Search

Introduction: Thalassemia intermedia is a type of anemia which has several treatments modalities. We aimed to study the cost effectiveness of two treatments, including blood transfusion and hydroxyurea, in patients with beta-thalassemia intermedia in south of Iran referred to a referral center affiliated to Iran, Shiraz University of Medical Sciences in 2015. Materials and methods: This was a cost-effectiveness study which was conducted on 122 patients with beta-thalassemia intermedia. The indicator of effectiveness in this study was the reduction of growth disorder (normal BMI). Data analysis was done using SPSS 21, Excel 2010 and Treeage 2011. Finally, the one-way sensitivity analysis was performed to determine the robustness of the results. Results: The average annual costs of blood transfusion and the use of hydroxyurea in 2015 were 20733.27 purchasing power parity (PPP)$ and 7040.29 PPP$, respectively. The effectiveness of blood transfusion was57.4% while in hydroxyurea group was 60.7%. Conclusion: The results showed that the cost effectiveness of using hydroxyurea was more than that of blood transfusion. Therefore, it is recommended that the use of hydroxyurea in the treatment of patients with beta-thalassemia intermedia would become the first priority, and more basic and supplementary insurance coverage for treating such patients using hydroxyurea should be considered. [ABSTRACT FROM AUTHOR]

Objective and importance: Thalassemia is the most frequently monogenetic disorders around the world that is inherited as a recessive single-gene disease, resulting from mutations in α- or β-globin gene clusters. The aim of this report was to present a new insertional mutation in the α1globin gene which causes transfusion-dependent anemia in α-thalassemic patients. Clinical presentation: Two 5-year-old girls with blood transfusion-dependent α-thalassemia anemia and another girl with moderate α-thalassemia have been presented among patients who have been referred to Hematology and Thalassemia Research Center, Dastgheib Hospital, Shiraz, Iran. They were not relatives. All children were stunted and pale; they were put on regular blood transfusion every 14–21 days. Intervention:Sequencing of the β-globin gene was normal in all cases and their parents; but, α-globin gene sequencing results were remarkable. An insertion of 21 base pairs (IVS II+3ins (+21nt)(+GACCCGGTCAACTTCAAGGTG) in the α1-globin gene was detected in all three cases and one of their parents. In two cases, this insertion was accompanied by MED deletion and in one child by POLY A1mutation. MED deletion was detected by gap-PCR. Conclusion: This new 21 base pair insertion cannot affect blood parameters on its own, but can present as continuous blood transfusion-dependent α-thalassemia. Thus, it is important to take this point into account for detecting the carriers, like β-thalassemia carriers, which can present as transfusion-dependent children in parents with α-thalassemia trait. [ABSTRACT FROM AUTHOR]

Background: The goal of this study was to compare heart function and arrhythmia in clinically asymptomatic patients with beta thalassemia intermedia and beta thalassemia major. Method: In this cross-sectional study, 60 patients with beta thalassemia major and 60 patients with beta thalassemia intermedia who had clinically no symptoms of arrhythmia and clinically normal heart function were evaluated using 24-hour ambulatory electrocardiogram monitoring and echocardiography. For data analysis SPSS ver.20 software was used. AP-value of less than 0.05 was considered statistically significant. Results: The mean age of the beta thalassemia intermedia patients was 24.18 ± 7.9 years and the mean age in beta thalassemia major was 24.38 ± 7.7 years (P>0.05). Premature atrial contractions (PACs) were observed in 14 (23.3%) patients with beta thalassemia intermedia and in 22 (36.6%) beta thalassemia major patients. Premature ventricular contractions (PVCs) were detected in 8 (13.3%) patients in the beta thalassemia intermediate group and 16 (26.6) patients in the beta thalassemia major group, respectively. The left ventricular diastolic dimension, end-diastolic volume, and stroke volume were significantly higher in beta thalassemia intermedia group (P<0.05). Pulmonary acceleration time as an indicator of pulmonary pressure was lower in beta thalassemia intermedia group. Conclusion: Both atrial and ventricular arrhythmias were more common in the beta thalassemia major group. Higher end-diastolic volume and stroke volume were detected in the beta thalassemia intermedia group. Pulmonary acceleration time was lower in the beta thalassemia intermedia group, which can be an indicator of higher pulmonary pressure. [ABSTRACT FROM AUTHOR]

Objective: The current standard option for iron chelation therapy (ICT) in transfusion-dependent patients with beta-thalassemia is deferoxamine (DFO). We aimed to compare the compliance with DFO vs. deferasirox (Exjade®), a novel oral iron chelator, in patients with transfusion-dependent beta-thalassemia. Methods: In this cross-sectional study, 220 patients from Southern Iran who were receiving DFO or Exjade® for the last 2 years were investigated in 2012. Satisfaction, compliance, convenience, and life disturbances of the patients with ICT were evaluated. Assessments were performed at four different occasions during 1 year. Results: According to the results, 114 patients received treatment with DFO and 106 patients were treated with Exjade®. In comparison with the patients who were treated with DFO, those receiving Exjade® reported a significantly higher rate of compliance and convenience (P<0.05). However, no significant difference was observed between the two groups regarding their satisfaction (P>0.05). In the DFO group, 44.9% of the patients reported irritation and pain at the injection site. Conclusions: Considering higher rate of compliance and convenience with Exjade® and the comparable efficacy of these two modalities of ICT documented in previous studies, Exjade® can be used as a preferable choice of ICT in iron-overload patients with beta-thalassemia. [ABSTRACT FROM AUTHOR]

Background: The aim of this study was to evaluate the efficacy and safety of deferasirox in patients from Iran. Methods: This was a retrospective, observational study in regularly transfused, iron-overloaded patients who received deferasirox 20-38 mg/kg/day for up to 12 months. Changes in serum ferritin were assessed as follows: from baseline to 3 months with deferasirox doses of 20-24 mg/kg/day; from 3 to 6 months with doses of 25-29 mg/kg/day; and from 6 to 12 months with doses of 30-38 mg/kg/day. The safety of deferasirox was evaluated monthly. Patients' satisfaction with treatment was assessed after 9 months. Results: One hundred and nineteen patients were included. Overall mean serum ferritin levels were significantly decreased from baseline after 12 months of deferasirox therapy (2510 ± 1210 to 1665 ± 1240 ng/ml; P < 0.002). A significant decrease was observed once doses were increased to ≥30 mg/kg/day (P = 0.0003). Most adverse events were mild and observed at the dose of 20-24 mg/kg. Only one patient discontinued treatment. Around 90% of patients were satisfied with therapy. Conclusion: This is the first study evaluating deferasirox in heavily iron-overloaded patients from Iran and confirms that deferasirox is effective and well tolerated; however, dose increases to ≥30 mg/kg/day should be considered if efficacy is insufficient. [ABSTRACT FROM AUTHOR]