Search

Liquid‐liquid phase separation (LLPS) of biopolymers to form condensates is a widespread phenomenon in living cells. Agents that target or alter condensation can help uncover elusive physiological and pathological mechanisms. Owing to their unique material properties and modes of interaction with biomolecules, nanoparticles represent attractive condensate‐targeting agents. Our work focused on elucidating the interaction between ultrasmall gold nanoparticles (usGNPs) and diverse types of condensates of tau, a representative phase‐separating protein associated with neurodegenerative disorders. usGNPs attract considerable interest in the biomedical community due to unique features, including emergent optical properties and good cell penetration. We explored the interaction of usGNPs with reconstituted self‐condensates of tau, two‐component tau/polyanion and three‐component tau/RNA/alpha‐synuclein coacervates. The usGNPs were found to concentrate into condensed liquid droplets, consistent with the formation of dynamic client (nanoparticle) ‐ scaffold (tau) interactions, and were observable thanks to their intrinsic luminescence. Furthermore, usGNPs were capable to promote LLPS of a protein domain which is unable to phase separate on its own. Our study demonstrates the ability of usGNPs to interact with and illuminate protein condensates. We anticipate that nanoparticles will have broad applicability as nanotracers to interrogate phase separation, and as nanoactuators controlling the formation and dissolution of condensates. [ABSTRACT FROM AUTHOR]

The prebiotic generation of sugars in the context of origins of life studies is of considerable interest. Among the important intramolecular processes of sugars are carbonyl migrations and accompanying epimerizations. Herein we describe the carbonyl migration‐epimerization process occurring down the entire carbon chain of chirally pure d‐tetroses sugars under mild conditions. Employing chirally pure 1‐13C‐erythrose, 4‐13C‐erythrose and 1‐13C‐threose, we (1) identify all the species formed as the carbonyl migrates down the four‐carbon chain and (2) assess the rates associated with the production of each of these species. Competing aldol reactions and oxidative fragmentation processes were also observed. Further observations of self‐condensation of glycolaldehyde mainly yielding 2‐keto‐hexoses (sorbose and tagatose) and tetrulose also provides a basis for understanding the effect of carbonyl migrations on the product distribution in plausible prebiotic scenarios. [ABSTRACT FROM AUTHOR]

The prebiotic origins of ribose, nucleosides, and eventually RNA are enduring questions whose answers are central to the RNA world hypothesis. The abiotic synthesis of sugars was first demonstrated over a century ago, but no known prebiotic reaction produces ribose (an aldose sugar) selectively and in good yield. In contrast, ribulose, and fructose (ketose sugars) and other monosaccharides are formed in high yield by several robust abiotic reactions. It is reported here that ketose sugars ‐ both ketopentoses and ketohexoes ‐ serve as precursors for the formation of ribosides and other aldosides, as demonstrated by glycoside‐forming reactions involving barbituric acid, a plausibly prebiotic nucleobase. Moreover, a one‐pot reaction of glyceraldehyde and barbituric acid was discovered which under mild conditions, and without special minerals or other catalysts, results in the formation of glycosides. These results reveal that an exclusive or high‐yielding generation of free ribose was not required for its incorporation into processes that provided the foundations for life. [ABSTRACT FROM AUTHOR]

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G‐tetrads. Three‐ or four‐tetrad G4s and antiparallel two‐tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e. not dimeric or multimeric) two‐tetrad parallel‐stranded DNA G4 has never been experimentally observed. Many sequences compatible with two‐tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel‐stranded G4 upon increasing the number of GGG‐to‐GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G‐triad, whose topology depends on the location of the deletion. Removal of another guanine from another G‐tract leads to di‐ or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two‐tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two‐tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes. [ABSTRACT FROM AUTHOR]

The origin of life is one of the fundamental questions in science. Eschenmoser proposed the 'glyoxylate scenario', in which plausible abiotic synthesis pathways were suggested to be compatible with the constraints of prebiotic chemistry. In this proposal, the stem compound is HCN. In this work, we explore the 'glyoxylate scenario' through several syntheses of HCN polymers, paying particular attention to the role of the aqueous aerosols, together with statistical methods, as a step to elucidate the synthetic problem of the origin of life. The soluble and insoluble HCN polymers synthetized were analyzed by GC-MS. We identified, for the first time, glyoxylic acid in these polymers, together with some constituents of the reductive tricarboxylic acid cycle, amino acids and several N-heterocycles. The findings presented herein, as the first global approach to the 'glyoxylate scenario', give full effect to this hypothesis and prove that aqueous aerosols could play an important role in this plausible scene of the origin of life. [ABSTRACT FROM AUTHOR]

Repetitive guanine-rich nucleic acid sequences play a crucial role in maintaining genome stability and the cell life cycle and represent potential targets for regulatory drugs. Recently, it has been demonstrated that guanine-based ligands with a porphyrin core can be used as markers of G-quadruplex assemblies in cell tissues. Herein, model systems of guanine-based ligands are explored by DFT methods. The energies of formation of modified guanine tetrads and those of modified tetrads stacked on the top of natural guanine tetrads have been calculated. The interaction energy has been decomposed into contributions from hydrogen bonding, stacking, and ion coordination and a twist-rise potential energy scan has been performed to find the individual local minima. Energy decomposition analysis reveals the impact of various substituents (F, Cl, Br, I, Me, NMe2) on individual energy terms. In addition, cooperative reinforcement in forming the modified and stacked tetrads, as well as the frontier orbitals participating in the hydrogen-bonding framework involving the HOMO-LUMO gap between the occupied σHOMO on the proton-accepting C=O and =N− groups and unoccupied σLUMO on the N−H groups, has been studied. The investigated systems are demonstrated to have a potential in ligand development, mainly due to stacking enhancement compared with natural guanine, which is used as a reference. [ABSTRACT FROM AUTHOR]

Under potentially prebiotic scenarios, ribose (pentose), the component of RNA is formed in meager amounts, as opposed to ribulose and xylulose (pentuloses). Consequently, replacement of ribose in RNA, with pentulose sugars, gives rise to prospective oligonucleotide candidates that are potentially prebiotic structural variants of RNA that could be formed by the same type of chemical pathways that gave rise to RNA from ribose. The potentially natural alternative (1′→3′)-ribulo oligonucleotides and (4′→3′)- and (1′→3′)-xylulo oligonucleotides consisting of adenine and thymine were synthesized and found to exhibit no self-pairing or cross-pairing with RNA. This signifies that even though pentulose sugars may have been abundant in a prebiotic scenario, the pentulose nucleic acids (NAs), if and when formed, would not have been competitors of RNA, or interfered with the emergence of RNA as a functional informational system. The reason for the lack of base pairing in pentulose NA highlights the contrasting and central role played by the furanosyl ring in RNA and pentulose NA, enabling and optimizing the base pairing in RNA, while impeding it in pentulose NA. [ABSTRACT FROM AUTHOR]