Search

In contrast to the vast majority of the members of the domain Bacteria , several Pseudomonas and Xanthomonas species have two lexA genes, whose products have been shown to recognize different LexA binding motifs, making them an interesting target for studying the interplay between cohabiting LexA regulons in a single species. Here we report an analysis of the genetic composition of the two LexA regulons of Pseudomonas putida KT2440 performed with a genomic microarray. The data obtained indicate that one of the two LexA proteins (LexA1) seems to be in control of the conventional Escherichia coli -like SOS response, while the other LexA protein (LexA2) regulates only its own transcriptional unit, which includes the imuA, imuB , and dnaE2 genes, and a gene (PP_3901) from a resident P. putida prophage. Furthermore, PP_3901 is also regulated by LexA1 and is required for DNA damage-mediated induction of several P. putida resident prophage genes. In silico searches suggested that this marked asymmetry in regulon contents also occurs in other Pseudomonas species with two lexA genes, and the implications of this asymmetry in the evolution of the SOS network are discussed.

The SOS response is a transcriptional regulatory network governed by the LexA repressor that activates in response to DNA damage. In the Betaproteobacteria , LexA is known to target a palindromic sequence with the consensus sequence CTGT-N 8 -ACAG. We report the characterization of a LexA regulon in the iron-oxidizing betaproteobacterium Sideroxydans lithotrophicus . In silico and in vitro analyses show that LexA targets six genes by recognizing a binding motif with the consensus sequence GAACGaaCGTTC, which is strongly reminiscent of the Bacillus subtilis LexA-binding motif. We confirm that the closely related Gallionella capsiferriformans shares the same LexA-binding motif, and in silico analyses indicate that this motif is also conserved in the Nitrosomonadales and the Methylophilales . Phylogenetic analysis of LexA and the alpha subunit of DNA polymerase III (DnaE) reveal that the organisms harboring this noncanonical LexA form a compact taxonomic cluster within the Betaproteobacteria . However, their lexA gene is unrelated to the standard Betaproteobacteria lexA , and there is evidence of its spread through lateral gene transfer. In contrast to other reported cases of noncanonical LexA-binding motifs, the regulon of S. lithotrophicus is comparable in size and function to that of many other Betaproteobacteria , suggesting that a convergent SOS regulon has reevolved under the control of a new LexA protein. Analysis of the DNA-binding domain of S. lithotrophicus LexA reveals little sequence similarity with that of other LexA proteins targeting similar binding motifs, suggesting that network structure may limit site evolution or that structural constrains make the B. subtilis -type motif an optimal interface for multiple LexA sequences. IMPORTANCE Understanding the evolution of transcriptional systems enables us to address important questions in microbiology, such as the emergence and transfer potential of different regulatory systems to regulate virulence or mediate responses to stress. The results reported here constitute the first characterization of a noncanonical LexA protein regulating a standard SOS regulon. This is significant because it illustrates how a complex transcriptional program can be put under the control of a novel transcriptional regulator. Our results also reveal a substantial degree of plasticity in the LexA recognition domain, raising intriguing questions about the space of protein-DNA interfaces and the specific evolutionary constrains faced by these elements.

The Escherichia coli LexA protein was used as a query sequence in TBLASTN searches to identify the lexA gene of the δ-proteobacterium Geobacter sulfurreducens from its genome sequence. The results of the search indicated that G. sulfurreducens has two independent lexA genes designated lexA1 and lexA2 . A copy of a dinB gene homologue, which in E. coli encodes DNA polymerase IV, is present downstream of each lexA gene. Reverse transcription-PCR analyses demonstrated that, in both cases, lexA and dinB constitute a single transcriptional unit. Electrophoretic mobility shift assays with purified LexA1 and LexA2 proteins have shown that both proteins bind the imperfect palindrome GGTTN 2 CN 4 GN 3 ACC found in the promoter region of both lexA1 and lexA2 . This sequence is also present upstream of the Geobacter metallireducens lexA gene, indicating that it is the LexA box of this bacterial genus. This palindrome is not found upstream of either the G. sulfurreducens or the G. metallireducens recA genes. Furthermore, DNA damage induces expression of the lexA-dinB transcriptional unit but not that of the recA gene. However, the basal level of recA gene expression is dramatically higher than that of the lexA gene. Likewise, the promoters of the G. sulfurreducens recN , ruvAB , ssb , umuDC , uvrA , and uvrB genes do not contain the LexA box and are not likely to bind to the LexA1 or LexA2 proteins. G. sulfurreducens is the first bacterial species harboring a lexA gene for which a constitutive expression of its recA gene has been described.

Dehalococcoides ethenogenes is a member of the physiologically diverse division of green nonsulfur bacteria. Using a TBLASTN search, the D. ethenogenes lexA gene has been identified, cloned, and expressed and its protein has been purified. Mobility shift assays revealed that the D. ethenogenes LexA protein specifically binds to both its own promoter and that of the uvrA gene, but not to the recA promoter. Our results demonstrate that the D. ethenogenes LexA binding site is GAACN 4 GTTC, which is identical to that found in gram-positive bacteria. In agreement with this fact, the Bacillus subtilis DinR protein binds specifically to the D. ethenogenes LexA operator. This constitutes the first non-gram-positive bacterium exhibiting a LexA binding site identical to that of B. subtilis.

Systematic inactivation of pathways involved in DNA alkylation damage repair demonstrated that inactivation of the ada , ogt , tag , uvrA , and mfd genes is required to detect a Salmonella enterica virulence decrease. Furthermore, the fitness of S. enterica , defective in these genes, is lowered only when the bacterium is orally, but not intraperitoneally, inoculated.

The recA gene has been isolated from a large number of bacteria (19). Its product is a multifunctional protein which is best characterized by its role in DNA recombination (12). RecA does, however, also play a central role in regulating the SOS response to DNA damage. Many proteins induced as part of this response help the cell survive, by either directly repairing damaged DNA or allowing the cell to tolerate DNA lesions until they can be repaired efficiently (29). LexA protein is the common transcriptional repressor of SOS-regulated genes, which include both recA and lexA themselves (6). Blockage to replication or damage to DNA generates an inducing signal which, with the help of Ssb protein, results in the activation of RecA coprotease functions (13, 14, 25). In its coprotease-proficient state, RecA mediates the efficient posttranslational cleavage and inactivation of the LexA repressor. Inducible DNA repair systems are apparently quite common and have been described in several bacteria (19). The Escherichia coli LexA protein binds to a specific region situated upstream of the SOS genes. Alignment of various SOS-regulated genes generated the consensus sequence CTG(TA)5CAG, known as the E. coli SOS box (31). Similar E. coli-like SOS boxes have been identified in the promoter regions of many recA and lexA genes from gram-negative bacteria (7, 19). Likewise, and by comparing promoter regions of several din (damage inducible) genes, the GAACN7GTTC palindrome has been proposed as the Bacillus subtilis SOS box (3). Recent data indicate that, in fact, the B. subtilis SOS box is slightly larger and has a consensus sequence of CGAACRNRYGTTYC (33). Many gram-positive bacterial species, such as Mycobacterium tuberculosis, Mycobacterium leprae, Streptococcus pneumoniae, and Clostridium perfringens, among others, have a B. subtilis-like SOS box upstream of their recA gene (4, 9, 20, 21). B. subtilis and M. tuberculosis LexA-like proteins have been purified, and binding to their respective SOS boxes has been previously demonstrated (18, 20, 32). Other bacterial SOS boxes, such as that belonging to Rhizobium etli, remain to be elucidated. We have previously reported that the R. etli recA gene is DNA damage inducible (5) and have demonstrated that the TTG and CAA motifs found in the TTGCGAGAGTGGAACAA (TTGN11CAA) sequence, upstream of the R. etli recA gene, are necessary for DNA damage-mediated induction (28). Interestingly, our data indicated that the TTG motif seemed to be less important than CAA. So, the effect of the substitution of the TTG motif, in both formation of a DNA-protein complex in vitro and recA DNA damage mediated in vivo, was weaker, which was a consequence of changing the CAA motif (28). By comparison, there was only a slight decrease in these two parameters when the TTG motif was changed. These findings therefore led us to systematically determine the role of each nucleotide base in the TTGN11CAA sequence, which appears to control R. etli recA gene expression.

The transcriptional response of Acinetobacter baumannii , a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene ( umuDAb ) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii .

RecA is the major enzyme involved in homologous recombination and plays a central role in SOS mutagenesis. In Acinetobacter spp., including Acinetobacter baumannii , a multidrug-resistant bacterium responsible for nosocomial infections worldwide, DNA repair responses differ in many ways from those of other bacterial species. In this work, the function of A. baumannii RecA was examined by constructing a recA mutant. Alteration of this single gene had a pleiotropic effect, showing the involvement of RecA in DNA damage repair and consequently in cellular protection against stresses induced by DNA damaging agents, several classes of antibiotics, and oxidative agents. In addition, the absence of RecA decreased survival in response to both heat shock and desiccation. Virulence assays in vitro (with macrophages) and in vivo (using a mouse model) similarly implicated RecA in the pathogenicity of A. baumannii . Thus, the data strongly suggest a protective role for RecA in the bacterium and indicate that inactivation of the protein can contribute to a combined therapeutic approach to controlling A. baumannii infections.

Footprinting and mutagenesis experiments demonstrated that Leptospira interrogans LexA binds the palindrome TTTGN 5 CAAA found in the recA promoter but not in the lexA promoter. In silico analysis revealed that none of the other canonical SOS genes is under direct control of LexA, making the leptospiral lexA gene the first described which is not autoregulated.

MC-1 is a marine, magnetotactic bacterium that is phylogenetically associated with the alpha subclass of the Proteobacteria and is the first and only magnetotactic coccus isolated in pure culture to date. By using a TBLASTN search, a lexA gene was identified in the published genome of MC-1; it was subsequently cloned, and the protein was purified to >90% purity. Results from reverse transcription-PCR analysis revealed that the MC-1 lexA gene comprises a single transcriptional unit with two open reading frames encoding proteins of unknown function and with a rumA -like gene, a homologue of the Escherichia coli umuD gene. Mobility shift assays revealed that this LexA protein specifically binds both to its own promoter and to that of the umuDC operon. However, MC-1 LexA does not bind to the promoter regions of other genes, such as recA and uvrA , that have been previously reported to be regulated by LexA in bacterial species belonging to the alpha subclass of the Proteobacteria . Site-directed mutagenesis of both the lexA and umuDC operator regions demonstrated that the sequence CCTN 10 AGG is the specific target motif for the MC-1 LexA protein.

The Escherichia coli LexA protein was used as a query sequence in TBLASTN searches to identify the lexA gene of the delta-proteobacterium Geobacter sulfurreducens from its genome sequence. The results of the search indicated that G. sulfurreducens has two independent lexA genes designated lexA1 and lexA2. A copy of a dinB gene homologue, which in E. coli encodes DNA polymerase IV, is present downstream of each lexA gene. Reverse transcription-PCR analyses demonstrated that, in both cases, lexA and dinB constitute a single transcriptional unit. Electrophoretic mobility shift assays with purified LexA1 and LexA2 proteins have shown that both proteins bind the imperfect palindrome GGTTN(2)CN(4)GN(3)ACC found in the promoter region of both lexA1 and lexA2. This sequence is also present upstream of the Geobacter metallireducens lexA gene, indicating that it is the LexA box of this bacterial genus. This palindrome is not found upstream of either the G. sulfurreducens or the G. metallireducens recA genes. Furthermore, DNA damage induces expression of the lexA-dinB transcriptional unit but not that of the recA gene. However, the basal level of recA gene expression is dramatically higher than that of the lexA gene. Likewise, the promoters of the G. sulfurreducens recN, ruvAB, ssb, umuDC, uvrA, and uvrB genes do not contain the LexA box and are not likely to bind to the LexA1 or LexA2 proteins. G. sulfurreducens is the first bacterial species harboring a lexA gene for which a constitutive expression of its recA gene has been described.

The tetracycline resistance regulatory gene (tetR) of transposon Tn10 was analyzed by a combination of methods involving gene fusion and cloning. This gene is located on a 695-base pair HincII DNA fragment near the center of Tn10. The direction of transcription is opposite to that of neighboring gene tetA, which encodes the TetA protein. The gene product of the tetR gene (the TetR protein) has a molecular weight of 23,000. tet-R-lacZ gene fusions encode fusion beta-galactosidases that are membrane bound, indicating that the TetR protein itself is membrane associated. Mutants defective in tetR result in constitutive tetracycline resistance, but the level of resistance is reduced. Expression of the tetR gene is induced by tetracycline; in the absence of tetracycline, the TetR protein turns off its own synthesis.