Search

Objectives Clinical experience in the use of teicoplanin for treating enterococcal infective endocarditis (EIE) is scarce. The aim of this study was to describe the characteristics and outcomes of patients with EIE treated with teicoplanin monotherapy compared to standard therapy with ampicillin plus ceftriaxone. Methods All consecutive adult patients diagnosed with EIE between January 2018 and September 2022 at a referral centre were reviewed. Characteristics of individuals treated with teicoplanin for ≥14 days [the treated with teicoplanin (TT) group] were compared with those who received ampicillin plus ceftriaxone (AC group). Results Sixty-six patients were included [61 (92%) E. faecalis infective endocarditis (IE) and 5 (8%) E. faecium IE]. Twenty-seven (41%) received teicoplanin: eight as first-line treatment and 19 as continuation therapy. The median duration of teicoplanin treatment was 30 (25–43) days. Surgery was indicated in 14/27 (52%) in the TT group and in 21/39 (54%) in the AC group, but was finally performed in 11/14 (79%) and 13/21 (62%) (P  = 0.46), respectively. In-hospital mortality rate was 3/27 (11%) in the TT group and 12/39 (31%) in the AC group (P  = 0.06). Patients treated with teicoplanin were more often discharged on outpatient parenteral antibiotic therapy [18/27 (67%) versus 6/39 (15%), P  < 0.001] and median hospital stay was shorter [29 days (IQR 20–61) versus 50 days (IQR 43–68), P  = 0.006]. One-year cumulative mortality was 8/27 (30%) in the TT group and 13/39 (33%) in the AC group (P  = 0.46). There was one relapse in each group. Conclusion Teicoplanin seems an effective treatment for selected patients with enterococcal IE, mainly to facilitate discharge. [ABSTRACT FROM AUTHOR]

Background VRE are increasingly described worldwide. Screening of hospitalized patients at risk for VRE carriage is mandatory to control their dissemination. Here, we have developed the Bfast [VRE Panel] PCR kit, a rapid and reliable quantitative PCR assay for detection of vanA , vanB , vanD and vanM genes, from solid and liquid cultures adaptable to classical and ultrafast real-time PCR platforms. Methods Validation was carried out on 133 well characterized bacterial strains, including 108 enterococci of which 64 were VRE. Analytical performances were determined on the CFX96 Touch (Bio-Rad) and Chronos Dx (BforCure), an ultrafast qPCR machine. Widely used culture plates and broths for enterococci selection/growth were tested. Results All targeted van alleles (A, B, D and M) were correctly detected without cross-reactivity with other van genes (C, E, G, L and N) and no interference with the different routinely used culture media. A specificity and sensitivity of 100% and 99.7%, respectively, were determined, with limits of detection ranging from 21 to 238 cfu/reaction depending on the targets. The Bfast [VRE Panel] PCR kit worked equally well on the CFX and Chronos Dx platforms, with differences in multiplexing capacities (five and four optical channels, respectively) and in turnaround time (45 and 16 minutes, respectively). Conclusions The Bfast [VRE Panel] PCR kit is robust, easy to use, rapid and easily implementable in clinical microbiology laboratories for ultra-rapid confirmation of the four main acquired van genes. Its features, especially on Chronos Dx, seem to be unmatched compared to other tools for screening of VRE. [ABSTRACT FROM AUTHOR]

Objectives To investigate the global distribution of an optrA -harbouring linezolid-resistant Enterococcus faecalis ST476 clonal lineage. Methods Comprehensive searches of the NCBI database were performed to identify published peer-reviewed articles and genomes of E. faecalis ST476. Each genome was analysed for resistome, virulome, OptrA variant and optrA genetic contexts. A phylogenetic comparison of ST476 genomes with publicly available genomes of other STs was also performed. Results Sixty-six E. faecalis ST476 isolates from 15 countries (China, Japan, South Korea, Austria, Denmark, Spain, Czech Republic, Colombia, Tunisia, Italy, Malaysia, Belgium, Germany, United Arab Emirates and Switzerland) mainly of human and animal origin were identified. Thirty available ST476 genomes compared with genomes of 591 STs indicated a progressive radiation of E. faecalis STs starting from ST21. The closest ancestral node for ST476 was ST1238. Thirty E. faecalis ST476 genomes exhibited 3–916 SNP differences. Several antimicrobial resistance and virulence genes were conserved among the ST476 genomes. The optrA genetic context exhibited a high degree of or complete identity to the chromosomal transposon Tn 6674. Only three isolates displayed an optrA -carrying plasmid with complete or partial Tn 6674. The WT OptrA protein was most widespread in the ST476 lineage. Conclusions Linezolid-resistant optrA -carrying E. faecalis of the clonal lineage ST476 is globally distributed in human, animal and environmental settings. The presence of such an emerging clone can be of great concern for public health. Thus, a One Health approach is needed to counteract the spread and the evolution of this enterococcal clonal lineage. [ABSTRACT FROM AUTHOR]

Objectives To investigate the genomic diversity and β-lactam susceptibilities of Enterococcus faecalis collected from patients with infective endocarditis (IE). Methods We collected 60 contemporary E. faecalis isolates from definite or probable IE cases identified between 2018 and 2021 at the University of Pittsburgh Medical Center. We used whole-genome sequencing to study bacterial genomic diversity and employed antibiotic checkerboard assays and a one-compartment pharmacokinetic–pharmacodynamic (PK/PD) model to investigate bacterial susceptibility to ampicillin and ceftriaxone both alone and in combination. Results Genetically diverse E. faecalis were collected, however, isolates belonging to two STs, ST6 and ST179, were collected from 21/60 (35%) IE patients. All ST6 isolates encoded a previously described mutation upstream of penicillin-binding protein 4 (pbp4) that is associated with pbp4 overexpression. ST6 isolates had higher ceftriaxone MICs and higher fractional inhibitory concentration index values for ampicillin and ceftriaxone (AC) compared to other isolates, suggesting diminished in vitro AC synergy against this lineage. Introduction of the pbp4 upstream mutation found among ST6 isolates caused increased ceftriaxone resistance in a laboratory E. faecalis isolate. PK/PD testing showed that a representative ST6 isolate exhibited attenuated efficacy of AC combination therapy at humanized antibiotic exposures. Conclusions We find evidence for diminished in vitro AC activity among a subset of E. faecalis IE isolates with increased pbp4 expression. These findings suggest that alternate antibiotic combinations against diverse contemporary E. faecalis IE isolates should be evaluated. [ABSTRACT FROM AUTHOR]

Background Bacterial membrane vesicles (BMVs) are novel vehicles of antibiotic resistance gene (ARG) transfer in Gram-negative bacteria, but their role in the spread of ARGs in Gram-positive bacteria has not been defined. The purpose of this study was to evaluate the role of MVs in the transmission of antimicrobial resistance in Gram-positive bacteria. Methods A linezolid-resistant Enterococcus faecalis CQ20 of swine origin was selected as the donor strain. Linezolid-susceptible E. faecalis SC032 of human origin, Enterococcus faecium BM4105 and Escherichia coli were selected as recipient strains. The presence of plasmids (pCQ20-1 and pCQ20-2) and an optrA -carrying transposon Tn 6674 in CQ20, MVs and vesiculants was verified by WGS or PCR. MVs were isolated with density gradient centrifugation, and MV-mediated transformation was performed to assess the horizontal transferability of MVs. The MICs for CQ20 and its vesiculants were determined by the broth microdilution method. Results CQ20-derived MVs (CQ20-MV) were isolated, and PCR identified the presence of two plasmids and the optrA gene in the CQ20-MVs. MV-mediated transformation to E. faecalis SC032 and E. faecium BM4105 was successfully performed, and the WGS data also showed that both plasmids pCQ20-1 and pCQ20-2 and optrA -carrying transposon Tn 6674 were transferred to E. faecalis SC032 and E. faecium BM4105, but failed for E. coli. Additionally, vesiculants that had acquired ARGs still had the ability to spread these genes via MVs. Conclusions To our knowledge, this is the first report of MV-mediated co-transfer of ARG-carrying plasmids and transposons in the Gram-positive bacterium E. faecium. [ABSTRACT FROM AUTHOR]

A recent study in Brazil has identified a strain of vancomycin-resistant Enterococcus faecium (VREfm) in companion animals, specifically a Rottweiler dog. VREfm is a medically significant pathogen that is typically associated with infections in humans. The strain, known as ICBPETVRE, exhibited resistance to multiple antibiotics but remained susceptible to certain drugs. The study suggests that there may be a potential for transmission of VREfm between humans and companion animals, highlighting the need for increased awareness and screening in veterinary practice. [Extracted from the article]

Background In recent years, an increasing number of linezolid-resistant enterococci (LRE) was recognized at the German National Reference Centre (NRC) for Enterococci. National guidelines on infection prevention recommend screening for LRE in epidemiologically linked hospital settings without referring to a reliable and rapid diagnostic method. Since 2020, CHROMAgar™ provide a chromogenic linezolid screening agar, LIN-R, suitable to simultaneously screen for linezolid-resistant staphylococci and enterococci. Objectives To assess the applicability of CHROMAgar™ LIN-R in clinical settings for detecting LRE directly from patient material and to infer prevalence rates of LRE amongst German hospital patients. Methods During the 3-month trial period, clinical samples were plated on CHROMAgar™ LIN-R. Antimicrobial susceptibility testing was performed using VITEK2 or disc diffusion. At the NRC, linezolid resistance was determined by broth microdilution, multiplex-PCR for cfr/optrA/poxtA and by a restriction-based assay for 23S rDNA mutations. Results The 12 participating study sites used 13 963 CHROMAgar™ LIN-R plates during the study period. Of 442 presumptive LRE, 192 were confirmed by phenotypic methods. Of these, 161 were received by the NRC and 121 (75%) were verified as LRE. Most of LR- E. faecium 53/81 (65%) exhibited a 23S rRNA gene mutation as the sole resistance-mediating mechanism, whereas optrA constituted the dominant resistance trait in LR- E. faecalis [39/40 (98%)]. Prevalence of LRE across sites was estimated as 1% (ranging 0.18%–3.7% between sites). Conclusions CHROMAgar™ LIN-R represents a simple and efficient LRE screening tool in hospital settings. A high proportion of false-positive results demands validation of linezolid resistance by a reference method. [ABSTRACT FROM AUTHOR]

In recent years, publications and debate have emerged in the scientific literature that have linked the use of ionophore coccidiostats, which are themselves not medically important and not related to any therapeutic antibiotics used in human and animal medicine, to resistance development to medically important antibiotics in Enterococcus faecium and Enterococcus faecalis , isolated from broilers and broiler meat. This has been based on the discovery of genes, now named NarAB, that appear to result in elevated MICs of the ionophores narasin, salinomycin and maduramycin and that these are linked to genes responsible for resistance to antibiotics that may be clinically relevant in human medicine. This article will seek to review the most significant publications in this regard and will also examine national antimicrobial resistance surveillance programmes in Norway, Sweden, Denmark and the Netherlands, in order to further evaluate this concern. The conclusion of the review is that the risk that enterococci may pass from broilers to humans and that antimicrobial resistance gene transfer may occur is negligible, remains unquantified and is highly unlikely to be of significance to human health. Indeed, to date no human nosocomial infections have been linked to poultry sources. Concurrently a review of the possible impact of a policy that limits access for poultry farmers and poultry veterinarians to ionophore coccidiostats in broilers indicates predictable negative consequences with regard to antibiotic resistance of significance to animal welfare and to human health. [ABSTRACT FROM AUTHOR]

This article, published in the Journal of Antimicrobial Chemotherapy, discusses the characterization of a non-functional erm(T) gene in a clinical strain of Enterococcus faecium. The erm(T) gene is typically associated with inducible erythromycin resistance in lactobacilli, streptococci, and staphylococci. However, this study identified an erythromycin-susceptible E. faecium strain that harbored a defective erm(T) gene. Whole-genome sequencing revealed that the strain belonged to clonal complex CC17 and that the erm(T) gene was located on a chromosomal integrative and conjugative element. This is the first report of a non-functional erm(T) gene with rearrangements in the leader peptide and coding sequence, potentially explaining the strain's erythromycin susceptibility. The study was supported by a grant from MIUR-Italy. [Extracted from the article]

SDSE V305 was screened by PCR for the presence of known oxazolidinone resistance genes;[7] the strain carried the I cfr i (D) and I poxtA i genes. Inverse PCR experiments, using outward-directed primer pairs targeting the I poxtA i and I fexA i genes (5' - TTGGATTTTTGTCCGCCTGAA - 3' and 5' - TTGCCCCGAACCTCCCATTG - 3', respectively) (Figure 1b), yielded a 3213 bp amplicon in both pV386 and pSdyV305, i.e. the circular form of the I cfr i (D)/ I poxtA2 i / I fexA i -carrying region. In pSdyV305, following the insertion of the I cfr i (D)/ I poxtA2 i / I fexA i -carrying region within the I repB i gene, 31 bp of the WT gene were replaced by 33 new nucleotides. [Extracted from the article]

Aminopenicillins have been widely used for decades for the treatment of various infections in animals and humans in European countries. Following this extensive use, acquired resistance has emerged among human and animal pathogens and commensal bacteria. Aminopenicillins are important first-line treatment options in both humans and animals, but are also among limited therapies for infections with enterococci and Listeria spp. in humans in some settings. Therefore, there is a need to assess the impact of the use of these antimicrobials in animals on public and animal health. The most important mechanisms of resistance to aminopenicillins are the β-lactamase enzymes. Similar resistance genes have been detected in bacteria of human and animal origin, and molecular studies suggest that transmission of resistant bacteria or resistance genes occurs between animals and humans. Due to the complexity of epidemiology and the near ubiquity of many aminopenicillin resistance determinants, the direction of transfer is difficult to ascertain, except for major zoonotic pathogens. It is therefore challenging to estimate to what extent the use of aminopenicillins in animals could create negative health consequences to humans at the population level. Based on the extent of use of aminopenicillins in humans, it seems probable that the major resistance selection pressure in human pathogens in European countries is due to human consumption. It is evident that veterinary use of these antimicrobials increases the selection pressure towards resistance in animals and loss of efficacy will at minimum jeopardize animal health and welfare. [ABSTRACT FROM AUTHOR]

Objectives To investigate the molecular characteristics and transferability of plasmid-borne linezolid resistance genes optrA , cfr , poxtA2 and cfr (D) genes in one linezolid-resistant Enterococcus faecalis DM86 from retail meat. Methods E. faecalis DM86 was screened for the presence of known linezolid resistance genes via PCR analysis. Conjugation experiments were used to evaluate the transferability of the resistance genes. The complete genome of E. faecalis DM86 was obtained using both the Illumina and Nanopore platforms. Results Analysis of the complete sequence showed that E. faecalis DM86 belonged to sequence type 116 (ST116). Four linezolid resistance genes were identified on three plasmids, designated as pDM86-2-cfr, pDM86-3-optrA and pDM86-4-poxtA [ cfr (D) co-located]. IS 1216 mobile elements were found to flank the cfr and optrA locus on these two plasmids. pDM86-3-optrA encoded the RDK-type OptrA protein and a common genetic array of 'IS 1216 - fexA - optrA - erm (A)-IS 1216 ' was identified on this plasmid. The cfr (D) gene was closely associated with the poxtA2 gene on pDM86-4-poxtA, and similar plasmids and structures were reported recently in the E. faecalis of animal origin. The intra- and inter-species horizontal transferability of this plasmid to E. faecalis JH2-2, Enterococcus faecium BM4105RF and Staphylococcus aureus RN4220 was also proved, with a frequency of 2.8 × 10−3, 1.7 × 10−3 and 3.4 × 10−5, respectively. Conclusions This was the first report of the co-existence of up to four plasmid-borne linezolid resistance genes in one E. faecalis. Thus, efficient actions should be exerted to circumvent the microbiota contamination of food and the further spread of these antimicrobial resistance reservoirs. [ABSTRACT FROM AUTHOR]

Objectives To set the tentative epidemiological cut-off values (TECOFFs) of contezolid for Staphylococcus aureus , Enterococcus faecalis , Enterococcus faecium , Streptococcus pneumoniae and Streptococcus agalactiae based on the distributions of inhibition zone diameters and MICs. Methods A total of 1358 non-duplicate clinical isolates of Gram-positive bacteria were collected from the patients across China from 2017 to 2020. The isolates were tested for susceptibility to contezolid and the comparator linezolid by broth microdilution and disc diffusion methods in three microbiology laboratories. The zone diameters and MICs of linezolid WT strains were used to set the WT TECOFFs of contezolid by normalized resistance interpretation calculations. Results Contezolid showed an aggregate MIC range from 0.03 to 8 mg/L and MIC90 value of 1–2 mg/L against all of the Gram-positive bacterial strains tested. The TECOFF of contezolid based on MIC distributions was 4 mg/L for both S. aureus and Enterococcus species, and 2 mg/L for S. pneumoniae and S. agalactiae. The TECOFF of contezolid based on zone diameter was 24 mm for S. aureus , 18 mm for E. faecalis , 20 mm for E. faecium and S. pneumoniae , and 17 mm for S. agalactiae. Conclusions The epidemiological cut-off values of contezolid were set tentatively for selected Gram-positive bacteria using the MIC and zone diameter distributions. These data are helpful for clinical microbiologists and clinicians to interpret the antimicrobial susceptibility results of contezolid. [ABSTRACT FROM AUTHOR]

Failure to detect a change in susceptibility in individual ABC-F deletion mutants could potentially reflect functional redundancy between the encoded proteins; consequently, we employed the same pIMAYZ constructs to sequentially delete all three ABC-F genes in a single strain of JE2. This pathogen is the prime exponent of acquired antibiotic resistance mediated by ARE ABC-F proteins,[1] and as indicated above, other members of the same genus are known to harbour native ARE ABC-Fs[5]; consequently, it seemed entirely possible that native ABC-Fs participate in intrinsic antibiotic resistance in I S. aureus i . [Extracted from the article]

Objectives In this study, the distribution of the oxazolidinone/phenicol resistance gene optrA and the mobile genetic elements involved in its dissemination were analysed among enterococcal isolates from a farrow-to-finish swine farm. Methods Enterococcus faecium and Enterococcus faecalis isolates were obtained from all pig production stages in the farm. The optrA -carrying E. faecium and E. faecalis isolates were subjected to PFGE and antimicrobial susceptibility testing. Complete sequences of the genetically unrelated optrA -carrying E. faecium and E. faecalis isolates were determined using Illumina HiSeq and MinION platforms. Results The optrA gene was present in 12.2% (23/188) of the E. faecium and E. faecalis isolates, most of which originated from nursery and finishing stages. The 23 optrA -positive Enterococcus isolates represented 15 PFGE types. WGS of representative isolates of the 15 PFGE types showed that optrA was carried by diverse genetic elements either located in the chromosomal DNA or on plasmids. A novel optrA -bearing genetic element was identified on two distinct multi-resistance plasmids from E. faecium. Two new hybrid plasmids carrying several resistance genes were found in two E. faecalis isolates. pC25-1-like plasmids and chromosomally integrated Tn 6674 and Tn 6823 -like transposons were prevalent in the remaining Enterococcus isolates. Conclusions The gene optrA was found in genetically unrelated E. faecium and E. faecalis isolates from the same farm. Analysis of the genetic contexts of optrA suggested that horizontal transfer including different plasmids and transposons played a key role in the dissemination of optrA in this farm. [ABSTRACT FROM AUTHOR]

Background Vancomycin and linezolid resistance among enterococci is an increasing problem due to a lack of alternative antibiotics. Early identification of vancomycin-resistant and linezolid-resistant strains can help prevent the spread of resistance to these antibiotics. Hence, early, rapid and accurate detection of vancomycin and linezolid resistance is critical. Objectives The resazurin microplate method (RMM) was developed for detecting vancomycin and linezolid susceptibility among Enterococcus faecalis (E. faecalis) and Enterococcus faecium (E. faecium) clinical isolates, and its performance was further evaluated. Methods A total of 209 non-duplicate clinical isolates and three strains from the faeces of domestic animals, including 142 E. faecalis (71 linezolid non-susceptible and 71 linezolid susceptible) and 70 E. faecium (23 vancomycin non-susceptible, 23 vancomycin susceptible, 12 linezolid non-susceptible and 12 linezolid susceptible), were tested using RMM. Results The susceptibility of E. faecium to vancomycin was detected within 5 h, with high susceptibility (23/23) and specificity (23/23). The susceptibility of E. faecalis and E. faecium to linezolid was detected within 4 h, with specificities of 98.59% and 100% and susceptibilities of 94.37% and 58.33% for E. faecalis and E. faecium , respectively. Conclusions RMM had a good positive predictive value for the detection of vancomycin-non-susceptible E. faecium and linezolid-non-susceptible E. faecalis. It thus has the potential to become an alternative method for the rapid screening of these resistant pathogens in clinical practice. [ABSTRACT FROM AUTHOR]

Objectives To describe two linezolid-resistant MRSA strains carrying the cfr (B) gene detected in the French National Reference Centre for staphylococci. Methods Two linezolid-resistant MRSA strains isolated from cystic fibrosis patients in two different French hospitals in 2017 and 2019 were examined to explore the mechanisms of linezolid resistance. Antimicrobial susceptibility was tested using broth microdilution and gradient strips. The genetic determinants of linezolid resistance were assessed by a multiplex PCR targeting cfr / cfr (B), optrA and poxtA genes, by amplification and sequencing of individual 23S rRNA genes and by WGS using both Illumina and Nanopore technologies. Results The two MRSA strains were resistant to linezolid but susceptible to tedizolid, and PCR-positive for cfr / cfr (B). The WGS analysis indicated that they belonged to two different STs (ST8-MRSA-IV and ST5382-MRSA-IV) and that they both harboured the cfr (B) gene on the same 9.7 kb Tn 6218 -like chromosomal transposon, a finding only previously reported in Enterococcus sp. and Clostridioides difficile. Conclusions To the best of our knowledge, this is the first description of the presence of cfr (B) in staphylococci, more specifically in linezolid-resistant MRSA strains. This finding illustrates the risk of horizontal intergenus transfer of oxazolidinone resistance genes in Staphylococcus aureus and highlights the need to monitor such emergence in this species. [ABSTRACT FROM AUTHOR]

Introduction Daptomycin is a bactericidal lipopeptide antibiotic approved for the treatment of systemic infections (i.e. skin and soft tissue infections, bloodstream infections, infective endocarditis) caused by Gram-positive cocci. It is often prescribed in association with a partner drug to increase its bactericidal effect and to prevent the emergence of resistant strains during treatment; however, its synergistic properties are still under evaluation. Methods We performed a systematic review to offer clinicians an updated overview of daptomycin synergistic properties from in vitro and in vivo studies. Moreover, we reported all in vitro and in vivo data evaluating daptomycin in combination with other antibiotic agents, subdivided by antibiotic classes, and a summary graph presenting the most favourable combinations at a glance. Results A total of 92 studies and 1087 isolates (723 Staphylococcus aureus , 68 Staphylococcus epidermidis , 179 Enterococcus faecium , 105 Enterococcus faecalis , 12 Enterococcus durans) were included. Synergism accounted for 30.9% of total interactions, while indifferent effect was the most frequently observed interaction (41.9%). Antagonistic effect accounted for 0.7% of total interactions. The highest synergistic rates against S. aureus were observed with daptomycin in combination with fosfomycin (55.6%). For S. epidermidis and Enterococcus spp. the most effective combinations were daptomycin plus ceftobiprole (50%) and daptomycin plus fosfomycin (63.6%) or rifampicin (62.8%), respectively. Future perspectives We believe this systematic review could be useful for the future updates of guidelines on systemic infections where daptomycin plays a key role. [ABSTRACT FROM AUTHOR]

Objectives: Since 2003, incidences of carbapenemase-producing Gram-negative bacilli (CP-GNB) and vancomycin-resistant Enterococcus faecium (VRE) have steadily increased in France. We therefore conducted a point prevalence study to estimate carriage rates of CP-GNB, VRE and ESBL-producing Enterobacterales (ESBL-PE) and associated risk factors.Methods: Between September 2019 and January 2020, all inpatients hospitalized on a given day in 11 teaching hospitals in the Paris urban area were eligible. Patient interviews and rectal swab screening results were recorded by dedicated nurses. The swabs were plated onto selective chromogenic media and processed using the GeneXpert® system.Results: Of 2396 patients, 364 (15.2%) yielded at least one multiresistant bacterial isolate, including 29 CP-GNB carriers (1.2%), 13 VRE carriers (0.5%) and 338 ESBL-PE carriers (14%). In 15 patients (4.4% of ESBL-PE carriers and 36.6% of CP-GNB/VRE carriers), concomitant CP-GNB/VRE and ESBL-PE carriage was observed. In 7/29 CP-GNB and 7/13 VRE carriers, carbapenemase production and vanA in the screening samples was only detected with Xpert® tests. The OXA-48 gene was predominant in 13/34 CP-GNB isolates from 29 carriers. From the 338 ESBL-PE carriers, 372 isolates were recovered, mainly Escherichia coli (61.2%). Among 379 children, 1.1% carried a CP-GNB/VRE strain, and 12.4% carried an ESBL strain. Previous hospitalization outside mainland France, previous antimicrobial treatment and previous ESBL-PE carriage were the main risk factors associated with CP-GNB and/or VRE carriage.Conclusions: The low CP-GNB and VRE prevalence likely reflects the French policy to limit intrahospital spread of CP-GNB and VRE strains. [ABSTRACT FROM AUTHOR]

Objectives: This study aimed to investigate the faecal carriage of enterococci harbouring oxazolidinone resistance genes among healthy humans in Switzerland and to genetically characterize the isolates.Methods: A total of 399 stool samples from healthy individuals employed in different food-processing plants were cultured on a selective medium containing 10 mg/L florfenicol. Resulting enterococci were screened by PCR for the presence of cfr, optrA and poxtA. A hybrid approach combining short-read and long-read WGS was used to analyse the genetic context of the cfr, optrA and poxtA genes.Results: Enterococcus faecalis (n = 6), Enterococcus faecium (n = 6), Enterococcus gallinarum (n = 1) and Enterococcus hirae (n = 2) were detected in 15/399 (3.8%) of the faecal samples. They carried cfr + poxtA, optrA, optrA + poxtA or poxtA. Four E. faecalis harbouring optrA and one E. faecium carrying poxtA were resistant to linezolid (8 mg/L). In most optrA-positive isolates, the genetic environments of optrA were highly variable, but often resembled previously described platforms. In most poxtA-positive isolates, the poxtA gene was flanked on both sides by IS1216E elements and located on medium-sized plasmids.Conclusions: Faecal carriage of Enterococcus spp. harbouring cfr, optrA and poxtA in healthy humans associated with the food-production industry demonstrates the possibility of spread of oxazolidinone resistance genes into the community. Given the importance of linezolid as a last-resort antibiotic for the treatment of serious infections caused by Gram-positive pathogens, the detection of the oxazolidinone resistance determinants in enterococci from healthy humans is of concern for public health. [ABSTRACT FROM AUTHOR]

Background: Tedizolid is a novel oxazolidinone antibiotic. Considering the higher antibacterial effect in immunocompetent compared with immunosuppressed animals, it is not recommended in immunocompromised patients.Objectives: In this study, we assessed the 'pure' pharmacokinetic-pharmacodynamic (PKPD) relationship for tedizolid against Enterococcus in the hollow-fibre infection model (HFIM).Methods: Unbound plasma concentration time profiles (200-5000 mg/day IV) were simulated in the HFIM over 120 h against an Enterococcus faecalis strain and two clinical isolates of Enterococcus faecium (VRE-vanB and VRE-vanA). Next, a PKPD model describing tedizolid efficacy against bacterial isolates was developed. A population PK model was linked to the developed PKPD model and utilized to predict the bacterial kinetics in plasma and in target tissues [adipose, muscle, epithelial lining fluid (ELF) and sputum] over 120 h of therapy.Results: The PKPD model adequately described the bacterial kill kinetics for all bacterial populations. At the human recommended dose of 200 mg/day, bacterial growth was predicted in plasma and all tissues, except for ELF. Bacteriostasis was observed only at a higher dose of 1200 mg/day over 120 h. An fAUC/MIC of 80 related to stasis over 120 h. Subpopulations resistant to 3 × MIC were amplified in plasma and target tissues, except for ELF, at doses of 200-800 mg/day.Conclusions: The human dose of 200 mg/day was insufficient to suppress bacterial growth in the HFIM, indicating that further components contribute to the clinical effect of tedizolid. This study supports the warning/precaution for tedizolid to limit its use in immunocompromised patients. [ABSTRACT FROM AUTHOR]

Objectives: To investigate transferability of the poxtA-carrying plasmids in Enterococcus faecium and the mechanism of recombination that occurs during the conjugation process.Methods: MICs were determined by broth microdilution. Transferability of the poxtA-carrying plasmids in E. faecium was investigated by conjugation. The mechanism of recombination that occurred during the conjugation process was explored by S1-PFGE and WGS.Results: E. faecium strain Fac90 carries two plasmids, designated pFac90-154 and pFac90-54, respectively. Six transconjugants with different characteristics were obtained. In transconjugant T90-1, a plasmid-chromosome fusion event led to the integration of plasmid pFac90-154 from the donor E. faecium strain Fac90 into the chromosomal DNA of the recipient strain Enterococcus faecalis JH2-2. In transconjugants T90-2, -3 and -4, losses or additions of different-sized plasmid segments most likely occurred due to IS1216-mediated recombination. In transconjugants T90-5 and -6, two large plasmids with sizes of 101 656 and 149 526 bp were formed by plasmid fusion.Conclusions: To the best of our knowledge, this is the first report showing the integration of pFac90-154 from E. faecium Fac90 into the chromosomal DNA of recipient E. faecalis JH2-2 via homologous recombination. Besides, we showed that five new plasmid types were formed by genetic rearrangements. These recombination events resulted simultaneously in the formation of various types of mosaic plasmids with multiple resistance genes and/or conjugation characteristics, which might promote the transmission of diverse plasmids encoding resistance genes among enterococci. Thus, these data significantly expand our knowledge regarding conjugative events, establishing a dual role of conjugation in both dissemination of resistance genes and plasmid evolution. [ABSTRACT FROM AUTHOR]

Objectives: Synergistic combinations of daptomycin and β-lactam antibiotics are currently recommended for treatment of VRE bloodstream infection (BSI). The efficacy of these combinations is jeopardized by VRE inherently resistant to β-lactam antibiotics. The combination of daptomycin and fosfomycin is recommended as an alternative therapy for VRE BSI; however, clinical data to support use of this combination are lacking.Patients and Methods: We conducted a prospective observational multicentre study of patients treated with a combination of daptomycin and fosfomycin for VRE BSI during 2016-20. The primary outcome was 28 day mortality. Multivariable logistic regression was performed for outcome analysis.Results: The study included 106 patients from 1112 VRE BSI episodes. The overall 28 day mortality was 40.6%. The median (IQR) daptomycin dose was 10.18 mg/kg (9.43-10.70). The fosfomycin dose was 16 g/day (8-22.5). Ninety-six isolates were available for MIC testing. The fosfomycin MIC was 32 mg/L in 6 (6.3%), 64 mg/L in 68 (70.8%) and ≥128 mg/L in 22 (22.9%) isolates. Independent of Charlson comorbidity index and Pitt bacteraemia score, fosfomycin MIC ≥128 mg/L [adjusted OR (aOR) = 3.05; 95% CI = 1.01-9.19; P = 0.047] and daptomycin dose (aOR = 0.64; 95% CI = 0.43-0.97; P = 0.04) predicted mortality.Conclusions: Higher daptomycin dose and susceptibility to fosfomycin were independently associated with lower mortality in patients with VRE BSI. Our results suggest that higher doses of daptomycin are indicated for VRE BSI, whether or not it is used in combination with fosfomycin. The combination was less effective for patients with fosfomycin-resistant isolates. [ABSTRACT FROM AUTHOR]

Objectives: To investigate the genetic elements and the transferability of linezolid resistance genes in three enterococci co-carrying cfr(D) and poxtA2 isolates from manure of a swine farm in central Italy.Methods: Two Enterococcus faecalis isolates and one Enterococcus casseliflavus isolate carrying both cfr(D) and poxtA genes were tested for their susceptibility to florfenicol, chloramphenicol, linezolid, tedizolid, tetracycline and vancomycin. Linezolid resistance genes transfer (filter mating), localization (S1-PFGE/hybridization), genetic elements and relatedness between isolates (WGS) were analysed.Results: Two E. faecalis isolates and one E. casseliflavus isolate carried the cfr(D) gene and the recently described poxtA2 variant. In the three enterococci, cfr(D) and poxtA2 were co-located on a 33 480 bp plasmid, pV386, 95%-100% identical (coverage 84%) to the Tn6349 transposon of Staphylococcus aureus AOUC-0915. In all isolates, both genes also showed a chromosomal location. Same sequence identities were found from the comparison with currently known poxtA2 genetic elements. In the plasmid pV386, poxtA2 gene was not bounded by two IS1216, as described in pIB-BOL, but closely associated to the cfr(D) and fexA genes. pV386 was always transferred by filter mating to Enterococcus faecium 64/3 recipient.Conclusions: The occurrence of the pV386 plasmid in E. faecalis and E. casseliflavus from swine manure is of great concern and highlights the need for control measures to contain its spread to other enterococcal species. [ABSTRACT FROM AUTHOR]

Objectives: To characterize a linezolid-resistant Enterococcus gallinarum isolate of porcine origin co-carrying cfr, optrA and poxtA genes.Methods: The genome was sequenced using the Illumina and Nanopore platforms. The presence of circular intermediates was examined by inverse PCR. Transferability of oxazolidinone resistance genes was investigated by transformation and conjugation.Results: Two plasmids, the cfr- and optrA-carrying pEgFS4-1 (35 kb) and the poxtA-harbouring pEgFS4-2 (38 kb), were identified. pEgFS4-1 disclosed a distinctive mosaic structure with two cargo regions bounded by identical IS1216 elements interpolated into a backbone related to that of Enterococcus faecium vanA-containing pVEF2. The first cargo region included the cfr and optrA contexts, whereas the second one carried a Tn554 remnant and the lnu(A) gene. Both regions were able to excise in circular form as a unique translocable unit. pEgFS4-2 plasmid was 99% identical to a not fully described E. faecium pSBC1 plasmid. The poxtA environment, flanked by IS1216, was proved to be unstable. pEgFS4-2 also exhibited another cargo region containing the tet(M)-tet(L) genes arranged in tandem and its circular form was detected. Transformation and conjugation experiments failed to demonstrate the transferability of both plasmids to enterococcal recipients. Both plasmids persisted in the absence of selective pressure.Conclusions: To the best of our knowledge, this is the first description of a linezolid-resistant E. gallinarum isolate of swine origin carrying cfr, optrA and poxtA genes. The co-presence of three linezolid resistance determinants in an intrinsically vancomycin-resistant enterococcal species is cause of concern. [ABSTRACT FROM AUTHOR]

Background: Vancomycin-resistant Enterococcus faecium (VREfm) cause a wide range of hospital infections. Ireland has had one of the highest invasive VREfm infection rates in Europe over the last decade, yet little is known about Irish VREfm.Objectives: To investigate the population structure of Irish VREfm, explore diversity by analysing the vanA transposon region and compare Irish, Danish and global isolates.Methods: E. faecium (n = 648) from five Irish hospitals were investigated, including VREfm [547 rectal screening and 53 bloodstream infection (BSI)] isolates and 48 vancomycin-susceptible (VSEfm) BSI isolates recovered between June 2017 and December 2019. WGS and core-genome MLST (cgMLST) were used to assess population structure. Genetic environments surrounding vanA were resolved by hybrid assembly of short-read (Illumina) and long-read (Oxford Nanopore Technologies) sequences.Results: All isolates belonged to hospital-adapted clade A1 and the majority (435/648) belonged to MLST ST80. The population structure was highly polyclonal; cgMLST segregated 603/648 isolates into 51 clusters containing mixtures of screening and BSI isolates, isolates from different hospitals, and VREfm and VSEfm. Isolates within clusters were closely related (mean average ≤16 allelic differences). The majority (96.5%) of VREfm harboured highly similar vanA regions located on circular or linear plasmids with multiple IS1216E insertions, variable organization of vanA operon genes and 78.6% harboured a truncated tnpA transposase. Comparison of 648 Irish isolates with 846 global E. faecium from 30 countries using cgMLST revealed little overlap.Conclusions: Irish VREfm are polyclonal, yet harbour a characteristic plasmid-located vanA region with multiple IS1216E insertions that may facilitate spread. [ABSTRACT FROM AUTHOR]

Background: A marked genotype shift among vancomycin-resistant Enterococcus faecium (VREfm) from vanB to vanA in Australia between 2011 and 2015 is a well-known phenomenon. It is hypothesized that this was caused by multiple independent clones emerging simultaneously in different settings and/or regions.Objectives: To gain insights into the circumstances surrounding the shift from vanB to vanA VREfm in one Australian hospital.Methods: The genomes of 69 vanA VREfm isolates from St George Hospital collected between 2009 and 2018 were studied. An expansion of ST80 vanA VREfm was noted following a single introduction. ST80 isolates were thus further characterized using hybrid sequencing and contextualized through comparisons with other published Australian ST80 isolates. Phylogenies were constructed with plasmid sequences compared with the index isolate.Results: The 2011 expansion of ST80 vanA VREfm isolates in our institution originated from the 2009 index isolate, from a patient transferred from overseas. Phylogenetic analysis with other Australian ST80 vanA VREfm isolates showed that the 2011 expansion event was unique, with limited spread to adjacent local health districts. Plasmid analysis showed multiple variants, which can also be traced back to the 2009 isolate, consistent with ongoing plasmid adaptation over time.Conclusions: These findings confirm an expansion event following a VREfm introduction event leading to a sustained clonal and plasmid outbreak over several years. Moreover, it demonstrates the complexity of countrywide replacement events. This study also highlights the use of hybrid sequencing in establishing an epidemiological relationship to the index isolate that was initially inapparent. [ABSTRACT FROM AUTHOR]

Background: Linezolid is a critically important antibiotic used to treat human infections caused by MRSA and VRE. While linezolid is not licensed for food-producing animals, linezolid-resistant (LR) isolates have been reported in European countries, including Belgium.Objectives: To: (i) assess LR occurrence in staphylococci and enterococci isolated from different Belgian food-producing animals in 2019 through selective monitoring; and (ii) investigate the genomes and relatedness of these isolates.Methods: Faecal samples (n = 1325) and nasal swab samples (n = 148) were analysed with a protocol designed to select LR bacteria, including a 44-48 h incubation period. The presence of LR chromosomal mutations, transferable LR genes and their genetic organizations and other resistance genes, as well as LR isolate relatedness (from this study and the NCBI database) were assessed through WGS.Results: The LR rate differed widely between animal host species, with the highest rates occurring in nasal samples from pigs and sows (25.7% and 20.5%, respectively) and faecal samples from veal calves (16.4%). WGS results showed that LR determinants are present in a large diversity of isolates circulating in the agricultural sector, with some isolates closely related to human isolates, posing a human health risk.Conclusions: LR dedicated monitoring with WGS analysis could help to better understand the spread of LR. Cross-selection of LR transferable genes through other antibiotic use should be considered in future action plans aimed at combatting antimicrobial resistance and in future objectives for the rational use of antibiotics in a One Health perspective. [ABSTRACT FROM AUTHOR]

Objectives: Fosfomycin is an established treatment for uncomplicated urinary tract infections (UTIs), yet evidence supporting susceptibility breakpoints is limited. We examine the UTI susceptibility criteria.Methods: Fosfomycin susceptibility, heteroresistance and in vitro growth in a bladder infection model, after a single 3 g dose of oral fosfomycin, were bridged to human pharmacokinetics with pharmacokinetic/pharmacodynamic and Monte Carlo analyses. Data from common uropathogens (24 Escherichia coli, 20 Klebsiella pneumoniae, 4 Enterobacter cloacae, 14 Pseudomonas aeruginosa, 8 Enterococcus faecalis and 8 Enterococcus faecium) were compared and analysed to ascertain species-specific PTA.Results: Glucose-6-phosphate (G6P) increased MICs of E. coli, K. pneumoniae and E. cloacae (median 2-fold dilutions 3-5), but not of P. aeruginosa and Enterococcus. Atypical E. coli lacking G6P potentiation were killed in the bladder infection model despite high MICs (32-128 mg/L). Fosfomycin heteroresistance was uncommon in E. coli (MIC > 2 mg/L) but was detected in the majority of K. pneumoniae (MIC > 1 mg/L) and P. aeruginosa (MIC >8 mg/L). For these species, baseline heteroresistance was a strong predictor for treatment failure in the model. No heteroresistance was found in Enterococcus. The fAUC/MIC targets for stasis were 1935, 3393, 9968, 2738 and 283 for typical E. coli, K. pneumoniae, E. cloacae, P. aeruginosa and E. faecalis, respectively (synthetic human urine medium alone promoted a 1 log10 kill in E. faecium). A >95% PTA for stasis was only found at MIC ≤ epidemiological cut-off (ECOFF) for E. coli (4 mg/L). For other species, PTAs were low for WT populations.Conclusions: With the exception of E. coli, fosfomycin is a poor target for other uropathogen species. A reduction in oral fosfomycin UTI breakpoints is supported. [ABSTRACT FROM AUTHOR]

Background: Enterococcus faecalis commonly produce aminoglycoside-modifying enzymes (AMEs) and are implicated in polymicrobial infections.Objectives: To determine if AME-producing E. faecalis is capable of protecting Enterobacteriaceae and Pseudomonas aeruginosa from gentamicin exposure.Methods: Two Klebsiella pneumoniae isolates, two Escherichia coli isolates, and two Pseudomonas aeruginosa isolates were investigated in monoculture time-kill experiments, and each Gram-negative organism was also evaluated during co-culture with either AME-producing or AME-deficient E. faecalis. A pharmacokinetic/pharmacodynamics analysis that utilized Log Ratio Areas and a Hill-type mathematical model was used to determine if the maximal killing or potency of gentamicin against the Gram-negative organisms was altered by the presence of the E. faecalis.Results: The maximal killing and potency of gentamicin was the same during monoculture and co-culture experiments for both K. pneumoniae isolates and one E. coli isolate (P > 0.05). In contrast, the maximal killing of gentamicin was attenuated against one E. coli isolate and both P. aeruginosa isolates during co-culture with E. faecalis (P < 0.05). The potency of gentamicin was variable against the three aforementioned isolates. Against the E. coli isolate, the potency of gentamicin was significantly reduced by the presence of either E. faecalis isolate (EC50 95% CI = 4.23-4.43 mg/L monoculture versus 3.86-4.19 mg/L and 3.55-3.96 mg/L during co-culture with AME-producing and AME-deficient E. faecalis, respectively). The potency of gentamicin increased or decreased for P. aeruginosa depending on which E. faecalis isolate was investigated.Conclusions: The AME-producing E. faecalis did not provide a consistent protective effect from aminoglycosides for the Gram-negative pathogens. [ABSTRACT FROM AUTHOR]

Background: During 2018-19, an increase of vanB vancomycin-resistant Enterococcus faecium (VREfm) was observed in the Capital Region of Denmark. vanA/vanB PCR performed directly on rectal swabs is accurate in detection of vanA; however, the positive predictive value for vanB-positive samples is low because of the presence of vanB in non-enterococcal gut commensals.Objectives: We investigated the epidemiology and clonal relatedness of vanB VREfm from the period 2015-19 and describe the application of a clone-specific vanB VREfm PCR assay for rapid and accurate detection of vanB VREfm in rectal screening samples.Methods: vanB VREfm were investigated using epidemiological data and WGS data. The SeqSphere+ software was used to analyse MLST and cgMLST, and de novo assemblies were annotated to determine insertion sites for the vanB transposon (Tn1549). A clone-specific vanB VREfm PCR assay was designed to detect the sequence bridging Tn1549 and the E. faecium chromosome (araA2) in the dominant cluster.Results: Two hundred and seventy-five vanB VREfm isolates were identified, of which 76% were identified in 2019. A dominant cluster (Cluster 1, n = 204, 74%), six minor clusters and 15 singletons were identified. All Cluster 1 isolates and six non-Cluster 1 isolates had Tn1549 integrated into araA2. In 2019, the PCR assay would have detected 92% of all rectal screening samples containing vanB VREfm.Conclusions: vanB VREfm increased due to the introduction and nosocomial transmission of the successful Cluster 1. The clone-specific PCR assay detected vanB VREfm outbreak isolates in rectal screening samples rapidly and accurately. [ABSTRACT FROM AUTHOR]

Objectives: To describe the prevalence of poxtA among clinical linezolid-resistant enterococci (LRE) collected in France from 2016 to 2020 and to extensively characterize its genetic supports and environments.Methods: All LRE clinical isolates received at the National Reference Centre for Enterococci from French hospitals between 2016 and 2020 were included. LRE isolates were screened for linezolid resistance genes (cfr-like, optrA and poxtA) by real-time PCR and phenotypically characterized. A collection of 11 representative poxtA-positive isolates (10 Enterococcus faecium and 1 Enterococcus faecalis) underwent WGS by hybrid assembly combining short-read (Illumina MiSeq) and long-read (MinION) approaches. Transferability of poxtA was attempted by filter-mating experiments.Results: Out of 466 LRE received at the National Reference Centre for Enterococci over the period, 47 (10.1%) were poxtA-positive, including 42 E. faecium. The 11 isolates characterized by WGS were confirmed to be epidemiologically unrelated by core genome analysis and eight different STs were assigned to E. faecium isolates. The poxtA gene was found to be plasmid carried and flanked by IS1216E transposase genes in all isolates and frequently linked with fexB, tet(M) and tet(L). A total of seven distinct poxtA-harbouring plasmids were obtained after hybrid assembly and plasmid transfer of poxtA was successful in three cases. For the two poxtA/optrA-positive isolates, those genes were carried by different plasmids.Conclusions: The poxtA gene has been circulating among clinical enterococci in France since at least 2016, mostly in E. faecium and independently from optrA. The poxtA-carrying plasmids often co-carried resistance genes to phenicols and tetracyclines, and could have been co-selected through their veterinary use. [ABSTRACT FROM AUTHOR]

Objectives: The increasing prevalence of VRE necessitates their reliable detection, especially for low-level resistance mediated by vanB in Enterococcus faecium. In this prospective study we analysed if vanB-mediated vancomycin resistance can be reliably detected by Vitek2.Methods: One thousand, three hundred and forty-four enterococcal isolates from routine clinical specimens were tested by Vitek2 (bioMérieux, Nürtingen, Germany). Additionally, a bacterial suspension (with a turbidity equivalent to that of a 0.5 McFarland standard) was inoculated on chromID VRE screening agar (bioMérieux) and incubated for 48 h. If vancomycin tested susceptible by Vitek2 but growth was detected on the screening agar, PCR for vanA/vanB was performed (GeneXpert vanA/B test, Cepheid, Frankfurt, Germany). For isolates that tested susceptible to vancomycin by Vitek2 but were vanA/B positive, MICs were determined before and after cultivation in broth with increasing concentrations of vancomycin.Results: One hundred and fifty-six out of 491 E. faecium were VRE and were predominantly vanB positive (81.0%). Of these, Vitek2 did not identify 14 as VRE (sensitivity 91.0%). By broth microdilution 9/14 isolates demonstrated high MICs (≥32 mg/L) and 5/14 showed low vancomycin MICs, which did not increase despite vancomycin exposure. Three of the 14 isolates demonstrated growth on chromID VRE; after vancomycin exposure seven additional isolates were able to grow on chromID VRE.Conclusions: Vitek2 fails to detect vanB-mediated vancomycin resistance consistently, especially, but not limited to, low-level resistance. As this may lead to treatment failure and further dissemination of vanB VRE, additional methods (e.g. culture on VRE screening agar or PCR) are necessary to reliably identify vanB-positive enterococci in clinical routine. [ABSTRACT FROM AUTHOR]

Objectives: To explore the mechanisms mediating the different levels of gentamicin resistance in enterococci.Methods: Susceptibility testing with gentamicin and PCR of resistance determinants were performed in 149 enterococcal isolates. Genetic relatedness was characterized by MLST and PFGE analysis. Sequences of the aac(6')-Ie-aph(2'')-Ia gene and its surrounding environment were determined by Illumina sequencing. Stability assays of gentamicin resistance were carried out to evaluate the probability of loss of the high-level gentamicin resistance (HLGR) phenotype.Results: A total of 17 (11.4%) aac(6')-Ie-aph(2'')-Ia-positive enterococcal isolates (2 Enterococcus faecalis and 15 Enterococcus faecium) with non-HLGR phenotype were found. MLST analysis revealed that the 2 E. faecalis belonged to ST116 and ST618, while all the 15 E. faecium belonged to clonal complex 17. Sequence analysis demonstrated that IS1216V was inserted into the 5'-end of aac(6')-Ie-aph(2'')-Ia, leading to loss of HLGR phenotype. Three IS1216V insertion types were found, and type II and III were frequently found in E. faecium. Interestingly, a total of 38 aac(6')-Ie-aph(2'')-Ia-positive E. faecium with HLGR phenotype also had type II or type III IS1216V insertion. Sequencing of the aac(6')-Ie-aph(2'')-Ia-positive HLGR E. faecium E37 revealed that an intact aac(6')-Ie-aph(2'')-Ia was located adjacent to IS1216V-disrupted aac(6')-Ie-aph(2'')-Ia. In a non-antibiotic environment, E37 tended to lose HLGR phenotype with a probability of 1.57 × 10-4, which was largely attributed to homologous recombination between the intact and disrupted aac(6')-Ie-aph(2'')-Ia.Conclusions: This is first study to elucidate that the E. faecium is capable of changing its HLGR phenotype, which may contribute to adaptation to hospital environments with decreased usage of gentamicin. [ABSTRACT FROM AUTHOR]

Background: Vancomycin variable enterococci (VVE) are van-positive isolates with a susceptible phenotype that can convert to a resistant phenotype during vancomycin selection.Objectives: To describe a vancomycin-susceptible vanA-PCR positive ST203 VVE Enterococcus faecium isolate (VVESwe-S) from a liver transplantation patient in Sweden which reverted to resistant (VVESwe-R) during in vitro vancomycin exposure.Methods: WGS analysis revealed the genetic differences between the isolates. Expression of the van-operon was investigated by qPCR. Fitness and stability of the revertant were investigated by growth measurements, competition and serial transfer.Results: The VVESwe-R isolate gained high-level vancomycin (MIC >256 mg/L) and teicoplanin resistance (MIC = 8 mg/L). VVESwe-S has a 5'-truncated vanR activator sequence and the VVESwe-R has in addition acquired a 44 bp deletion upstream of vanHAX in a region containing alternative putative constitutive promoters. In VVESwe-R the vanHAX-operon is constitutively expressed at a level comparable to the non-induced prototype E. faecium BM4147 strain. The vanHAX operon of VVESwe is located on an Inc18-like plasmid, which has a 3-4-fold higher copy number in VVESwe-R compared with VVESwe-S. Resistance has a low fitness cost and the vancomycin MIC of VVESwe-R decreased during in vitro serial culture without selection. The reduction in MIC was associated with a decreased vanA-plasmid copy number.Conclusions: Our data support a mechanism by which vancomycin-susceptible VVE strains may revert to a resistant phenotype through the use of an alternative, constitutive, vanR-activator-independent promoter and a vanA-plasmid copy number increase. [ABSTRACT FROM AUTHOR]

Objectives: To characterize two Enterococcus faecium isolates with different resistance phenotypes obtained from the same blood culture.Methods: The isolates were identified by MALDI-TOF MS and antimicrobial susceptibility testing (AST) was performed using a VITEK® 2 AST P592 card and Etest. WGS was performed on the MiSeq and MinION sequencer platforms. Core-genome MLST (cgMLST) and seven-loci MLST were performed. Plasmid analysis was performed using S1-PFGE followed by Southern-blot hybridization.Results: Both E. faecium isolates were ST203. AST revealed that one was a vancomycin-resistant E. faecium (VREfm) isolate and the other was a vancomycin-susceptible E. faecium (VSEfm) isolate. The VREfm isolate harboured the vanA gene cluster as part of a Tn1546-type transposon encoded on a 49 kb multireplicon (rep1, rep2 and rep7a) plasmid (pAML0157.1). On the same plasmid, ant(6)-Ia, cat-like and erm(B) were encoded. The VSEfm isolate harboured a rep2 plasmid (pAML0158.1), 12 kb in size, which was present in full length as part of pAML0157.1 from the VREfm isolate. The vanA-encoding pAML0157.1 was a chimera of the rep2 pAML0158.1 and a second DNA segment harbouring vanA, ant(6)-Ia, erm(B) and cat-like, as well as the replicons rep1 and rep7a. By cgMLST analysis, the VREfm and VSEfm isolates were identical.Conclusions: Our results demonstrate that the VREfm and VSEfm blood culture isolates represented ST203 and were identical. The investigated heterogeneous resistance phenotypes resulted from the acquisition or loss of plasmid segments in the enterococcal isolates. These data illustrate that mobile genetic elements may contribute to the spread of vancomycin resistance among enterococci and to the genotypic and phenotypic variation within clonal isolates. [ABSTRACT FROM AUTHOR]

Background: VRE are nosocomial pathogens with an increasing incidence in recent decades. Rapid detection is crucial to reduce their spread and prevent infections and outbreaks.Objectives: To evaluate a lateral flow immunoassay (LFIA) (called NG-Test VanA) for the rapid and reliable detection of VanA-producing VRE (VanA-VRE) from colonies and broth.Methods: NG-Test VanA was validated on 135 well-characterized enterococcal isolates grown on Mueller-Hinton (MH) agar (including 40 VanA-VRE). Different agar plates and culture broths widely used in routine laboratories for culture of enterococci were tested.Results: All 40 VanA-VRE clinical isolates were correctly detected in less than 15 min irrespective of the species expressing the VanA ligase and the medium used for bacterial growth. No cross-reaction was observed with any other clinically relevant ligases (VanB, C1, C2, D, E, G, L, M and N). Overall, the sensitivity and specificity of the assay were 100% for VanA-VRE grown on MH agar plates. NG-Test VanA accurately detects VanA-VRE irrespective of the culture medium (agar and broth). Band intensity was increased when using bacteria grown on vancomycin-containing culture media or on MH close to the vancomycin disc as a consequence of VanA induction. The limit of detection of the assay was 6.3 × 106 cfu per test with bacteria grown on MH plates and 4.9 × 105 cfu per test with bacteria grown on ChromID® VRE plates.Conclusions: NG-Test VanA is efficient, rapid and easy to implement in the routine workflow of a clinical microbiology laboratory for the confirmation of VanA-VRE. [ABSTRACT FROM AUTHOR]

Objectives: To analyse the rectal carriage rate and the molecular epidemiology of vancomycin-resistant Enterococcus faecium (VREfm) recovered from patients upon hospital admission.Methods: Adult patients were screened at six German university hospitals from five different federal states upon hospital admission for rectal colonization with VREfm between 2014 and 2018. Molecular characterization of VREfm was performed by WGS followed by MLST and core-genome MLST analysis.Results: Of 16350 patients recruited, 263 were colonized with VREfm, with increasing prevalence rates during the 5 year study period (from 0.8% to 2.6%). In total, 78.5% of the VREfm were vanB positive and 20.2% vanA positive, while 1.2% harboured both vanA and vanB. The predominant ST was ST117 (56.7%) followed by ST80 (15%), ST203 (10.9%), ST78 (5.7%) and ST17 (3.2%). ST117/vanB VREfm isolates formed a large cluster of 96 closely related isolates extending across all six study centres and four smaller clusters comprising 13, 5, 4 and 3 isolates each. In contrast, among the other STs inter-regional clonal relatedness was rarely observed.Conclusions: To our knowledge, this is the largest admission prevalence and molecular epidemiology study of VREfm. These data provide insight into the epidemiology of VREfm at six German university hospitals and demonstrate the remarkable inter-regional clonal expansion of the ST117/vanB VREfm clone. [ABSTRACT FROM AUTHOR]

Background: Linezolid-resistant enterococci (LRE) causing infections that are challenging to treat are rising, highlighting the need for reliable screening of LRE clinical isolates.Objectives: To evaluate the ability of the broth microdilution (BMD) method for LRE detection and to assess the performance of seven commercially available techniques for linezolid susceptibility testing.Methods: A collection of 100 clinical isolates (80 Enterococcus faecium and 20 Enterococcus faecalis), including 20 optrA-positive isolates, 17 poxtA-positive isolates and 1 optrA/poxtA-positive E. faecium isolate, were studied. MICs were determined after 18 h [Day 1 (D1)] and 42 h [Day 2 (D2)] of incubation and interpreted following EUCAST and CLSI guidelines, which currently provide different interpretative breakpoints. Performance of commercial techniques was compared with BMD results.Results: MIC50/D1 and MIC50/D2 were both 8 mg/L, while MIC90/D1 and MIC90/D2 were 16 and 32 mg/L, respectively. MICD1 values for poxtA-positive isolates were lower than those for optrA-positive isolates. Proportions of susceptible isolates at D1 and D2 were 48% and 41%, respectively, according to EUCAST breakpoints and 35% and 13%, respectively, according to CLSI criteria (the proportions of isolates categorized as intermediate following CLSI recommendations were 13% and 28% at D1 and D2, respectively). Percentage susceptibility assessed by the commercially available techniques was always higher. The four commercial methods allowing MIC determination provided an overall essential agreement of ≥90% at D1. Categorical agreement and error rates were generally improved at D2.Conclusions: Non-automated methods (Sensititre and UMIC) and, to a lesser extent, gradient strip Etest appear to show an acceptable correlation with the BMD reference method for the detection of isolates with low MICs of linezolid after prolonged incubation. [ABSTRACT FROM AUTHOR]

Objectives: To characterize the novel cfr(D) gene identified in an Enterococcus faecium clinical isolate (15-307.1) collected from France.Methods: The genome of 15-307.1 was entirely sequenced using a hybrid approach combining short-read (MiSeq, Illumina) and long-read (GridION, Oxford Nanopore Technologies) technologies in order to analyse in detail the genetic support and environment of cfr(D). Transfer of linezolid resistance from 15-307.1 to E. faecium BM4107 was attempted by filter-mating experiments. The recombinant plasmid pAT29Ωcfr(D), containing cfr(D) and its own promoter, was transferred to E. faecium HM1070, Enterococcus faecalis JH2-2 and Escherichia coli AG100A.Results: As previously reported, 15-307.1 belonged to ST17 and was phenotypically resistant to linezolid (MIC, 16 mg/L), vancomycin and teicoplanin. A hybrid sequencing approach confirmed the presence of several resistance genes including vanA, optrA and cfr(D). Located on a 103 kb plasmid, cfr(D) encoded a 357 amino acid protein, which shared 64%, 64%, 48% and 51% amino acid identity with Cfr, Cfr(B), Cfr(C) and Cfr(E), respectively. Both optrA and cfr(D) were successfully co-transferred to E. faecium BM4107. When expressed in E. faecium HM1070 and E. faecalis JH2-2, pAT29Ωcfr(D) did not confer any resistance, whereas it was responsible for an expected PhLOPSA resistance phenotype in E. coli AG100A. Analysis of the genetic environment of cfr(D) showed multiple IS1216 elements, putatively involved in its mobilization.Conclusions: Cfr(D) is a novel member of the family of 23S rRNA methyltransferases. While only conferring a PhLOPSA resistance phenotype when expressed in E. coli, enterococci could constitute an unknown reservoir of cfr(D). [ABSTRACT FROM AUTHOR]

Objectives: VRE are listed, by the WHO, among the leading resistant pathogens causing greatest public concern; hence the spread and transmission of VRE, especially in hospitalized patients, need to be monitored. Despite the advancements in typing methods since the implementation of WGS for outbreak investigations, data interpretation, especially for vancomycin-resistant Enterococcus faecium (VREfm) in an endemic setting, remains challenging. In this study we explored the potential added benefit of incorporating patient movement data and admission screening to accurately estimate the magnitude of an outbreak.Methods: We sequenced 73 VREfm isolates from patients with bacteraemia (n = 43) and rectal colonization (n = 30/32). Genetic relatedness was determined by SNP distance (≤10) between isolates. Patient movements were visualized in a movement network, along with contact intensity and rectal colonization status prior to infection onset.Results: ST117, ST80 and ST203 were the predominant STs in our study population. Forty-four percent (18/41) of VREfm bacteraemia cases were of endogenous origin. SNP analysis of infection and colonization isolates revealed nine clonal groups. Eighty-six percent (37/43) of the patients were visualized in a transmission network due to spatiotemporal overlap. Nineteen out of 43 (44%) belonged to five transmission clusters. Incorporation of prior colonization status revealed that transmission was very likely in only 63% (12/19) of patients in these transmission clusters.Discussion: Although interpretation of WGS data is challenging, incorporation of patient movement data and colonization status by admission screening of high-risk patients may provide additional resolution when interpreting the magnitude of an outbreak in an endemic setting. [ABSTRACT FROM AUTHOR]

Objectives: To investigate the prevalence of the optrA, poxtA and cfr linezolid resistance genes in linezolid-resistant enterococci from Irish hospitals and to characterize associated plasmids.Methods: One hundred and fifty-four linezolid-resistant isolates recovered in 14 hospitals between June 2016 and August 2019 were screened for resistance genes by PCR. All isolates harbouring resistance genes, and 20 without, underwent Illumina MiSeq WGS. Isolate relatedness was assessed using enterococcal whole-genome MLST. MinION sequencing (Oxford Nanopore) and hybrid assembly were used to resolve genetic environments/plasmids surrounding resistance genes.Results: optrA and/or poxtA were identified in 35/154 (22.7%) isolates, the highest prevalence reported to date. Fifteen isolates with diverse STs harboured optrA only; one Enterococcus faecium isolate harboured optrA (chromosome) and poxtA (plasmid). Seven Enterococcus faecalis and one E. faecium harboured optrA on a 36 331 bp plasmid with 100% identity to the previously described optrA-encoding conjugative plasmid pE349. Variations around optrA were also observed, with optrA located on plasmids in five isolates and within the chromosome in three isolates. Nine E. faecium and 10 E. faecalis harboured poxtA, flanked by IS1216E, within an identical 4001 bp region on plasmids exhibiting 72.9%-100% sequence coverage to a 21 849 bp conjugative plasmid. E. faecalis isolates belonged to ST480, whereas E. faecium isolates belonged to diverse STs. Of the remaining 119 linezolid-resistant isolates without linezolid resistance genes, 20 investigated representatives all harboured the G2576T 23S RNA gene mutation associated with linezolid resistance.Conclusions: This high prevalence of optrA and poxtA in diverse enterococcal lineages in Irish hospitals indicates significant selective pressure(s) for maintenance. [ABSTRACT FROM AUTHOR]

Background: Since 2012, the incidence of vancomycin-resistant Enterococcus faecium (VREfm) has increased dramatically in Copenhagen and vanA E. faecium has become endemic and polyclonal.Objectives: To examine whether a patient with a positive VRE clinical sample had the same VREfm in a preceding screening sample (within 60 days).Methods: We performed a 30 month retrospective study. From our laboratory information system (LIS), we identified all patients with an invasive VREfm isolate and a VREfm rectal screening isolate within 60 days before infection. VREfm pairs (screening isolate and invasive isolate) were whole-genome sequenced. All isolates were analysed using SeqSphere and core-genome MLST (cgMLST) types were determined. We examined all isolates for the presence of the three most dominant vanA plasmids in the Capital Region of Denmark. Two novel vanA plasmids were closed by Nanopore/Illumina sequencing.Results: We found a total of 19 VREfm pairs. Of these, 13 patients had pairs with matching cgMLST types and vanA plasmids and a median number of 6 days from identification of carriage to clinical infection. One patient had a pair with non-matching cgMLST types but matching vanA plasmids and 24 days between identification of carriage to clinical infection. Five patients had pairs with non-matching cgMLST types and non-matching vanA plasmids and a median number of 18 days from identification of carriage to clinical infection.Conclusions: Of our 19 pairs, 13 were a match regarding cgMLST types (68%) and 1 more (5%) had matching vanA plasmids. Infection was thus preceded by colonization with the same isolates in 13 out of 19 patients. The five mismatches (26%) could be explained by the longer interval between colonization and infection. [ABSTRACT FROM AUTHOR]

Background: There is increasing knowledge of antimicrobial usage in children yet limited availability of nationally representative paediatric-specific data on antimicrobial resistance.Objectives: Paediatric data from this national surveillance programme are presented to explore differences between childhood and adult bloodstream infections and antimicrobial resistance surveillance.Methods: Using information collected from a prospective coordinated antimicrobial resistance surveillance programme, children ≤18 years and adults >18 years with a positive blood culture for Staphylococcus aureus, Enterococcus spp. or Gram-negative spp. presenting to one of 34 Australian hospitals during 2013-16 were evaluated. Consistent methodologies for key sepsis pathogens were employed and a comparative analysis between children and adults was conducted.Results: There are stark contrasts between children and adults in this national antimicrobial resistance (AMR) data set. Notable differences include lower rates of AMR, different clinical and molecular phenotypes and lower mortality amongst children. The burden of Gram-negative resistance is disproportionately experienced in children, with higher odds of death with an ESBL versus non-ESBL bacteraemia in comparison with adults.Conclusions: These data support that children are not just 'little adults' in the AMR era, and analyses by age group are important to detect differences in antibiotic susceptibility, clinical phenotype and genetic virulence factors. Antimicrobial surveillance incorporated into routine laboratory practice is vital to inform an array of wider applications including antimicrobial guidelines, stewardship and direction for prioritization of novel antimicrobial development. [ABSTRACT FROM AUTHOR]

Objectives: Infections caused by vancomycin-resistant Enterococcus faecium (VREfm) represent a major public health concern due to limited treatment options. Among invasive isolates of VREfm, ST117, ST80 and ST78 represent the most frequently detected STs by MLST in Germany. In this study, we investigated the genetic diversity of isolates of VREfm recovered from different nosocomial outbreaks in Bavaria, Germany, by WGS.Methods: Between January 2018 and April 2019, 99 non-replicate isolates of VREfm originating from nosocomial outbreaks at eight different hospitals in Bavaria were investigated for genetic diversity by WGS. In detail, complex types (CTs) were identified by core-genome MLST. Furthermore, an SNP analysis was performed for all VREfm strains.Results: Most of the isolates of this study (76%) belonged to three major clonal groups, which occurred in at least three hospitals: ST80/CT1065 vanB (n = 45; six hospitals), ST117/CT71 vanB (n = 11; four hospitals) and ST78/CT894like vanA (n = 19; three hospitals). Moreover, isolates of the predominant lineage ST80/CT1065 vanB showed a maximum difference of 36 SNPs as revealed by SNP analysis.Conclusions: Whole-genome analysis of VREfm causing nosocomial outbreaks suggests the occurrence of few endemic clonal lineages in Bavarian hospital settings, namely ST80/CT1065 vanB, ST117/CT71 vanB and ST78/CT894like vanA. Further studies are needed for a better understanding of the factors affecting the successful spread of the above-mentioned lineages. [ABSTRACT FROM AUTHOR]

Background: Vancomycin-variable enterococci (VVE) are a potential risk factor for vancomycin resistance gene dissemination and clinical treatment failure. vanM has emerged as a new prevalent resistance determinant among clinical enterococci in China. A total of 54 vancomycin-susceptible enterococci (VSE) isolates carrying incomplete vanM gene clusters were isolated in our previous study.Objectives: To determine the potential of vanM-carrying VSE to develop vancomycin resistance and investigate the mechanism of alteration of the resistance phenotype.Methods: Fifty-four vanM-positive VSE strains were induced in vitro by culturing in increasing concentrations of vancomycin. Genetic changes between three parent VVE strains and their resistant variants were analysed using Illumina and long-read sequencing technologies, quantitative PCR and Southern blot hybridization. Changes in expression level were determined by quantitative RT-PCR.Results: Twenty-five of the 54 VSE strains carrying vanM became resistant upon vancomycin exposure. A significant increase in vanM copy number was observed ranging from 5.28 to 127.64 copies per cell in induced resistant VVE strains. The vanM transposon was identified as tandem repeats with IS1216E between them, and occurred in either the plasmid or the chromosome of resistant VVE cells. In addition, an increase in vanM expression was observed after resistance conversion in VVE.Conclusions: This study identified tandem amplification of the vanM gene cluster as a new mechanism for vancomycin resistance in VVE strains, offering a competitive advantage for VVE under antibiotic pressure. [ABSTRACT FROM AUTHOR]

Background: Aminopenicillins with or without a β-lactamase inhibitor are widely used in both human and veterinary medicine. However, little is known about their differential impact on the gut microbiota and development of antimicrobial resistance.Objectives: To investigate changes in the faecal microbiota of dogs treated with amoxicillin or amoxicillin/clavulanic acid.Methods: Faeces collected from 42 dogs (21 per treatment group) immediately before, during and 1 week after termination of oral treatment with amoxicillin or amoxicillin/clavulanic acid were analysed by culture and 16S rRNA gene sequence analysis.Results: In both groups, bacterial counts on ampicillin selective agar revealed an increase in the proportion of ampicillin-resistant Escherichia coli during treatment, and an increased occurrence and proportion of ampicillin-resistant enterococci during and after treatment. 16S rRNA gene analysis showed reductions in microbial richness and diversity during treatment followed by a return to pre-treatment conditions approximately 1 week after cessation of amoxicillin or amoxicillin/clavulanic acid treatment. While no significant differences were observed between the effects of amoxicillin and amoxicillin/clavulanic acid on microbial richness and diversity, treatment with amoxicillin/clavulanic acid reduced the abundance of taxa that are considered part of the beneficial microbiota (such as Roseburia, Dialister and Lachnospiraceae) and enriched Escherichia, although the latter result was not corroborated by phenotypic counts.Conclusions: Our results suggest a limited effect of clavulanic acid on selection of antimicrobial resistance and microbial richness when administered orally in combination with amoxicillin. However, combination with this β-lactamase inhibitor appears to broaden the spectrum of amoxicillin, with potential negative consequences on gut health. [ABSTRACT FROM AUTHOR]

Objectives: Increasing numbers of linezolid-resistant Enterococcus carrying optrA are being reported across different niches worldwide. We aimed to characterize the first optrA-carrying Enterococcus faecalis obtained from food-producing animals and retail meat samples in Tunisia.Methods: Seven optrA-carrying E. faecalis obtained from chicken faeces (n=3, August 2017) and retail chicken meat (n=4, August 2017) in Tunisia were analysed. Antimicrobial susceptibility was determined by disc diffusion, broth microdilution and Etest against 13 antibiotics, linezolid and tedizolid, respectively (EUCAST/CLSI). optrA stability (∼600 bacterial generations), transfer (filter mating) and location (S1-PFGE/hybridization) were characterized. WGS (Illumina-HiSeq) was done for four representatives that were analysed through in silico and genomic mapping tools.Results: Four MDR clones carrying different virulence genes were identified in chicken faeces (ST476) and retail meat (the same ST476 clone plus ST21 and ST859) samples. MICs of linezolid and tedizolid were stably maintained at 8 and 1-2 mg/L, respectively. optrA was located in the same transferable chromosomal Tn6674-like element in ST476 and ST21 clones, similar to isolates from pigs in Malaysia and humans in China. ST859 carried a non-conjugative plasmid of ∼40 kb with an impB-fexA-optrA segment, similar to plasmids from pigs and humans in China.Conclusions: The same chromosomal and transferable Tn6674-like element was identified in different E. faecalis clones from humans and animals. The finding of retail meat contaminated with the same linezolid-resistant E. faecalis strain obtained from a food-producing animal highlights the potential role of the food chain in the worrisome dissemination of optrA that can be stably maintained without selective pressure over generations. [ABSTRACT FROM AUTHOR]

Objectives: Linezolid is an important therapeutic option for the treatment of infections caused by VRE. Linezolid is a synthetic antimicrobial and resistance to this antimicrobial agent remains relatively rare. As a result, data on the comparative genomics of linezolid resistance determinants in Enterococcus faecium are relatively sparse.Methods: To address this knowledge gap in E. faecium, we deployed phenotypic antibiotic susceptibility testing and Illumina WGS on hospital surface (environmental) and clinical isolates from the USA and Pakistan.Results: We found complete concordance between isolate source country and mechanism of linezolid resistance, with all the US isolates possessing a 23S rRNA gene mutation and the Pakistan isolates harbouring two to three acquired antibiotic resistance genes. These resistance genes include the recently elucidated efflux-pump genes optrA and poxtA and a novel cfr-like variant. Although there was no difference in the linezolid MIC between the US and Pakistan isolates, there was a significant difference in the geometric mean of the MIC between the Pakistan isolates that had two versus three of the acquired antibiotic resistance genes. In five of the Pakistan E. faecium that possessed all three of the resistance genes, we found no difference in the local genetic context of poxtA and the cfr-like gene, but we identified different genetic contexts surrounding optrA.Conclusions: These results demonstrate that E. faecium from different geographical regions employ alternative strategies to counter selective pressure of increasing clinical linezolid use. [ABSTRACT FROM AUTHOR]

Objectives: To assess the association between country income status and national prevalence of invasive infections caused by the top-ranked bacteria on the WHO priority list: carbapenem-resistant (CR) Acinetobacter spp., Klebsiella spp. and Pseudomonas aeruginosa; third-generation cephalosporin-resistant (3GCR) Escherichia coli and Klebsiella spp.; and MRSA and vancomycin-resistant Enterococcus faecium (VR E. faecium).Methods: Active surveillance systems providing yearly prevalence data from 2012 onwards for the selected bacteria were included. The gross national income (GNI) per capita was used as the indicator for income status of each country and was log transformed to account for non-linearity. The association between antibiotic prevalence data and GNI per capita was investigated individually for each bacterium through linear regression.Results: Surveillance data were available from 67 countries: 38 (57%) were high income, 16 (24%) upper-middle income, 11 (16%) lower-middle income and two (3%) low income countries. The regression showed significant inverse association (P<0.0001) between resistance prevalence of invasive infections and GNI per capita. The highest rate of increase per unit decrease in log GNI per capita was observed in 3GCR Klebsiella spp. (22.5%, 95% CI 18.2%-26.7%), CR Acinetobacter spp. (19.2% 95% CI 11.3%-27.1%) and 3GCR E. coli (15.3%, 95% CI 11.6%-19.1%). The rate of increase per unit decrease in log GNI per capita was lower in MRSA (9.5%, 95% CI 5.2%-13.7%).Conclusions: The prevalence of invasive infections caused by the WHO top-ranked antibiotic-resistant bacteria is inversely associated with GNI per capita at the global level. Public health interventions designed to limit the burden of antimicrobial resistance should also consider determinants of poverty and inequality, especially in lower-middle income and low income countries. [ABSTRACT FROM AUTHOR]