Search

Background Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. Methods We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. Results Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. Conclusion Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Background Bardet Biedl Syndrome (BBS) is a rare condition of multi-organ dysfunction with characteristic clinical features of retinal degeneration, truncal obesity, postaxial polydactyly, genital anomaly, intellectual disability and renal dysfunction. It is a hetero-genetic disorder and nineteen BBS genes have been discovered so far. Methods Whole genome SNP genotyping was performed by using CytoScan® 750 K array (Affymetrix). Subsequently, the segregation of the disease locus in the whole family was carried out by genotyping STS markers within the homozygous interval. Finally, the mutation analysis was performed by Sanger DNA sequencing. Results In the present molecular study a consanguineous Pakistani family, with autosomal recessive BBS, was analyzed. The clinical analysis of affected individuals presented with synpolydactyly, obesity, intellectual disability, renal abnormality and retinitis pigmentosa. The presented phenotype was consistent with the major features of BBS syndrome. Homozygosity mapping identified a common homozygous interval within the known BBS9 locus. Sequence analysis of BBS9/PTHB1 gene revealed a single base deletion of c.299delC (p.Ser100Leufs*24) in exon 4. This frame-shift mutation presumably leads to a 122 amino acid truncated protein with complete loss of its C-terminal PTHB1 domain in combination with a partial loss of the N-terminal PTHB1 domain as well. BBS9/PTHB1 gene mutations have been shown to be associated with BBS syndrome and to the best of our knowledge this study reports the first Pakistani family linked to the BBS9 gene. Conclusion Our molecular findings expand the mutational spectrum of BBS9 gene and also explain the genetic heterogeneity of Pakistan families with BBS syndrome. The growing number of mutations in BBS genes in combination with a detailed phenotypical description of patients will be helpful for genotype-phenotype correlation, targeted genetic diagnosis, prenatal screening and carrier testing of familial and non-familial BBS patients.

Background Type II syndactyly or synpolydactyly (SPD) is clinically very heterogeneous, and genetically three distinct SPD conditions are known and have been designated as SPD1, SPD2 and SPD3, respectively. SPD1 type is associated with expansion mutations in HOXD13, resulting in an addition of ≥ 7 alanine residues to the polyalanine repeat. It has been suggested that expansions ≤ 6 alanine residues go without medical attention, as no such expansion has ever been reported with the SPD1 phenotype. Methods We describe a large Pakistani and an Indian family with SPD. We perform detailed clinical and molecular analyses to identify the genetic basis of this malformation. Results We have identified four distinct clinical categories for the SPD1 phenotype observed in the affected subjects in both families. Next, we show that a milder foot phenotype, previously described as a separate entity, is in fact a part of the SPD1 phenotypic spectrum. Then, we demonstrate that the phenotype in both families segregates with an identical expansion mutation of 21 bp in HOXD13. Finally, we show that the HOXD13 polyalanine repeat is polymorphic, and the expansion of 2 alanine residues, evident in unaffected subjects of both families, is without clinical consequences. Conclusion It is the first molecular evidence supporting the hypothesis that expansion of ≤ 6 alanine residues in the HOXD13 polyalanine repeat is not associated with the SPD1 phenotype.