Search

The immune-modulatory effects of mesenchymal stromal cells (MSCs) are widely used to treat inflammatory disorders, with indoleamine 2,4-dioxygenase-1 (IDO-1) playing a pivotal role in suppressing stimulated T-cell proliferation. Taking that three-dimensional (3D) cultures enhance MSCs' anti-inflammatory properties compared with two-dimensional (2D) cultures, the differentially expressed miRNAs were examined. Thus, we identified hsa-miR-4662a-5p (miR-4662a) as a key inducer of IDO-1 via its suppression of bridging integrator-1 (BIN-1), a negative regulator of the IDO-1 gene. The IDO-1-inducing potential of miR-4662a was conserved across primary MSCs from various donors and sources but exhibited variability. Notably, iPSC-derived MSCs (iMSCs) demonstrated superior IDO-1 induction and immune-modulatory efficacy compared with their donor-matched primary MSCs. Accordingly, iMSCs expressing miR-4662a (4662a/iMSC) exhibited stronger suppressive effects on T-cell proliferation and more potent suppressive effects on graft-versus-host disease (GVHD), improving survival rates and reducing tissue damage in the liver and gut. Our results point to the therapeutic potential of standardized, off-the-shelf 4662a/iMSC as a robust immune-modulating cell therapy for GVHD.

Extrachromosomal circular DNAs (eccDNAs) has been found to be widespread and functional in various organisms. However, comparative analyses of pre- and post-infection of virus are rarely known. Herein, we investigated the changes in expression patterns of eccDNA following infection with Bombyx mori cytoplasmic polyhedrosis virus (BmCPV) and explore the role of eccDNA in viral infection. Circle-seq was used to analyze eccDNAs in the midgut of BmCPV-infected and BmCPV-uninfected silkworms. A total of 5508 eccDNAs were identified, with sizes varying from 72 bp to 17 kb. Most of eccDNAs are between 100 to 1000 bp in size. EccDNA abundance in BmCPV-infected silkworms was significantly higher than in BmCPV-uninfected silkworms. GO and KEGG analysis of genes carried by eccDNAs reveals that most are involved in microtubule motor activity, phosphatidic acid binding, cAMP signaling pathway, and pancreatic secretion signaling pathways. Several eccDNAs contain sequences of the transcription factor SOX6, sem-2, sp8b, or Foxa2. Association analysis of eccDNA-mRNA/miRNA/circRNA revealed that some highly expressed genes are transcribed from relevant sequences of eccDNA and the transcription of protein coding genes influenced the frequency of eccDNA. BmCPV infection resulted in changes in the expression levels of six miRNAs, but no known miRNAs with altered expression levels due to changes in eccDNA abundance were identified. Moreover, it was found that 1287 and 924 sequences representing back-spliced junctions of circRNAs were shared by the junctions of eccDNAs in the BmCPV-infected and uninfected silkworms, respectively, and some eccDNAs loci were shared by circRNAs on Chromosomes 2, 7, 11, 14, and 24, suggesting some eccDNAs may exert its function by being transcribed into circRNAs. These findings suggest that BmCPV infection alter the expression pattern of eccDNAs, leading to changes in RNA transcription levels, which may play roles in regulating BmCPV replication. In the future, further experiments are needed to verify the association between eccDNA-mRNA/miRNA/circRNA and its function in BmCPV infection.

microRNA-22 (miR-22) plays a pivotal role in the regulation of metabolic processes and has emerged as a therapeutic target in metabolic disorders, including obesity, type 2 diabetes, and metabolic-associated liver diseases. While miR-22 exhibits context-dependent effects, promoting or inhibiting metabolic pathways depending on tissue and condition, current research highlights its therapeutic potential, particularly through inhibition strategies using chemically modified antisense oligonucleotides. This review examines the dual regulatory functions of miR-22 across key metabolic pathways, offering perspectives on its integration into next-generation diagnostic and therapeutic approaches while acknowledging the complexities of its roles in metabolic homeostasis.

Deregulation of micro-RNAs (miRNAs) may contribute to mechanisms of injury in the bicuspid aortic valve (BAV). Our objective was to investigate the expression of miRNAs in aortic tissue from patients who underwent aortic valve replacement for aortic stenosis and its relationship with aortic dilatation. The study included 78 patients, 40 with bicuspid aortic valve (BAV) and 38 with tricuspid aortic valve (TAV). The expression of miRNA-17-5p, hsa-let-7e, and miRNA-196a-5p in human aortic tissue was evaluated by a reverse transcriptase polymerase chain reaction (RT-qPCR). Comparative analysis between patients with BAV and controls with TAV explored the association between the miRNAs and aortic dilatation (AD), calcification, valve dysfunction, and stenosis. The results showed that the expression levels of miRNA-Let-7e-5p and miRNA-196-5p were mostly increased in patients with BAV and aortic dilatation ( p = 0.01 and p = 0.01), respectively. In contrast, the levels of miRNA-17a-5p ( p < 0.20) were lower but without a statistically significant difference. The downregulation of miRNA-17a-5p and the upregulation of miR-Let-7e-5p and miR-196-5p were related to an increased risk of AD risk. Subjects with BAVs with or without double aortic lesions had higher expression levels of Let-7e-5p and miRNA-17a-5p vs. TAV. In all patients, we found an inverse correlation of MiRNA-196-5p with High-Density Lipoprotein-Cholesterol (HDL-C) and indexed valvular area. In subjects with a higher expression of miRNA196, lower levels of HDL-C correlation (r 2 ) [r 2 0.27 ( p = 0.02)] and a lower indexed valvular area [r 2 0.28 ( p = 0.05)] were observed. In the specific analysis for each patient group, it was found that in control subjects with tricuspid aortic valve (TAV), miRNA-196-5p had a positive correlation with valvular calcification (r 2 = 0.60, p = 0.02). Deregulation of miRNAs in the aortic tissue of a BAV may influence valvular stenosis, dysfunction, and concomitant aortic dilation. This information could help to define potential therapeutic target strategies to improve the prognosis and treatment of BAV.

Autism Spectrum Disorder (ASD) is a complex condition with a multifactorial aetiology including both genetic and epigenetic factors. MicroRNAs (miRNAs) play a role in ASD and may influence metabolic pathways. Glycosylation (the glycoconjugate synthesis pathway) is a necessary process for the optimal development of the central nervous system (CNS). Congenital Disorders of Glycosylation (CDGs) (CDGs) are linked to over 180 genes and are predominantly associated with neurodevelopmental disorders (NDDs) including ASD. From a literature search, we considered 64 miRNAs consistently deregulated in ASD patients (ASD-miRNAs). Computational tools, including DIANA-miRPath v3.0 and TarBase v8, were employed to investigate the potential involvement of ASD-miRNAs in glycosylation pathways. A regulatory network constructed through miRNet 2.0 revealed the involvement of these miRNAs in targeting genes linked to glycosylation. Protein functions were further validated through the Human Protein Atlas. A total of twenty-five ASD-miRNAs were identified, including nine miRNAs that were differentially expressed in cells or brain tissue in ASD patients and associated with glycosylation pathways, specifically protein N- and O-glycosylation and glycosaminoglycan biosynthesis (heparan sulfate). A number of CDG genes and/or ASD-risk genes, including DOLK , GALNT2 , and EXT1 , were identified as targets, along with validated interactions involving four key miRNAs (hsa-miR-423-5p, hsa-miR-30c-5p, hsa-miR-195-5p, and hsa-miR-132-5p). B4GALT1 , an ASD susceptibility gene, emerged as a central regulatory hub, reinforcing the link between glycosylation and ASD. In sum, the evidence presented here supports the hypothesis that ASD-miRNAs mediate the epigenetic regulation of glycosylation, thus unveiling possible novel patho-mechanisms underlying ASD.

Type 2 diabetes mellitus (T2DM) is a common metabolic disease that is frequently accompanied by multiple complications, including diabetic myopathy, a muscle disorder that is mainly manifested as decreased muscle function and reduced muscle mass. Diabetic myopathy is a relatively common complication among patients with diabetes that is mainly attributed to mitochondrial dysfunction. Therefore, we investigated the mechanisms underlying diabetic myopathy development, focusing on the role of microRNAs (miRs). Zebrafish were fed a high-sugar diet for 8 weeks and immersed in a glucose solution to establish a model of T2DM. Notably, the fish exhibited impaired blood glucose homeostasis, increased lipid accumulation in the skeletal muscles, and decreased insulin levels in the skeletal muscle. Additionally, we observed various symptoms of diabetic myopathy, including a decreased cross-sectional area of skeletal muscle fibers, increased skeletal muscle fibrosis, a significant decline in exercise capacity, and a significant decrease in mitochondrial respiratory function. Mechanistically, bioinformatic analysis combined with various molecular analyses showed that the miR-139-5p/NAMPT pathway was involved in long-term high-glucose-induced mitochondrial dysfunction in the skeletal muscle, leading to diabetic myopathy. Conclusively, this study provides a basis for the development of novel strategies for the prevention and treatment of diabetic myopathy.

Breast cancer treatment has advanced significantly, particularly for estrogen receptor-positive (ER+) tumors. Tamoxifen, an estrogen antagonist, is widely used; however, approximately 40% of patients develop resistance. Recent studies indicate that microRNAs, especially miR-155, play a critical role in this resistance. Our analysis of MCF-7 tamoxifen-sensitive (TAM-S) and tamoxifen-resistant (TAM-R) cells revealed that miR-155 is significantly upregulated in TAM-R cells. Overexpression of miR-155 in TAM-S cells increased resistance to tamoxifen. Additionally, genistein, a natural isoflavone from soybeans, effectively downregulated miR-155 and its targets associated with apoptosis and glucose metabolism, including STAT3 and hexokinase 2 (HK2). Notably, genistein also significantly decreased cell migration, suggesting potential anti-metastatic effects. Furthermore, genistein reduced glucose consumption, indicating its potential to overcome miR-155-mediated tamoxifen resistance and modulate the Warburg effect. These findings highlight genistein as a promising therapeutic agent for overcoming tamoxifen resistance in ER+ breast cancer and merit further investigation.

MicroRNA-200c (miR-200c) is increasingly recognized as a crucial small RNA molecule that plays a significant and multifaceted role in the complex processes of tumor development, invasion, and metastasis across various types of cancers. Recent studies have compellingly demonstrated that miR-200c exerts its influence on tumor biology by meticulously regulating a range of critical processes, including cell proliferation, apoptosis, epithelial-mesenchymal transition (EMT), and cell migration, all of which are essential for the progression and aggressiveness of tumors. This comprehensive review aims to summarize the expression characteristics and functional implications of miR-200c across a diverse array of tumor types, delving into its potential utility as both a biomarker for early detection and a therapeutic target in the realm of cancer treatment. By synthesizing current research findings and insights, we aspire to provide valuable information that could significantly enhance early diagnostic capabilities and inform the strategic development of targeted therapy approaches in oncology.

Mesenchymal stem cell-derived extracellular vesicles (MSC-EVs) have emerged as a promising therapeutic strategy for spinal cord injury (SCI). These nanosized vesicles possess unique properties such as low immunogenicity and the ability to cross biological barriers, making them ideal carriers for delivering bioactive molecules to injured tissues. MSC-EVs have been demonstrated to exert multiple beneficial effects in SCI, including reducing inflammation, promoting neuroprotection, and enhancing axonal regeneration. Recent studies have delved into the molecular mechanisms underlying MSC-EV-mediated therapeutic effects. Exosomal microRNAs (miRNAs) have been identified as key regulators of various cellular processes involved in SCI pathogenesis and repair. These miRNAs can influence inflammation, oxidative stress, and apoptosis by modulating gene expression. This review summarized the current state of MSC-EV-based therapies for SCI, highlighting the underlying mechanisms and potential clinical applications. We discussed the challenges and limitations of translating these therapies into clinical practice, such as inconsistent EV production, complex cargo composition, and the need for targeted delivery strategies. Future research should focus on optimizing EV production and characterization, identifying key therapeutic miRNAs, and developing innovative delivery systems to maximize the therapeutic potential of MSC-EVs in SCI.

Long non-coding RNAs (lncRNAs) play a pivotal role in regulating gene expression and are critically involved in the progression of malignant brain tumors, including glioblastoma, medulloblastoma, and meningioma. These lncRNAs interact with microRNAs (miRNAs), proteins, and DNA, influencing key processes such as cell proliferation, migration, and invasion. This review highlights the multifaceted impact of lncRNA dysregulation on tumor progression and underscores their potential as therapeutic targets to enhance the efficacy of chemotherapy, radiotherapy, and immunotherapy. The insights provided offer new directions for advancing basic research and clinical applications in malignant brain tumors.

MicroRNAs (miRNAs) are a class of small non-coding RNAs (ncRNAs) crucial for regulating gene expression at the post-transcriptional level. Recent evidence has shown that miRNAs are also found in mitochondria, organelles that produce energy in the cell. These mitochondrial miRNAs, also known as mitomiRs, are essential for regulating mitochondrial function and metabolism. MitomiRs can originate from the nucleus, following traditional miRNA biogenesis pathways, or potentially from mitochondrial DNA, allowing them to directly affect gene expression and cellular energy dynamics within the mitochondrion. While miRNAs have been extensively investigated, the function and involvement of mitomiRs in the development of neurodegenerative disorders like Alzheimer's disease, Parkinson's disease, and amyotrophic lateral sclerosis remain to be elucidated. This review aims to discuss findings on the role of mitomiRs in such diseases and their potential as therapeutic targets, as well as to highlight future research directions.

High concentrations of prolactin (PRL)-induced ovine ovarian granulosa cell (GCs) apoptosis and MAPK12 could aggravate the induced effect. However, the molecular mechanisms that MAPK12 -induced GC apoptosis and repressed steroid hormone secretion remain unclear. In this study, GCs in the P group (GCs with high PRL concentration: 500 ng/mL PRL) and P-10 group (GCs with 500 ng/mL PRL infected by lentiviruses carrying overexpressed sequences of MAPK12 ) were collected for whole-transcriptome analysis. Then, we applied the miRNA mimics combined with a dual-luciferase reporter gene assay to explore the molecular mechanisms through which MAPK12 affected GC apoptosis and steroid hormones secretion. The whole-transcriptome analysis indicated that MAPK12 regulated high PRL concentration GC apoptosis and steroid hormone secretion mainly through novel 58. The expression of pro-apoptotic proteins Caspase 3 and Bax was increased, while the expression of anti-apoptotic protein BCL-2 declined by novel 58-5p in high PRL concentration GCs ( p < 0.05); The secretion of steroid hormones and genes associated with steroid secretion ( CYP11A1 , 3β-HSD and CYP19A1 ) decreased ( p < 0.05), while the protein expression of the target gene, SREBF1 of novel 58, was repressed by novel 58-5p in high PRL concentration GCs ( p < 0.05). Dual-luciferase reporter gene analysis showed that SREBF1 was confirmed as a target gene of novel 58-5p and the negative feedback interaction was established between novel 58-5p and SREBF1 . The ggccggctgggggattgccg sequence may be the target site of SREBF1 , targeted by novel 58-5p. In addition, steroid hormone secretion was reduced and GC apoptosis was suppressed after the interference of SREBF1 in ovine ovarian GCs with high PRL concentration. In conclusion, novel 58-5p regulated ovine ovarian GC apoptosis and steroid hormone secretion by targeting SREBF1 .

Stroke is a major cause of mortality and long-term disability worldwide, making early diagnosis and effective treatment crucial for reducing its impact. In response to the limited efficacy of current treatments, alternative therapeutic strategies, such as novel biomarkers and therapies, are emerging to address this critical unmet medical need. MicroRNAs (miRNAs) are small, non-coding RNAs that regulate gene expression at the post-transcriptional level. Due to their dysregulation, they have been implicated in the onset and progression of various diseases. Recent research highlighted the important role of miR-181 family members in the context of stroke. Polymorphisms such as rs322931 in miR-181b are associated with increased stroke risk. miR-181 family members are aberrantly expressed and related to various aspects of stroke pathology, affecting inflammatory responses or neuronal survival. We provide a comprehensive overview of how alterations in miR-181 expression influence stroke mechanisms and their potential as therapeutic targets.

Cancer is a complex genetic disorder characterized by abnormalities in both coding and regulatory non-coding RNAs. microRNAs (miRNAs) are key regulatory non-coding RNAs that modulate cancer development, functioning as both tumor suppressors and oncogenes. miRNAs play critical roles in cancer progression, influencing key processes such as initiation, promotion, and metastasis. They exert their effects by targeting tumor suppressor genes, thereby facilitating cancer progression, while also inhibiting oncogenes to prevent further disease advancement. The miR-10 family, particularly miR-10a-5p and miR-10b-5p (miR-10a/b-5p), is notably involved in cancer progression. Intriguingly, their functions can differ across different cancers, sometimes promoting and at other times suppressing tumor growth depending on the cancer type and target genes. This review explores the dual roles of miR-10a/b-5p as tumor-suppressive miRNAs (TSmiRs) or oncogenic miRNAs (oncomiRs) in various cancers by examining their molecular and cellular mechanisms and their impact on the tumor microenvironment. Furthermore, we discuss the potential of miR-10a/b-5p as therapeutic targets, emphasizing miRNA-based strategies for cancer treatment. The insights discussed in this review aim to advance our understanding of miR-10a/b-5p's roles in tumor biology and their application in developing innovative cancer therapies.

Plant growth and development require water, but excessive water hinders growth. Sesame ( Sesamum indicum L.) is an important oil crop; it is drought-tolerant but sensitive to waterlogging, and its drought tolerance has been extensively studied. However, the waterlogging tolerance of sesame still has relatively few studies. In this study, two kinds of sesame, R (waterlogging-tolerant) and S (waterlogging-intolerant), were used as materials, and they were treated with waterlogging stress for 0, 24, 72, and 120 h. Physiological analysis showed that after waterlogging, sesame plants responded to stress by increasing the contents of ascorbate peroxidase (APX), glutathione (GSH), and some other antioxidants. The results of the multi-omics analysis of sesame under waterlogging stress revealed 15,652 (R) and 12,156 (S) differentially expressed genes (DEGs), 41 (R) and 47 (S) differentially expressed miRNAs (DEMis), and 896 (R) and 1036 (S) differentially accumulated metabolites (DAMs). The combined DEMi-DEG analysis that 24 DEMis regulated 114 DEGs in response to waterlogging stress. In addition, 13 hub genes and three key pathways of plant hormone signal transduction, glutathione metabolism, and glyoxylate and dicarboxylate metabolism were identified by multi-omics analysis under waterlogging stress. The results showed that sesame regulated the content of hormones and antioxidants and promoted energy conversion in the plant through the above pathways to adapt to waterlogging stress. In summary, this study further analyzed the response mechanism of sesame to waterlogging stress and provides helpful information for the breeding of plants for waterlogging tolerance and genetic improvement.

Fibrosis represents a terminal pathological manifestation encountered in numerous chronic diseases. The process involves the persistent infiltration of inflammatory cells, the transdifferentiation of fibroblasts into myofibroblasts, and the excessive deposition of extracellular matrix (ECM) within damaged tissues, all of which are characteristic features of organ fibrosis. Extensive documentation exists on fibrosis occurrence in vital organs such as the liver, heart, lungs, kidneys, and skeletal muscles, elucidating its underlying pathological mechanisms. Regular exercise is known to confer health benefits through its anti-inflammatory, antioxidant, and anti-aging effects. Notably, exercise exerts anti-fibrotic effects by modulating multiple pathways, including transforming growth factor-β1/small mother decapentaplegic protein (TGF-β1/Samd), Wnt/β-catenin, nuclear factor kappa-B (NF-kB), reactive oxygen species (ROS), microRNAs (miR-126, miR-29a, miR-101a), and exerkine (FGF21, irisin, FSTL1, and CHI3L1). Therefore, this paper aims to review the specific role and molecular mechanisms of exercise as a potential intervention to ameliorate organ fibrosis.

MicroRNA (miR)-126 is frequently downregulated in malignancies, including breast cancer (BC). Despite its tumor-suppressive role, the mechanisms underlying miR-126 deregulation in BC remain elusive. Through silencing experiments, we identified Early B Cell Factor 1 (EBF1), ETS Proto-Oncogene 2 (ETS2), and Krüppel-Like Factor 2 (KLF2) as pivotal regulators of miR-126 expression. These transcription factors were found to be downregulated in BC due to epigenetic silencing or a "poised but not transcribed" promoter state, impairing miR-126 expression. Gene Ontology analysis of differentially expressed miR-126 target genes in the Cancer Genome Atlas: Breast Invasive Carcinoma (TCGA-BRCA) cohort revealed their involvement in cancer-related pathways, primarily signal transduction, chromatin remodeling/transcription, and differentiation/development. Furthermore, we defined interconnections among transcription factors, miR-126, and target genes, identifying a potential feed-forward loop (FFL) crucial in maintaining cellular identity and preventing the acquisition of stemness properties associated with cancer progression. Our findings propose that the dysregulation of the EBF1/ETS2/KLF2/miR-126 axis disrupts this FFL, promoting oncogenic transformation and progression in BC. This study provides new insights into the molecular mechanisms of miR-126 downregulation in BC and highlights potential targets for therapeutic intervention. Further research is warranted to clarify the role of this FFL in BC, and to identify novel therapeutic strategies aimed at modulating this network as a whole, rather than targeting individual signals, for cancer management.

While ultraviolet C (UVC) radiation has beneficial applications, it can also pose risks to living organisms. Nevertheless, a detailed assessment of UVC radiation's effects on mammalian male reproductive physiology, including the underlying mechanisms and potential protective strategies, has not yet been accomplished. This study aimed to examine the critical roles of oxidative stress, autophagy, reproductive hormonal axis, and microRNAs in UVC-induced reproductive challenges in male rats. Semen, biochemical, molecular, and in silico analyses revealed significant dysregulation of testicular steroidogenesis, impaired spermatogenesis, deteriorated sperm quality, and altered reproductive hormonal profiles, which ultimately lead to a decline in fertility in male rats exposed to UVC radiation. Our data indicated that the suppression of autophagy, stimulation of gonadotropin-inhibiting hormone (GnIH), and alteration of microRNAs serve as key mediators of UVC-induced stress effects in mammalian reproduction, potentially contributing to male infertility. Targeting these pathways, particularly through pretreatment with hesperidin (HES), offers a promising strategy to counteract UVC-induced male infertility. In conclusion, the present findings emphasize the importance of understanding the molecular mechanisms behind UVC-induced male infertility and offer valuable insights into the protective mechanisms and prospective role of HES in safeguarding male reproductive health.

MicroRNAs play a pivotal role in the regulation of adipose tissue function and have emerged as promising therapeutic candidates for the management of obesity and associated comorbidities. Among them, miR-1 could be a potential biomarker for metabolic diseases and contribute to metabolic homeostasis. However, thorough research is required to fully elucidate the impact of miR-1 on human adipocyte thermogenesis and metabolism. This study aimed to explore the effect of miR-1 on human adipocyte browning, a process whose activation has been linked to obesity protection and counteraction. Human multipotent adipose-derived stem cells, hMADS cells, were differentiated into white and brown-like adipocytes and transfected with miR-1 mimics for gene expression and western blotting analyses. miR-1 inhibited the expression of its previously validated target PTK9 / TWF1 and modulated the expression profile of key genes involved in thermogenesis and adipocyte browning (increased UCP1 at mRNA and protein level, increased CPT1M , decreased HIF3A ), adipocyte differentiation and metabolism (decreased PLIN1 , FASN , RXRA , PPARG , FABP4 , MAPKAPK2 ), as well as genes related to the cytoskeleton (decreased ACTB ) and extracellular matrix (decreased COL1A1 ). These findings suggest that miR-1 can modulate the expression of adipocyte human genes associated with thermogenesis and metabolism, which could hold value for eventual therapeutic potential in obesity.

Myocardial infarction (MI) is a highly challenging and fatal disease, with diverse challenges arising at different stages of its progression. As such, non-coding RNAs (ncRNAs), which can broadly regulate cell fate, and stem cells with multi-differentiation potential are emerging as novel therapeutic approaches for treating MI across its various stages. NcRNAs, including microRNAs (miRNAs) and long non-coding RNAs (LncRNAs), can directly participate in regulating intracellular signaling pathways, influence cardiac angiogenesis, and promote the repair of infarcted myocardium. Currently, stem cells commonly used in medicine, such as mesenchymal stem cells (MSCs) and induced pluripotent stem cells (iPSCs), can differentiate into various human cell types without ethical concerns. When combined with ncRNAs, these stem cells can more effectively induce directed differentiation, promote angiogenesis in the infarcted heart, and replenish normal cardiac cells. Additionally, stem cell-derived exosomes, which contain various ncRNAs, can improve myocardial damage in the infarcted region through paracrine mechanisms. However, our understanding of the specific roles and mechanisms of ncRNAs, stem cells, and exosomes secreted by stem cells during different stages of MI remains limited. Therefore, this review systematically categorizes the different stages of MI, aiming to summarize the direct regulatory effects of ncRNAs on an infarcted myocardium at different points of disease progression. Moreover, it explores the specific roles and mechanisms of stem cell therapy and exosome therapy in this complex pathological evolution process. The objective of this review was to provide novel insights into therapeutic strategies for different stages of MI and open new research directions for the application of stem cells and ncRNAs in the field of MI repair.

Fasciolosis is a neglected tropical disease caused by helminth parasites of the genus Fasciola spp., including Fasciola hepatica ( F. hepatica ) and Fasciola gigantica ( F. gigantica ), being a major zoonotic problem of human and animal health. Its control with antihelminthics is becoming ineffective due to the increase in parasite resistance. Developing new therapeutic protocols is crucial to a deeper knowledge of the molecular bases in the host-parasite interactions. The high-throughput omics technologies have dramatically provided unprecedented insights into the complexity of the molecular host-parasite crosstalk. MicroRNAs (miRNAs) are key players as critical regulators in numerous biological processes, modifying the gene expression of cells by degradation of messenger RNA (mRNA), regulating transcription and translation functions, protein positioning, cell cycle integrity, differentiation and apoptosis. The large-scale exploration of miRNAs, including the miRNome, has offered great scientific knowledge of steps in fasciolosis, further scrutinizing the pathogenesis, the growth and development of their strains and their interaction with the host for the survival of the different parasite stages. This review compiles the updated knowledge related to miRNAs involved in fasciolosis and the generated miRNome, highlighting the importance of these key molecules in the host-parasite interactions and the pathogenesis of Fasciola spp. directing towards the development of new biotherapeutic protocols for the control of fasciolosis.

Growing scientific evidence suggests a strong interconnection between inflammatory skin diseases and osteoporosis (OP), a systemic condition characterized by decreased bone density and structural fragility. These conditions seem to share common pathophysiological mechanisms, including immune dysregulation, chronic inflammation, and vitamin D deficiency, which play a crucial role in both skin and bone health. Additionally, the roles of gut microbiota (GM) and epigenetic regulation via microRNAs (miRNAs) emerge as key elements influencing the progression of both conditions. This review aims to examine the skin-bone axis, exploring how factors such as vitamin D, GM, and miRNAs interact in a subtle pathophysiological interplay driving skin inflammation and immune-metabolic bone alterations. Recent research suggests that combined therapeutic approaches-including vitamin D supplementation, targeted microbiota interventions, and miRNA-based therapies-could be promising strategies for managing comorbid inflammatory skin diseases and OP. This perspective highlights the need for multidisciplinary approaches in the clinical management of conditions related to the skin-bone axis.

The specific expression profile and function of circular RNA (circRNA) in follicular atresia remain largely unknown. Here, the circRNA expression profiles of granulosa cells derived from healthy follicles (HFs) and antral follicles (AFs) in buffalo were analyzed by RNA-seq, and the mechanism of a differentially expressed circRNA (DEcircRNA) circTEC regulating the granulosa cell function that affects follicular atresia was further explored. RNA-seq results showed that a total of 112 DEcircRNAs were identified. Among them, circTEC was highly expressed in HF, and its circular structure was confirmed by RNase R digestion assay, reversed PCR and Sanger sequencing. Functional experiments demonstrated that circTEC promotes the proliferation and steroid hormone synthesis of buffalo granulosa cells (bGCs), and it also inhibits their apoptosis. In-depth mechanism analysis showed that the expression level of circTEC in bGCs from AFs was adversely related to miR-144-5p and consistent with FZD3. CircTEC acts as an endogenous sponge of miR-144-5p to regulate the expression of the target gene FZD3 in AFs, which promotes the proliferation of bGCs and inhibits bGCs apoptosis, thereby inhibiting follicular atresia in buffalo. In summary, our study revealed the regulatory role of the circTEC/miR-144-5p/FZD3 axis during follicular atresia in buffalo. These results provided new insights into the biological mechanism underlying follicular atresia.

MicroRNAs (miRNAs) are short sequences of single-stranded non-coding RNAs that target messenger RNAs, leading to their repression or decay. Interestingly, miRNAs play a role in the cellular response to low oxygen levels, known as hypoxia, which is associated with reactive oxygen species and oxidative stress. However, the physiological implications of hypoxia-induced miRNAs ("hypoxamiRs") remain largely unclear. Here, we investigate the role of miR-210 in brown adipocyte differentiation and thermogenesis. We treated the cells under sympathetic stimulation with hypoxia, CoCl 2 , or IOX2. To manipulate miR-210, we performed reverse transfection with antagomiRs. Adipocyte markers expression, lipid accumulation, lipolysis, and oxygen consumption were measured. Hypoxia hindered BAT differentiation and suppressed sympathetic stimulation. Hypoxia-induced HIF-1α stabilization increased miR-210 in brown adipocytes. Interestingly, miR-210-5p enhanced differentiation under normoxic conditions but was insufficient to rescue the inhibition of brown adipocyte differentiation under hypoxic conditions. Although adrenergic stimulation activated HIF-1α signaling and upregulated miR-210 expression, inhibition of miR-210-5p did not significantly influence UCP1 expression or oxygen consumption. In summary, hypoxia and adrenergic stimulation upregulated miR-210, which impacted brown adipocyte differentiation and thermogenesis. These findings offer new insights for the physiological role of hypoxamiRs in brown adipose tissue, which could aid in understanding oxidative stress and treatment of metabolic disorders.

During all periods of male ontogenesis, physiological processes responsible for the correct functioning of reproductive organs and spermatogenesis are under the influence of various factors (neuro-humoral, genetic, and paratypical). Recently, the attention of researchers has increasingly turned to the study of epigenetic factors. In scientific publications, one can increasingly find references to the direct role of microRNAs, small non-coding RNAs involved in post-transcriptional regulation of gene expression, in the processes of development and functioning of reproductive organs. Although the role of microRNAs in the reproduction of mammals, including humans, has been intensively studied, this area of knowledge in birds remains under-researched and limited to single experiments. This is likely due to the unique features of embryogenesis and the structure of the avian reproductive system. This review summarizes the current state of knowledge on the role of microRNAs in avian reproduction. Insight into the molecular basis of spermatogenesis in Gallus gallus domesticus is provided. Data on the functions and mechanisms by which microRNAs influence the processes of growth, development, and formation of rooster germ cells that determine the necessary morphofunctional qualitative characteristics of mature spermatozoa are summarized. Particular attention is paid to miRNA biogenesis as an important step affecting the success of spermatogenesis, as well as the role of miRNAs in avian sex differentiation during early embryogenesis. The modern literature sources systematized in this review, revealing the questions about the role of miRNAs in the reproductive function of birds, create a theoretical basis and define new perspectives and directions for further research in this field.

Cells meticulously regulate free calcium ion (Ca 2+ ) concentrations, with the endoplasmic reticulum (ER) being crucial for Ca 2+ homeostasis. Disruptions in ER Ca 2+ balance can contribute to various diseases, including cancer. Although considerable research has focused on the direct mechanisms of ER Ca 2+ regulation, the role of microRNAs (miRNAs) in this process remains underexplored. Mainly using data from a CRISPR-based genomic screening previously conducted in our laboratory, we identified 33 candidate miRNAs that may regulate ER Ca 2+ levels. From these, 10 miRNAs were found to significantly lower basal ER Ca 2+ levels. RNA sequencing analysis indicated that these miRNAs downregulate the tumor suppressor tumor protein p53 (TP53)-inducible protein 11 gene ( TP53I11 ), which is a key regulator of ER Ca 2+ levels. Functional assays confirmed that TP53I11 influences ER Ca 2+ levels and affects cancer cell proliferation. Additionally, the chemotherapeutic agent doxorubicin (DOX) was shown to upregulate TP53I11 and enhance ER Ca 2+ accumulation. These findings elucidate the central role of TP53I11 in miRNA-mediated regulation of ER Ca 2+ homeostasis and suggest potential therapeutic strategies targeting ER Ca 2+ upregulation for cancer intervention.

Osteoarthritis (OA) is a degenerative joint disease characterized by the breakdown of cartilage and the subsequent inflammation of joint tissues, leading to pain and reduced mobility. Despite advancements in symptomatic treatments, disease-modifying therapies for OA remain limited. This narrative review examines the dual role of autophagy in OA, emphasizing its protective functions during the early stages and its potential to contribute to cartilage degeneration in later stages. By delving into the molecular pathways that regulate autophagy, this review highlights its intricate interplay with oxidative stress and inflammation, key drivers of OA progression. Emerging therapeutic strategies aimed at modulating autophagy are explored, including pharmacological agents such as AMP kinase activators, and microRNA-based therapies. Preclinical studies reveal encouraging results, demonstrating that enhancing autophagy can reduce inflammation and decelerate cartilage degradation. However, the therapeutic benefits of autophagy modulation depend on precise, stage-specific approaches. Excessive or dysregulated autophagy in advanced OA may lead to chondrocyte apoptosis, exacerbating joint damage. This review underscores the promise of autophagy-based interventions in bridging the gap between experimental research and clinical application. By advancing our understanding of autophagy's role in OA, these findings pave the way for innovative and effective therapies. Nonetheless, further research is essential to optimize these strategies, address potential off-target effects, and develop safe, targeted treatments that improve outcomes for OA patients.

Regenerative medicine and tissue engineering aim to restore or replace impaired organs and tissues using cell transplantation supported by scaffolds. Recently scientists are focusing on developing new biomaterials that optimize cellular attachment, migration, proliferation, and differentiation. Nanoparticles, such as graphene oxide (GO), have emerged as versatile materials due to their high surface-to-volume ratio and unique chemical properties, such as electrical conductivity and flexibility. However, GO faces challenges such as cytotoxicity at high concentrations, a negative surface charge, and potential inflammatory responses; for these reasons, variations in synthesis have been studied. A GO derivative, Graphene Oxide-Polyethylenimine (GO-PEI), shows controlled porosity and structural definition, potentially offering better support for cell growth. Human amniotic fluid stem cells (hAFSCs) are a promising candidate for regenerative medicine due to their ability to differentiate into mesodermic and ectodermic lineages, their non-immunogenic nature, and ease of isolation. This study investigates the effects of GO and GO-PEI on hAFSCs, focusing on the effects on adhesion, proliferation, and metabolic features. Results indicate that GO-PEI restores cell proliferation and mitochondrial activity to control levels, with respect to GO that appeared less biocompatible. Both materials also influence the miRNA cargo of hAFSC-derived microvesicles, potentially influencing also cell-to-cell communication.

Long noncoding RNAs (LncRNAs) play essential roles in numerous biological processes in mammals, such as reproductive physiology and endocrinology. Cryptorchidism is a common male reproductive disease. Circadian rhythms are actively expressed in the reproductive system. In this study, a total of 191 LncRNAs were obtained from yak testes and cryptorchids. Then, we identified NTRK2's relationship to circadian rhythm and behavioral processes. Meanwhile, the ceRNA (LncRNA-MSTRG.19083.1/miR-429-y/NTRK2) network was constructed, and its influence on circadian rhythm was revealed. The results showed that NTRK2 and LncRNA-MSTRG.19083.1 were significantly upregulated, and miR-429-y was obviously decreased in cryptorchid tissue; NTRK2 protein was mainly distributed in the Leydig cells of the testis. In addition, the upregulation of the expression level of miR-429-y resulted in the significant downregulation of LncRNA and NTRK2 levels, while the mRNA and protein levels of CREB, CLOCK, and BMAL1 were significantly upregulated; the knockdown of miR-429-y resulted in the opposite changes. Our findings suggested that LncRNA-MSTRG.19083.1 competitively binds to miR-429-y to target NTRK2 to regulate circadian rhythm through the cAMP pathway. Taken together, the results of our study provide a comprehensive understanding of how the LncRNA-miRNA-mRNA networks operate when yak cryptorchidism occurs. Knowledge of circadian-rhythm-associated mRNAs and LncRNAs could be useful for better understanding the relationship between circadian rhythm and reproduction.

Cardiovascular diseases (CVDs) are the leading cause of death worldwide, and effectively repairing the heart following myocardial injuries remains a significant challenge. Research has increasingly shown that exosomes derived from mesenchymal stem cells (MSC-Exo) can ameliorate myocardial injuries and improve outcomes after such injuries. The therapeutic benefits of MSC-Exo are largely due to their capacity to deliver specific cargo, including microRNAs and proteins. MSC-Exo can modulate various signaling pathways and provide several beneficial effects, including cytoprotection, inflammation modulation, and angiogenesis promotion to help repair the damaged myocardium. In this review, we summarize the cardioprotective effects of MSC-Exo in myocardial injury, the underlying molecular mechanism involved in the process, and various approaches studied to enhance their efficacy based on recent findings.

Circulating microRNAs (miRNAs), especially transported by extracellular vesicles (EVs), have recently emerged as major new participants in interorgan communication, playing an important role in the metabolic coordination of our tissues. Among these, adipose tissue displays an extraordinary ability to secrete a vast list of EV-carried miRNAs into the circulation, representing new hormone-like factors. Despite the limitations of current methodologies for the unequivocal identification of the origin and destination of EV-carried miRNAs in vivo, recent investigations clearly support the important regulatory role of adipose-derived circulating miRNAs in shaping the metabolism and function of other tissues including the liver, muscle, endocrine pancreas, cardiovascular system, gastrointestinal tract, and brain. Here, we review the most recent findings regarding miRNAs transported by adipose-derived EVs (AdEVs) targeting other major metabolic organs and the implications of this dialog for physiology and pathology. We also review here the current and potential future diagnostic and therapeutic applications of AdEV-carried miRNAs.

Doxorubicin (DOX), a cornerstone chemotherapeutic agent, effectively combats various malignancies but is marred by significant cardiovascular toxicity, including endothelial damage, chronic heart failure, and vascular remodeling. These adverse effects, mediated by oxidative stress, mitochondrial dysfunction, inflammatory pathways, and dysregulated autophagy, underscore the need for precise therapeutic strategies. Emerging research highlights the critical role of microRNAs (miRNAs) in DOX-induced vascular remodeling and cardiotoxicity. miRNAs, such as miR-21, miR-22, miR-25, miR-126, miR-140-5p, miR-330-5p, miR-146, miR-143, miR-375, miR-125b, miR-451, miR-34a-5p, and miR-9, influence signaling pathways like TGF-β/Smad, AMPKa/SIRT, NF-κB, mTOR, VEGF, and PI3K/AKT/Nrf2, impacting vascular homeostasis, angiogenesis, and endothelial-to-mesenchymal transition. Despite existing studies, gaps remain in understanding the full spectrum of miRNAs involved and their downstream effects on vascular remodeling. This review synthesizes the current knowledge on miRNA dysregulation during DOX exposure, focusing on their dual roles in cardiovascular pathology and tumor progression. Strategies to reduce DOX cardiotoxicity include modulating miRNA expression to restore signaling balance, targeting pro-inflammatory and pro-fibrotic pathways, and leveraging miRNA inhibitors or mimics. This review aims to organize and integrate the existing knowledge on the role of miRNAs in vascular remodeling, particularly in the contexts of DOX treatment and the progression of various cardiovascular diseases, including their potential involvement in tumor growth.

The increasing incidence and mortality rates of liver cancer have heightened the demand for the development of effective anticancer drugs with minimal side effects. In this study, the roles of exosomes derived from liver cancer stem cells (LCSCs) with PRELI (Protein of Relevant Evolutionary and Lymphoid Interest) modulation and their miRNAs were investigated to explore their therapeutic properties for liver cancer. Various techniques, such as miRNA profiling, microRNA transfection, overexpression, flow cytometry, Western blotting, and immunocytochemistry, were used to evaluate the effects of exosomes under PRELI up- and downregulation. Downregulated PRELI cellular exosomes (DPEs) reduced the levels of five markers-CD133, CD90, CD24, CD13, and EpCAM-in LCSCs, with the exception of OV-6. Conversely, upregulated PRELI cellular exosomes (UPEs) significantly increased the expression of CD90, CD24, and CD133 in NHs, with the maximum increase in CD24. PRELI upregulation altered expression levels of miRNAs, including hsa-miR-378a-3p (involved in stem-like properties), hsa-miR-25-3p (contributing to cell proliferation), and hsa-miR-423-3p (driving invasiveness). Exosomes with downregulated PRELI inhibited the AKT/mTORC1 signaling pathway, whereas LCSCs transfected with the candidate miRNAs activated it. Additionally, under PRELI upregulation, exosomes showed increased surface marker expression, promoting cancer progression. The modulation of PRELI in LCSCs affected miRNA expression significantly, revealing candidate miRNA targets for liver cancer treatment. Exosomes with PRELI downregulation show potential as a novel therapeutic strategy. Consequently, this study proposes the potential of PRELI-induced exosomes and the three miRNAs as a liver anticancer therapeutic candidate.

Historically, microglial activation has been associated with diseases of a neurodegenerative and neuroinflammatory nature. Some, like Alzheimer's disease, Parkinson's disease, and multiple system atrophy, have been explored extensively, while others pertaining to metabolism not so much. However, emerging evidence points to hypothalamic inflammation mediated by microglia as a driver of metabolic dysregulations, particularly insulin resistance and type 2 diabetes mellitus. Here, we explore this connection further and examine pathways that underlie this relationship, including the IKKβ/NF-κβ, IRS-1/PI3K/Akt, mTOR-S6 Kinase, JAK/STAT, and PPAR-γ signaling pathways. We also investigate the role of non-coding RNAs, namely microRNAs and long non-coding RNAs, in insulin resistance related to neuroinflammation and their diagnostic and therapeutic potential. Finally, we explore therapeutics further, searching for both pharmacological and non-pharmacological interventions that can help mitigate microglial activation.

Plant diseases diminish crop yields and put the world's food supply at risk. Plant elicitor peptides (Peps) are innate danger signals inducing defense responses both naturally and after external application onto plants. Pep-triggered defense networks are compatible with pattern-triggered immunity (PTI). Nevertheless, in complex regulatory pathways, there is crosstalk among different signaling pathways, involving noncoding RNAs in the natural response to pathogen attack. Here, we used Prunus persica , PpPep2 and a miRNA-Seq approach to show for the first time that Peps regulate, in parallel with a set of protein-coding genes, a set of plant miRNAs (~15%). Some PpPep2-regulated miRNAs have been described to participate in the response to pathogens in various plant-pathogen systems. In addition, numerous predicted target mRNAs of PpPep2-regulated miRNAs are themselves regulated by PpPep2 in peach trees. As an example, peach miRNA156 and miRNA390 probably have a role in plant development regulation under stress conditions, while others, such as miRNA482 and miRNA395, would be involved in the regulation of resistance (R) genes and sulfate-mediated protection against oxygen free radicals, respectively. This adds to the established role of Peps in triggering plant defense systems by incorporating the miRNA regulatory network and to the possible use of Peps as sustainable phytosanitary products.

Male-typical behaviors such as aggression and mating, which reflect sexual libido in male mice, are regulated by the hypothalamus, a crucial part of the nervous system. Previous studies have demonstrated that microRNAs (miRNAs), especially miR-29 , play a vital role in reproduction and the neural control of behaviors. However, it remains unclear whether miR-29 affects reproduction through the hypothalamus-mediated regulation of male-typical behaviors. Here, we constructed two mouse knockout models by ablating either the miR-29ab1 or miR-29b2c cluster. Compared to WT, the ablation of miR-29ab1 in male mice significantly reduced the incidence of aggression by 60% and the incidence of mating by 46.15%. Furthermore, the loss of miR-29ab1 in male mice led to the downregulation of androgen receptor (AR) in the ventromedial hypothalamus. Transcriptomic analysis of the hypothalamus of miR-29ab1 -deficient mice revealed inflammatory activation and aberrant expression of genes associated with male-typical behaviors, including Ar , Pgr , Htr4 , and Htr2c . Using bioinformatics analysis and dual-luciferase reporter assays, we identified zinc finger protein 36 ( Zfp36 ) as a direct downstream target gene of miR-29ab1 . We subsequently showed that ZFP36 colocalized with AR in GT1-7 cells. Furthermore, inhibition of Zfp36 or RelB in GT1-7 cells led to an increase in AR expression. Collectively, our results demonstrate that the miR-29ab1/Zfp36/AR axis in the hypothalamus plays a pivotal role in the regulation of aggression and mating in male mice, providing a potential therapeutic target for treating infertility caused by low libido.

Microorganisms that colonize the intestine communicate with the host in various ways and affect gut function and health. Extracellular vesicles (EVs), especially their encapsulated microRNAs (miRNAs), participate in the complex and precise regulation of microbiota-host interactions in the gut. These roles make miRNAs critically important for the prevention, diagnosis, and treatment of intestinal diseases. Here, we review the current knowledge on how different sources of EVs and miRNAs, including those from diets, gut microbes, and hosts, maintain gut microbial homeostasis and improve the intestinal barrier and immune function. We further highlight the roles of EVs and miRNAs in intestinal diseases, including diarrhea, inflammatory bowel disease, and colorectal cancer, thus providing a perspective for the application of EVs and miRNAs in these diseases.

The study of microRNAs (miRNAs) has emerged in recent decades as a key approach to understanding the pathophysiology of many diseases, exploring their potential role as biomarkers, and testing their use as future treatments. Not only have neurological, cardiovascular diseases, or cancer benefited from this research but also infertility. Female infertility, as a disease, involves alterations at multiple levels, such as ovarian and uterine alterations. This review compiles the latest studies published in humans that link female disorders that affect fertility with altered miRNA profiles. Studies on ovarian alterations, including diminished ovarian reserve (DOR), poor ovarian response to stimulation (POR), premature ovarian insufficiency (POI), and polycystic ovary syndrome (PCOS), are summarized and classified based on the expression and type of sample analyzed. Regarding uterine disorders, this review highlights upregulated and downregulated miRNAs primarily identified as biomarkers for endometriosis, adenomyosis, decreased endometrial receptivity, and implantation failure. However, despite the large number of studies in this field, the same limitations that reduce reproducibility are often observed. Therefore, at the end of this review, the main limitations of this type of study are described, as well as specific precautions or safety measures that should be considered when handling miRNAs.

Maternal unbalanced diets cause adverse metabolic programming and affect the offspring's liver microRNA (miRNA) profile. The liver is a site of β-carotene (BC) metabolism and a target of BC action. We studied the interaction of maternal Western diet (WD) and early-life BC supplementation on the epigenetic remodeling of offspring's liver microRNAs. Mouse offspring of WD-fed mothers were given a daily placebo (controls) or BC during suckling. Biometric parameters and liver miRNAome by microarray hybridization were analyzed in newly weaned animals. BC sex-dependently impacted the liver triacylglycerol content. The liver miRNAome was also differently affected in male and female offspring, with no overlap in differentially expressed (DE) miRNAs between sexes and more impact in females. Bioinformatic analysis of DE miRNA predicted target genes revealed enrichment in biological processes/pathways related to metabolic processes, regulation of developmental growth and circadian rhythm, liver homeostasis and metabolism, insulin resistance, and neurodegeneration, among others, with differences between sexes. Fifty-five percent of the overlapping target genes in both sexes identified were targeted by DE miRNAs changed in opposite directions in males and females. The results identify sex-dependent responses of the liver miRNA expression profile to BC supplementation during suckling and may sustain further investigations regarding the long-term impact of early postnatal life BC supplementation on top of an unbalanced maternal diet.

As one of the most prevalent malignant neoplasms among women globally, the optimization of therapeutic strategies for breast cancer has perpetually been a research hotspot. The tumor microenvironment (TME) is of paramount importance in the progression of breast cancer, among which the extracellular matrix (ECM) and hypoxia are two crucial factors. The alterations of these two factors are predominantly regulated by the Hippo signaling pathway, which promotes tumor invasiveness, metastasis, therapeutic resistance, and susceptibility. Hence, this review focuses on the Hippo pathway in breast cancer, specifically, how the ECM and hypoxia impact the biological traits and therapeutic responses of breast cancer. Moreover, the role of miRNAs in modulating ECM constituents was investigated, and hsa-miR-33b-3p was identified as a potential therapeutic target for breast cancer. The review provides theoretical foundations and potential therapeutic direction for clinical treatment strategies in breast cancer, with the aspiration of attaining more precise and effective treatment alternatives in the future.

Obesity is the fifth leading cause of death globally and its comorbidities put a high burden on societies and cause disability. In this review, we aim to summarize the interactions and crosstalk between gut microbiota and micro-RNA (miRNA) in obesity. We searched for the relevant literature through PubMed, Web of Science, Scopus, and Science Direct. The study design is registered in the international prospective register of systematic reviews (Prospero). According to the inclusion criteria, eight studies were eligible for assessment (two studies including human subjects and six studies including animal subjects). We report that the interactions of miRNA and gut microbiota in the context of obesity are diverse and in some cases tissue specific. However, the interactions mediate obesity-associated pathways including the inflammatory response, oxidative stress, insulin signaling, gut permeability, and lipogenesis. To mention the most meaningful results, the expression of adipose tissue miRNA-378a-3p/5p was associated with Bifidobacterium and Akkermansia abundance, the expression of hepatic miRNA-34a was related to the Firmicutes phylum, and the expression of miRNA-122-5p and miRNA-375 was associated with the Bacteroides genus. miRNA-microbiota-associated pathological pathways seem to provide an intricate, but promising field for future research directed toward the treatment of obesity and its comorbidities.

Parkinson's disease (PD), as a widespread neurodegenerative disorder, significantly impacts patients' quality of life. Its primary symptoms include motor disturbances, tremor, muscle stiffness, and balance disorders. In recent years, with the advancement of research, the concept of the bone-brain axis has gradually become a focal point in the field of PD research. The bone-brain axis refers to the interactions and connections between the skeletal system and the central nervous system (CNS), playing a crucial role in the pathogenesis and pathological processes of PD. The purpose of this review is to comprehensively and deeply explore the bone-brain axis in PD, covering various aspects such as the complex relationship between bone metabolism and PD, the key roles of neurotransmitters and hormones in the bone-brain axis, the role of inflammation and immunity, microRNA (miRNA) functional regulation, and potential therapeutic strategies. Through a comprehensive analysis and in-depth discussion of numerous research findings, this review aims to provide a solid theoretical foundation for a deeper understanding of the pathogenesis of PD and to offer strong support for the development of new treatment methods.

MicroRNAs (miRNAs) maintain cellular homeostasis by blocking mRNAs by binding with them to fine-tune the expression of genes across numerous biological pathways. The 2024 Nobel Prize in Medicine and Physiology for discovering miRNAs was long overdue. We anticipate a deluge of research work involving miRNAs to repeat the history of prizes awarded for research on other RNAs. Although miRNA therapies are included for several complex diseases, the realization that miRNAs regulate genes and their roles in addressing therapies for hundreds of diseases are expected; but with advancement in drug discovery tools, we anticipate even faster entry of new drugs. To promote this, we provide details of the current science, logic, intellectual property, formulations, and regulatory process with anticipation that many more researchers will introduce novel therapies based on the discussion and advice provided in this paper., Competing Interests: Author S.K.N. is a developer of biological drugs and a consultant to the FDA, EMA, and MHRA and the U.S. Senate. M.M. is a manufacturer of pharmaceutical products. All the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.

It has been demonstrated that cancer cells that have survived cancer treatment may be more malignant than the original cancer cells. These cells are considered the main cause of metastasis in prognosis. A Nanog -overexpressing colon-26 ( Nanog + colon26) was generated to obtain such a malignant cancer cell model, which was confirmed by enhancement of metastatic potential by in vivo tests using mice. Extracellular vesicles (EVs) secreted from Nanog + colon26 cells ( Nanog + colon26EVs) were administered to mice three times per week for three weeks. Subsequently, Nanog + colon26 cells were administered, and metastatic colonies were analyzed two weeks later. The results demonstrated that the administration of EVs suppressed metastasis. Nanog + colon26EVs enhanced phagocytic activity and M1 marker CD80 of a macrophage cell line J774.1. These suggested the enforcement of tumor-suppressive properties of macrophages and their contribution to the in vivo suppression of metastasis. Small RNA sequencing was conducted to identify Nanog -dependent miRNAs that exhibited significant changes (Fc ≥ 1.5 or Fc ≤ 1/1.5; p < 0.05) in Nanog + colon26EVs relative to colon26EVs. Nine miRNAs (up-regulated: four, down-regulated: five) were identified, and 623 genes were predicted to be their target genes. Of the 623 genes identified, nine genes were predicted to be highly relevant to macrophage functions such as phagocytosis.

This study explores how select microRNAs (miRNAs) influence bone structure in humans and in transgenic mice. In trabecular bone biopsies from 84 postmenopausal women (healthy, osteopenic, and osteoporotic), we demonstrate that DLEU2 (deleted in lymphocytic leukemia 2)-encoded miR-15a-5p is strongly positively associated with bone mineral density (BMD) at different skeletal sites. In bone transcriptome analyses, miR-15a-5p levels correlated positively with the osteocyte characteristic transcripts SOST (encoding sclerostin) and MEPE (Matrix Extracellular Phosphoglycoprotein), while the related miR-15b-5p showed a negative association with BMD and osteoblast markers. The data imply that these miRNAs have opposite roles in bone remodeling with distinct actions on bone cells. Expression quantitative trait loci (eQTL) variants confirmed earlier DLEU2 associations. Furthermore, a novel variant (rs12585295) showed high localization with transcriptionally active chromatin states in osteoblast primary cell cultures. The supposition that DLEU2 -encoded miRNAs have an important regulatory role in bone remodeling was further confirmed in a transgenic mice model showing that miR-15a/16-1 -deleted mice had significantly higher percentage bone volume and trabecular number than the wild type, possibly due to prenatal actions. However, the three-point mechanical break force test of mice femurs showed a positive correlation between strength and miR-15a-5p/miR-16-5p levels, indicating differential effects on cortical and trabecular bone. Moreover, these miRNAs appear to have distinct and complex actions in mice prenatally and in adult humans, impacting BMD and microstructure by regulating bone cell transcription. However, detailed interactions between these miRNAs and their downstream mechanisms in health and disease need further clarification.

Silicosis is one of the most prevalent and fatal occupational diseases worldwide, with unsatisfactory clinical outcomes. This study aimed to investigate the therapeutic effect and related molecular mechanisms of how mesenchymal stem cell (MSC)-secreted exosomes alleviate SiO 2 -induced pulmonary fibrosis. miR-99a-5p was significantly downregulated in silicosis models via high-throughput miRNA screening, and was overlapped with miRNAs in exosomes from MSCs. miR-99a-5p was significantly downregulated in the lung of a mice silicosis model and in TGFβ1-induced NIH-3T3 cells. In contrast, fibroblast growth factor receptor 3 ( FGFR3 ), a direct target gene of miR-99a-5p, was upregulated in vitro and in vivo. Furthermore, we demonstrated that MSC-derived exosomes deliver enriched miR-99a-5p to target cells and inhibit TGF-β1-induced fibroblast transdifferentiation to reduce collagen protein production. Similarly, in a silicosis mouse model, MSC-derived exosome treatment through the tail veins of the mice counteracted the upregulation of fibrosis-related proteins and collagen deposition in the lung of the mice. By constructing exosomal therapeutic cell models with different miR-99a expressions, we further demonstrated that miR-99a-5p might attenuate pulmonary fibrosis by regulating target protein FGFR3 and downstream mitogen-activated protein kinase (MAPK) signalling pathways. Our study demonstrated that MSC-derived exosomes ameliorate SiO 2 -induced pulmonary fibrosis by inhibiting fibroblast transdifferentiation and represent an attractive method of pulmonary fibrosis treatment.

In regenerative medicine, stromal cells are supposed to play an important role by modulating immune responses and differentiating into various tissue types. The aim of this study was to investigate the influence of heparin, frequently used as an anticoagulant in human platelet lysate (HPL)-supplemented cell cultures, on the expression of non-coding RNA species, particularly microRNAs (miRNA), which are pivotal regulators of gene expression. Through genomic analysis and quantitative RT-PCR, we assessed the differential impact of heparin on miRNA expression in various stromal cell types, derived from human bone marrow, umbilical cord and white adipose tissue. Our results demonstrate that heparin significantly alters miRNA expression, with distinct up- and downregulation patterns depending on the original tissue source of human stromal cells. Furthermore, our analyses indicate that these heparin-induced alterations in miRNA expression profiles influence critical cellular processes, including proliferation, apoptosis and differentiation. In conclusion, our study highlights that heparin not only fulfills its primary role as an efficient anticoagulant but can also modulate important regulatory pathways in stromal cells by influencing miRNA expression. This may alter cellular properties and thus influence stromal cell-based therapeutic applications in regenerative medicine.

Arabidopsis thaliana ( Arabidopsis ) double-stranded RNA binding (DRB) proteins DRB1, DRB2 and DRB4 perform essential roles in microRNA (miRNA) production, with many of the produced miRNAs mediating aspects of the molecular response of Arabidopsis to abiotic stress. Exposure of the drb1 , drb2 and drb4 mutants to mannitol stress showed drb2 to be the most sensitive to this form of osmotic stress. Profiling of the miRNA landscapes of mannitol-stressed drb1 , drb2 and drb4 seedlings via small RNA sequencing, and comparison of these to the profile of mannitol-stressed wild-type Arabidopsis plants, revealed that the ability of the drb1 and drb2 mutants to mount an appropriate miRNA-mediated molecular response to mannitol stress was defective. RT-qPCR was next used to further characterize seven miRNA/target gene expression modules, with this analysis identifying DRB1 as the primary DRB protein required for miR160, miR164, miR167 and miR396 production. In addition, via its antagonism of DRB1 function, DRB2 was shown by RT-qPCR to play a secondary role in regulating the production of these four miRNAs. This analysis further showed that DRB1, DRB2 and DRB4 are all required to regulate the production of miR399 and miR408, and that DRB4 is the primary DRB protein required to produce the non-conserved miRNA, miR858. Finally, RT-qPCR was used to reveal that each of the seven characterized miRNA/target gene expression modules responded differently to mannitol-induced osmotic stress in each of the four assessed Arabidopsis lines. In summary, this research has identified mannitol-stress-responsive miRNA/target gene expression modules that can be molecularly manipulated in the future to generate novel Arabidopsis lines with increased tolerance to this form of osmotic stress.

Mesenchymal stromal cells (MSCs) and their secretome show intrinsic antitumor properties, however, the anti-cancer effects of MSCs remain debated and depend on the cancer type or model. MSCs derived from discarded samples, such as human amniotic fluid (hAFSC), have been introduced as an attractive and potent stem cell source for clinical applications due to their collection procedures, which minimize ethical issues. Until now, various studies have obtained controversial results and poor understanding of the mechanisms behind the effects of perinatal cells on cancer cells. To better clarify this aspect, protein and miRNA expression profiling isolated from Extracellular vesicles (EVs) secreted by hAFSCs, obtained in the II or III trimester, were evaluated. Bioinformatic analysis was performed aiming at evaluating differential expression, pathway enrichment, and miRNA-mRNA networks. We highlighted that most of the highest expressed proteins and miRNAs are mainly involved in antioxidant and anti-cancer effects. Indeed, in the presence of hAFSC-EVs, a reduction of the G2/M phase was observed on melanoma cell lines, an activation of the apoptotic pathway occurred and the migration and invasion ability reduced. Our data demonstrated that II or III trimester hAFSCs can release bioactive factors into EVs, causing an efficient anti-cancer effect inhibiting melanoma progression.

The epidermis, the outer layer of the skin, relies on a delicate balance of cell growth and keratinocyte differentiation for its function and renewal. Recent research has shed light on exosomes' role in facilitating skin communication by transferring molecules like miRNAs, which regulate gene expression post-transcriptionally. Additionally, these factors lead to skin aging through oxidative stress caused by reactive oxygen species (ROS). In this research project, experiments were conducted to study the impact of Sun2000 solar simulator irradiation on exosomal miRNA profiles in HEKa cells. We hypothesized that acute oxidative stress induced by solar simulator irradiation would alter the expression profile of exosomal miRNAs in HEKa cells. The cells were exposed to different durations of irradiation to induce oxidative stress, and the levels of reactive ROS were measured using the CellROX Deep Red flow cytometry assay kit. Exosomes were isolated from both control and irradiated cells, characterized using DLS and SEM techniques, and their miRNAs were extracted and analyzed using qPCR. Solar simulator irradiation led to a time-dependent increase in intracellular ROS and a decrease in cell viability. Exosomal size increased in irradiated cells. Fifty-nine exosomal miRNAs were differentially expressed in irradiated HEKa cells, including hsa-miR-425-5p, hsa-miR-181b-5p, hsa-miR-196b-5p, hsa-miR-376c-3p, and hsa-miR-15a-5p. This study highlights the significant impact of solar radiation on exosomal miRNA expression in keratinocytes, suggesting their potential role in the cellular response to oxidative stress., Competing Interests: The authors declare no conflicts of interest.