube for PCR. PCR was conducted in 25-μl reaction mixtures that contained 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 0.2 or 0.4 mM each deoxynucleoside triphosphate, 2 mM MgCl2, 1 U of Taq polymerase (Fisher, Pittsburgh, Pa.), and 15 pmol each of primer P1, which matched the viral donor DNA strand (for visna virus, 5′CAGGGTAGGCATTTGTTCTCTGTCCTGACA3′; for RSV, 5′AAGACTACAAGAGTATTGCATAAGACTACA3′), and primer P2, which was derived from φX174 (5′GGCGACCATTCAAAGGATAAACAT3′). The reaction mixtures underwent 35 cycles at 95°C for 45 s and 65°C for 3 min, with a final extension at 72°C for 10 min. Subsequently, 3 μl of each PCR was transferred to a 10-ul nested runoff reaction that contained 0.24 pmol of 5′ 32P-labeled φX174 primer P3 (5′GGCAGTCGGGAGGGTAGTCGG3′) and 1 U of Taq polymerase under the same buffer conditions as for PCR but for one cycle of 95°C for 2.5 min, 55°C for 4 min, and 72°C for 20 min. All reactions were analyzed by autoradiography after electrophoresis on denaturing polyacrylamide gels (20% gels for the processing, joining, and alcoholysis assays and 6% gels for the PCR-based insertion assay).

The capacity of influenza A viruses to cross species barriers presents a continual threat to human and animal health. Knowledge of the human-swine interface is particularly important for understanding how viruses with pandemic potential evolve in swine hosts. We sequenced the genomes of 141 influenza viruses collected from North American swine during 2002 to 2011 and identified a swine virus that possessed all eight genome segments of human seasonal A/H3N2 virus origin. A molecular clock analysis indicates that this virus—A/sw/Saskatchewan/02903/2009(H3N2)—has likely circulated undetected in swine for at least 7 years. For historical context, we performed a comprehensive phylogenetic analysis of an additional 1,404 whole-genome sequences from swine influenza A viruses collected globally during 1931 to 2013. Human-to-swine transmission occurred frequently over this time period, with 20 discrete introductions of human seasonal influenza A viruses showing sustained onward transmission in swine for at least 1 year since 1965. Notably, human-origin hemagglutinin (H1 and H3) and neuraminidase (particularly N2) segments were detected in swine at a much higher rate than the six internal gene segments, suggesting an association between the acquisition of swine-origin internal genes via reassortment and the adaptation of human influenza viruses to new swine hosts. Further understanding of the fitness constraints on the adaptation of human viruses to swine, and vice versa, at a genomic level is central to understanding the complex multihost ecology of influenza and the disease threats that swine and humans pose to each other. IMPORTANCE The swine origin of the 2009 A/H1N1 pandemic virus underscored the importance of understanding how influenza A virus evolves in these animals hosts. While the importance of reassortment in generating genetically diverse influenza viruses in swine is well documented, the role of human-to-swine transmission has not been as intensively studied. Through a large-scale sequencing effort, we identified a novel influenza virus of wholly human origin that has been circulating undetected in swine for at least 7 years. In addition, we demonstrate that human-to-swine transmission has occurred frequently on a global scale over the past decades but that there is little persistence of human virus internal gene segments in swine.