Search

An ideal synthetic promoter can accurately regulate gene expression and the minimal cauliflower mosaic virus 35S promoter (GWSF) is an ideal synthetic pathogen-inducible promoter (SPIP) with several advantages. Three modified SPIPs, named as VGWSF, GWVSF, and GWSFV according to the arrangement of cis-elements, were optimized by inserting the dimer of a virus inducible cis-element (TTGGGAAGGAATTTCCTACT, V-box) upstream, midstream, or downstream the GWSF sequence. The three promoters were used to replace the cauliflower mosaic virus 35S promoter in the plasmid pBI121 in order to control the expression of the β-glucuronidase (gus) gene. Transformation of Arabidopsis thaliana (ecotype Col-0) plants was performed via the Agrobacterium tumefaciens strain GV3101 by the floral dip method. The five-week-old transgenic T3 lines were histochemically stained for GUS activity to evaluate the transcriptional properties of modified SPIPs. The VGWSF and GWVSF had low basal expressions and could not be induced by low or high temperatures and a low osmotic potential but could be induced by the tobacco mosaic virus (TMV). Although GWSFV had the highest GUS activity, it showed a substantial basal expression. After being treated with TMV, abscisic acid (ABA), salicylic acid (SA), or ethylene (Eth) for12 h, the expressions of modified SPIPs were evaluated by real-time quantitative PCR. With the basal expression of GWSF as a reference, each treatment was represented as log2 (fold to the GWSF basal level). The basal expression of VGWSF and expressions induced by TMV, ABA, SA, and Eth were 1.39, 3.42, 6.01, 4.14, and 2.26, respectively, whereas the corresponding values of GWVSF were 1.16, 4.07, 3.72, 4.65, and 3.98, respectively, and the corresponding values of GWSFV were 4.43, 6.11, 4.83, 3.69, and 3.34, respectively. The results revealed that three modified SPIPs acquired virus induction activity due to the insertion of V-box. The V-box insertion position had a significant impact on transcription properties of modified SPIPs. [ABSTRACT FROM AUTHOR]

Fructans play vital roles in enhancing plant abiotic stress tolerance by reducing oxidative damage, stabilizing cell membranes, improving the osmotic adjustment capacity, and lowering the freezing point. In this study, a sucrose: fructan-6-fructosyltransferase (6-SFT) gene involved in the synthesis of fructans was isolated from Dasypyrum villosum, Dv-6-SFT, using genomic walking and reverse transcription (RT)-PCR. Alignment of the cDNA sequence with its genomic counterpart showed that no introns were present in the Dv-6-SFT gene, and thus it differs from all other plant 6-SFTs that have been cloned previously. Sequence analysis showed that the cDNA of the Dv-6-SFT sequence comprised 2 175 bp with a 1 863 bp open reading frame, and its deduced protein comprised 620 amino acids with a predicted molecular mass of 68.47 kDa. The Dv-6-SFT gene was transferred into tobacco (Nicotiana tabacum L.) cv. W38 via Agrobacterium-mediated transformation. The screened plants were tested by PCR and semi-quantitative RT-PCR, and the transgenic plants were evaluated under drought, cold, and salt stresses. The Dv-6-SFT transgenic tobacco plants had higher resistance to drought, cold, and salt stress than the non-transgenic plants. Further analysis showed that the transgenic plant expressing Dv-6-SFT had increased content of saccharides and proline, but reduced content of malondialdehyde in leaves. The results of this study demonstrate that the Dv-6-SFT gene is a potential candidate for conferring abiotic stress tolerance in plants and it could be used in crop improvement breeding programs.

A plasmid and two isocaudamer systems, namely, NotI/Bsp120I and SpeI/XbaI/NheI, were used to construct a new type of multi-gene plant transformation vector system. This system included a transformation vector containing the restriction enzyme cutting sites Bsp120I and XbaI as well as a cloning vector containing the restriction enzyme cutting sites NotI, Bsp120I, SpeI, and NheI. The open reading frame of the new target genes was connected to the transformation vector. The original restriction enzyme cutting site disappeared after connecting to the isocaudamer. The plant transformation vector p096871, which contained Bacillus thuringiensis (Bt) genes Cry1Ac and Cry3A as well as p09X6, which contained mtlD, strD, betA, nhaA, and ostAB, were constructed using this vector system. Resistant plants were obtained after tobacco was transformed by two vectors via the Agrobacterium-mediated method. Detection by PCR revealed that all exogenous genes were inserted into the genome of tobacco. Real-time fluorescence quantification PCR, reverse transcription PCR, and ELISA detections were performed on five transgenic lines transformed by two Bt genes. Cry1Ac and Cry3A were inserted into the genome with a single copy to transcribe and express Bt toxins. The proposed vector system reduced the number of operational procedures and minimized the difficulty of the experiment.

This study aimed to develop a new vector system to remove selection genes and to introduce two or more genes of interest into plants in order to express them in a coordinated manner. A multigene expression vector was established based on pCamBIA2300 using a selectable marker gene (SMG)-free system based on the combination of the isocaudamer technique and double T-DNA. The vector DT7 containing seven target genes was constructed and introduced into tobacco using Agrobacterium-mediated transformation. Twenty-one of 27 positive transgenic plants contained both T-DNA regions. The co-transformation frequency was 77.8 %. The frequency of unlinked integration of two intact T-DNAs was 22.22 % (6/27). The frequency of removal of SMG from transgenic T1 plants was 19.10 %. These results suggest that this vector system was functional and effective for multigene expression and SMG-free transgenic plant cultivation. At least seven target genes can be co-expressed using this system. Overall, these findings provide a new and highly effective platform for multigene and marker-free transgenic plant production.

Saussurea involucrata Kar. et Kir. tolerates severe abiotic stresses including cold, and the level of membrane fatty acid desaturation is associated with its cold acclimation. We discovered and characterized a full-length cDNA of stearoyl acyl-carrier-protein desaturase (sikSACPD) which encodes a protein consisted of 396 amino acids. A sequence alignment of the SikSACPD protein showed that it shares 91 and 86 % identity with the SACPDs of Carthamus tinctorius and Helianthus annuus, respectively. Semi-quantitative RT-PCR showed that the expression of sikSACPD increased in S. involucrata leaves as the temperature decreased from 20 to -10 °C. Agrobacterium tumefaciens was used to transform fatty acid biosynthesis 2 (FAB2):SikSACPD and FAB2:FAB2 constructs into tobacco to investigate resistance to a freezing stress and fatty acid composition of the transgenic plants. The FAB2:SikSACPD transgenic plants showed a slightly more resistance to the freezing stress than the FAB2:FAB2 transgenic plants and the wild-type. The proportion of oleic acid (C18:1) in the leaves of SikSACPD transgenic tobacco increased from approximately 5 to 20 % compared with the leaves of non-transgenic tobacco when both were exposed to cold stress treatments. This study demonstrates that the SikSACPD transgene, when expressed in tobacco, conferred a higher cold tolerance in comparison with that observed in non-transgenic tobacco. Thus, this gene may be a candidate for enhancing cold tolerance in other crop plants.

Fructans play vital roles in enhancing plant abiotic stress tolerance by reducing oxidative damage, stabilizing cell membranes, improving the osmotic adjustment capacity, and lowering the freezing point. In this study, a sucrose: fructan-6-fructosyltransferase ( 6-SFT) gene involved in the synthesis of fructans was isolated from Dasypyrum villosum, Dv-6-SFT, using genomic walking and reverse transcription (RT)-PCR. Alignment of the cDNA sequence with its genomic counterpart showed that no introns were present in the Dv-6-SFT gene, and thus it differs from all other plant 6-SFTs that have been cloned previously. Sequence analysis showed that the cDNA of the Dv-6-SFT sequence comprised 2 175 bp with a 1 863 bp open reading frame, and its deduced protein comprised 620 amino acids with a predicted molecular mass of 68.47 kDa. The Dv-6-SFT gene was transferred into tobacco ( Nicotiana tabacum L.) cv. W38 via Agrobacterium-mediated transformation. The screened plants were tested by PCR and semi-quantitative RT-PCR, and the transgenic plants were evaluated under drought, cold, and salt stresses. The Dv-6-SFT transgenic tobacco plants had higher resistance to drought, cold, and salt stress than the non-transgenic plants. Further analysis showed that the transgenic plant expressing Dv-6-SFT had increased content of saccharides and proline, but reduced content of malondialdehyde in leaves. The results of this study demonstrate that the Dv-6-SFT gene is a potential candidate for conferring abiotic stress tolerance in plants and it could be used in crop improvement breeding programs. [ABSTRACT FROM AUTHOR]

A plasmid and two isocaudamer systems, namely, NotI/ Bsp120I and SpeI/ XbaI/ NheI, were used to construct a new type of multi-gene plant transformation vector system. This system included a transformation vector containing the restriction enzyme cutting sites Bsp120I and XbaI as well as a cloning vector containing the restriction enzyme cutting sites NotI, Bsp120I, SpeI, and NheI. The open reading frame of the new target genes was connected to the transformation vector. The original restriction enzyme cutting site disappeared after connecting to the isocaudamer. The plant transformation vector p096871, which contained Bacillus thuringiensis ( Bt) genes Cry1Ac and Cry3A as well as p09X6, which contained mtlD, strD, betA, nhaA, and ostAB, were constructed using this vector system. Resistant plants were obtained after tobacco was transformed by two vectors via the Agrobacterium-mediated method. Detection by PCR revealed that all exogenous genes were inserted into the genome of tobacco. Real-time fluorescence quantification PCR, reverse transcription PCR, and ELISA detections were performed on five transgenic lines transformed by two Bt genes. Cry1Ac and Cry3A were inserted into the genome with a single copy to transcribe and express Bt toxins. The proposed vector system reduced the number of operational procedures and minimized the difficulty of the experiment. [ABSTRACT FROM AUTHOR]

This study aimed to develop a new vector system to remove selection genes and to introduce two or more genes of interest into plants in order to express them in a coordinated manner. A multigene expression vector was established based on pCamBIA2300 using a selectable marker gene (SMG)-free system based on the combination of the isocaudamer technique and double T-DNA. The vector DT7 containing seven target genes was constructed and introduced into tobacco using Agrobacterium-mediated transformation. Twenty-one of 27 positive transgenic plants contained both T-DNA regions. The co-transformation frequency was 77.8 %. The frequency of unlinked integration of two intact T-DNAs was 22.22 % (6/27). The frequency of removal of SMG from transgenic T1 plants was 19.10 %. These results suggest that this vector system was functional and effective for multigene expression and SMG-free transgenic plant cultivation. At least seven target genes can be co-expressed using this system. Overall, these findings provide a new and highly effective platform for multigene and marker-free transgenic plant production. [ABSTRACT FROM AUTHOR]

Soil salinity is a major abiotic stress and salt overly sensitive (SOS) pathway plays an important role in imparting tolerance to salinity by reinstating cellular ionic equilibrium. Salt overly sensitive 1 (SOS1) gene of SOS pathway has been implicated in increasing salt tolerance in plants. In this study, a 734 bp fragment of SOS1 promoter (SbUSOS1) was isolated from a halophyte Salicornia brachiata Roxb. In silico analysis of SbUSOS1 predicted several cis-acting regulatory elements such as DOF motif, GT elements, ABRE-like sequence, and root specific motifs. Functional validation of SbUSOS1 into tobacco stems and leaves using the GUS reporter gene showed that this promoter is induced by salt stress (250 mM NaCl) but not by ABA (500 μM) and cold (4 °C) stresses. This study indicated that SbUSOS1 was functional with predicted cis-acting elements that could be responsible for its salt-inducible nature. It can be used for the development of salt stress tolerant transgenic plants.

Transgenic rice (Oryza sativa L. subsp. indica cv. White Ponni) constitutively expressing the rice thaumatin-like protein gene (tlp-D34, PR-5) individually or in combination with the rice chitinase gene (chi11, PR-3) was generated using an Agrobacterium vir helper strain with multiple copies of pTiBo542 virB and virG. Transformation with the tlp-D34 gene alone and tlp-D34 + chi11 genes yielded five and seven single-copy transgenic lines, respectively. Southern blot analysis with two probes, one flanking the right T-DNA border and the second flanking the left T-DNA border, confirmed that all transgenic plants harboured single and complete T-DNA copies. Homozygous transgenic lines were first identified in the T1 generation by Southern blot analysis and were subsequently confirmed by segregation analysis of T2 plants. Accumulation of transcripts encoded by the transgenes was confirmed in T0 plants and homozygous T2 plants by Northern blot analysis. The homozygous T2 plants harbouring tlp-D34 + chi11 genes showed 2.8- to 4.2-fold higher chitinase activity. Western blot analysis revealed the accumulation of thaumatin-like protein and chitinase in the respective transgenic plants. Upon infection with Rhizoctonia solani, the disease index reduced from 100 % in control plants to 65 % in a T3 homozygous transgenic line T4 expressing the tlp-D34 gene alone. In a T2 homozygous transgenic line CT22 co-expressing tlp-D34 and chi11 genes, the disease index reduced to 39 %.

The coat protein (CP) gene of Tobacco streak virus (TSV) from sunflower (Helianthus annuus L.) was amplified, cloned and sequenced. A 421 bp fragment of the TSV coat protein gene was amplified and a gene construct encoding the hairpin RNA (hpRNA) of the TSV-CP sequence was made in the plasmid pHANNIBAL. The construct contains sense and antisense CP sequences flanking a 742 bp spacer sequence (Pdk intron) under the control of the constitutive CaMV35S promoter. A 3.6 kb Not I fragment containing the hpRNA cassette (TSV-CP) was isolated from pHANNIBAL and sub-cloned into the binary vector pART27. This chimeric gene construct was then mobilized into Agrobacterium tumefaciens strain LBA4404 via triparental mating using pRK2013 as a helper. Sunflower (cv. Co 4) and tobacco (cv. Petit Havana) plants were transformed with A. tumefaciens strain LBA4404 harbouring the hpRNA cassette and in vitro selection was performed with kanamycin. The integration of the transgene into the genome of the transgenic lines was confirmed by PCR analysis. Infectivity assays with TSV by mechanical sap inoculation demonstrated that both the sunflower and tobacco transgenic lines exhibited resistance to TSV infection and accumulated lower levels of TSV compared with non-transformed controls.

To induce virus resistance in tobacco and rice we constructed hairpin RNA expression system harbouring inverted repeat fragments of coat protein cDNA of Potato virus Y (PVY) or Rice stripe virus (RSV). These structures were driven by three promoters [cauliflower mosaic virus 35S (CaMV 35S), polyubiqutin gene of maize (Ubi), and Pharbitis nil leucine zipper gene (PNZIP)] which have different tissue-specific activity. PVY resistance ratios were 65.18, 24.33 and 83.54 % in transgenic tobacco plants harboring p35S-PVY, pUbi-PVY and pPNZIP-PVY. RSV resistance was 16.21, 28.61 and 29.33 % in transgenic rice plants harboring p35S-RSV, pUbi-RSV and pPNZIP-RSV. Northern blotting and GUS assay demonstrated that virus resistance levels were related to promoter activity. Therefore, choice of the more effective and tissue-specific promoter to reinforce transcription of hpRNAs will favour the cultivation of highly virusresistant transgenic plants.

The gene of Zinnia elegans L. coding for S-like extracellular ribonuclease (ZRNase II) was used to produce transgenic tobacco plants with an increased ribonuclease activity. The protein-coding part of ZRNase II included the signal peptide sequence so the transgenic protein was located extracellularly. The cDNA of ZRNase II was cloned under the control of 2'-promoter of the mannopine synthase (MAS 2') gene from Ti-plasmid of Agrobacterium tumefaciens. It was shown that the resultant transgenic plants had an increased ribonuclease activity of the crude extracts and the induction of MAS 2' promoter by wounding additionally increased the activity. The plants of two transforming lines characterized by different ribonuclease activities were used to analyze the transgene influence on plant resistance to tobacco mosaic virus. The plants demonstrated either absence of disease symptoms or a significant delay in their appearance, depending on the virus content in the inoculum and ribonuclease activity.

In this study, 16 hairpin RNA (hpRNA) vectors were constructed, each harboring 50 bp viral RNA sequence as the stem. They all targeted the coat protein (CP) gene of Potato virus Y (PVY). Virus resistance assay revealed that hairpin constructs targeting the anterior 200 bp regions of the CP gene were unable to induce virus resistance, while the 12 hpRNA constructs targeting posterior 600 bp regions induced high virus resistance up to 77.78 %. Northern blot analysis revealed that 50 bp-length hpRNA constructs could be transcribed efficiently and processed into siRNAs; however, no correlation between siRNA accumulation and degree of antiviral defense was observed. Results presented here indicated that the middle and 3' end of the CP cDNA was important for hpRNA-mediated PVY resistance, improving the design of pathogen-derived hpRNA expression cassettes for transgenic plant against viruses.

Embryogenic cell suspension cultures of Santalum album were transformed with Agrobacterium tumefaciens harboring pD35SHER plant expression vector having hepatitis B small surface antigen (HBsAg) with a C-terminal ER retention signal. The transformed colonies were selected on culture medium supplemented with kanamycin and subsequently the transgenic nature of these colonies was confirmed by PCR analysis. The expression of HBsAg was confirmed by RT-PCR analysis and Western blot analysis and the expression was quantified using monoclonal antibody-based ELISA. Cell suspension cultures were initiated from the colony with expression of 11.09 μg(HBsAg) g-1(f.m.). To further increase the expression of HBsAg, transgenic S. album suspensions were cultured on media with various medium additives and cells growing in medium with 30 mM trehalose showed the expression of 19.95 μg(HBsAg) g-1(f.m.).

Saussurea involucrata Kar. et Kir. tolerates severe abiotic stresses including cold, and the level of membrane fatty acid desaturation is associated with its cold acclimation. We discovered and characterized a full-length cDNA of stearoyl acyl-carrier-protein desaturase ( sikSACPD) which encodes a protein consisted of 396 amino acids. A sequence alignment of the SikSACPD protein showed that it shares 91 and 86 % identity with the SACPDs of Carthamus tinctorius and Helianthus annuus, respectively. Semi-quantitative RT-PCR showed that the expression of sikSACPD increased in S. involucrata leaves as the temperature decreased from 20 to −10 °C. Agrobacterium tumefaciens was used to transform fatty acid biosynthesis 2 (FAB2):SikSACPD and FAB2:FAB2 constructs into tobacco to investigate resistance to a freezing stress and fatty acid composition of the transgenic plants. The FAB2:SikSACPD transgenic plants showed a slightly more resistance to the freezing stress than the FAB2:FAB2 transgenic plants and the wild-type. The proportion of oleic acid (C18:1) in the leaves of SikSACPD transgenic tobacco increased from approximately 5 to 20 % compared with the leaves of non-transgenic tobacco when both were exposed to cold stress treatments. This study demonstrates that the SikSACPD transgene, when expressed in tobacco, conferred a higher cold tolerance in comparison with that observed in non-transgenic tobacco. Thus, this gene may be a candidate for enhancing cold tolerance in other crop plants. [ABSTRACT FROM AUTHOR]

Soil salinity is a major abiotic stress and salt overly sensitive (SOS) pathway plays an important role in imparting tolerance to salinity by reinstating cellular ionic equilibrium. Salt overly sensitive 1 ( SOS1) gene of SOS pathway has been implicated in increasing salt tolerance in plants. In this study, a 734 bp fragment of SOS1 promoter (SbUSOS1) was isolated from a halophyte Salicornia brachiata Roxb. In silico analysis of SbUSOS1 predicted several cis-acting regulatory elements such as DOF motif, GT elements, ABRE-like sequence, and root specific motifs. Functional validation of SbUSOS1 into tobacco stems and leaves using the GUS reporter gene showed that this promoter is induced by salt stress (250 mM NaCl) but not by ABA (500 μM) and cold (4 °C) stresses. This study indicated that SbUSOS1 was functional with predicted cis-acting elements that could be responsible for its salt-inducible nature. It can be used for the development of salt stress tolerant transgenic plants. [ABSTRACT FROM AUTHOR]

Transgenic rice ( Oryza sativa L. subsp. indica cv. White Ponni) constitutively expressing the rice thaumatin-like protein gene ( tlp-D34, PR-5) individually or in combination with the rice chitinase gene ( chi11, PR-3) was generated using an Agrobacterium vir helper strain with multiple copies of pTiBo542 virB and virG. Transformation with the tlp-D34 gene alone and tlp-D34 + chi11 genes yielded five and seven single-copy transgenic lines, respectively. Southern blot analysis with two probes, one flanking the right T-DNA border and the second flanking the left T-DNA border, confirmed that all transgenic plants harboured single and complete T-DNA copies. Homozygous transgenic lines were first identified in the T generation by Southern blot analysis and were subsequently confirmed by segregation analysis of T plants. Accumulation of transcripts encoded by the transgenes was confirmed in T0 plants and homozygous T plants by Northern blot analysis. The homozygous T2 plants harbouring tlp-D34 + chi11 genes showed 2.8- to 4.2-fold higher chitinase activity. Western blot analysis revealed the accumulation of thaumatin-like protein and chitinase in the respective transgenic plants. Upon infection with Rhizoctonia solani, the disease index reduced from 100 % in control plants to 65 % in a T homozygous transgenic line T4 expressing the tlp-D34 gene alone. In a T2 homozygous transgenic line CT22 co-expressing tlp-D34 and chi11 genes, the disease index reduced to 39 %. [ABSTRACT FROM AUTHOR]

To induce virus resistance in tobacco and rice we constructed hairpin RNA expression system harbouring inverted repeat fragments of coat protein cDNA of Potato virus Y (PVY) or Rice stripe virus (RSV). These structures were driven by three promoters [cauliflower mosaic virus 35S (CaMV 35S), polyubiqutin gene of maize (Ubi), and Pharbitis nil leucine zipper gene (PNZIP)] which have different tissue-specific activity. PVY resistance ratios were 65.18, 24.33 and 83.54 % in transgenic tobacco plants harboring p35S-PVY, pUbi-PVY and pPNZIP-PVY. RSV resistance was 16.21, 28.61 and 29.33 % in transgenic rice plants harboring p35S-RSV, pUbi-RSV and pPNZIP-RSV. Northern blotting and GUS assay demonstrated that virus resistance levels were related to promoter activity. Therefore, choice of the more effective and tissue-specific promoter to reinforce transcription of hpRNAs will favour the cultivation of highly virusresistant transgenic plants. [ABSTRACT FROM AUTHOR]

The coat protein (CP) gene of Tobacco streak virus (TSV) from sunflower ( Helianthus annuus L.) was amplified, cloned and sequenced. A 421 bp fragment of the TSV coat protein gene was amplified and a gene construct encoding the hairpin RNA (hpRNA) of the TSV-CP sequence was made in the plasmid pHANNIBAL. The construct contains sense and antisense CP sequences flanking a 742 bp spacer sequence ( Pdk intron) under the control of the constitutive CaMV35S promoter. A 3.6 kb Not I fragment containing the hpRNA cassette (TSV-CP) was isolated from pHANNIBAL and sub-cloned into the binary vector pART27. This chimeric gene construct was then mobilized into Agrobacterium tumefaciens strain LBA4404 via triparental mating using pRK2013 as a helper. Sunflower (cv. Co 4) and tobacco (cv. Petit Havana) plants were transformed with A. tumefaciens strain LBA4404 harbouring the hpRNA cassette and in vitro selection was performed with kanamycin. The integration of the transgene into the genome of the transgenic lines was confirmed by PCR analysis. Infectivity assays with TSV by mechanical sap inoculation demonstrated that both the sunflower and tobacco transgenic lines exhibited resistance to TSV infection and accumulated lower levels of TSV compared with non-transformed controls. [ABSTRACT FROM AUTHOR]

The gene of Zinnia elegans L. coding for S-like extracellular ribonuclease ( ZRNase II) was used to produce transgenic tobacco plants with an increased ribonuclease activity. The protein-coding part of ZRNase II included the signal peptide sequence so the transgenic protein was located extracellularly. The cDNA of ZRNase II was cloned under the control of 2′-promoter of the mannopine synthase (MAS 2′) gene from Ti-plasmid of Agrobacterium tumefaciens. It was shown that the resultant transgenic plants had an increased ribonuclease activity of the crude extracts and the induction of MAS 2′ promoter by wounding additionally increased the activity. The plants of two transforming lines characterized by different ribonuclease activities were used to analyze the transgene influence on plant resistance to tobacco mosaic virus. The plants demonstrated either absence of disease symptoms or a significant delay in their appearance, depending on the virus content in the inoculum and ribonuclease activity. [ABSTRACT FROM AUTHOR]

The manipulation of cytokinin contents via Agrobacterium-mediated transformation is an efficient tool for delaying leaf senescence and improving the resistance to environmental stresses. In the present study, cotton transformants harbouring the Agrobacterium tumefaciens isopentenyl transferase ( IPT) gene under the control of the promoter of Gossypium hirsutum cysteine proteinase ( Ghcysp) were generated. PCR and Southern blot analysis indicated that the foreign DNA fragment was successfully integrated into the cotton genome. The chlorophyll and cytokinin contents, and ROS-scavenging enzymatic activities were significantly increased in transgenic cotton lines, which resulted in a significant delay in leaf senescence. The growth characteristics of transgenic cotton lines resembled the non-transgenic lines except delaying premature senescence and the lint yield and fiber quality of transgenic lines were improved. In addition, the transgenic lines had higher biomasses, IPT transcripts, and endogenous cytokinin contents compared with those of non-transgenic lines under 200 mM NaCl stress. [ABSTRACT FROM AUTHOR]

Marker-free transgenic cucumber ( Cucumis sativus L.) cv. Poinsett 76 SR plants were produced by Agrobacterium mediated transformation. A transformation efficiency of 1.62 was observed on using Agrobacterium tumefaciens strain LBA4404 harbouring Arabidopsis cbf1 gene driven by the inducible promoter RD29A in a binary vector system pCAMBIA. Transgene integration and single copy insert in transgenic cucumber was confirmed by polymerase chain reaction (PCR) and Southern blot analysis in T lines and also confirmed marker-free status in T generation. Transgene expression was confirmed by reverse transcription (RT)-PCR in T generation transgenic cucumber and advanced to T generation. Upon exposure to chilling stress (4 °C), the T generation transgenic plants survived up to 36 h; however, wild-type plants could not survive and gradually died. A significant decrease in membrane injury index (MII), increase in activities of antioxidant enzymes (SOD and CAT), free proline content and relative water content (RWC) in the leaves were observed in transgenic cucumber as compared to wild-type under chilling stress. Thus, the transgenic cucumber plants expressing Arabidopsis cbf1 gene conferred protection against chilling stress. [ABSTRACT FROM AUTHOR]

Vigna Δ-pyrroline-5-carboxylate synthetase ( P5CS) cDNA was transferred to chickpea ( Cicer arietinum L.) cultivar Annigeri via Agrobacterium tumefaciens mediated transformation. Following selection on hygromycin and regeneration, 60 hygromycin-resistant plants were recovered. Southern blot analysis of five fertile independent lines of T0 and T1 generation revealed single and multiple insertions of the transgene. RT-PCR and Western blot analysis of T0 and T1 progeny demonstrated that the P5CS gene is expressed and produced functional protein in chickpea. T1 transgenic lines accumulated higher amount of proline under 250 mM NaCl compared to untransformed controls. Higher accumulation of Na was noticed in the older leaves but negligible accumulation in seeds of T1 transgenic lines as compared to the controls. Chlorophyll stability and electrolyte leakage indicated that proline overproduction helps in alleviating salt stress in transgenic chickpea plants. The T1 transgenics lines were grown to maturity and set normal viable seeds under continuous salinity stress (250 mM) without any reduction in plant yield in terms of seed mass. [ABSTRACT FROM AUTHOR]

In this study, 16 hairpin RNA (hpRNA) vectors were constructed, each harboring 50 bp viral RNA sequence as the stem. They all targeted the coat protein ( CP) gene of Potato virus Y (PVY). Virus resistance assay revealed that hairpin constructs targeting the anterior 200 bp regions of the CP gene were unable to induce virus resistance, while the 12 hpRNA constructs targeting posterior 600 bp regions induced high virus resistance up to 77.78 %. Northern blot analysis revealed that 50 bp-length hpRNA constructs could be transcribed efficiently and processed into siRNAs; however, no correlation between siRNA accumulation and degree of antiviral defense was observed. Results presented here indicated that the middle and 3′ end of the CP cDNA was important for hpRNA-mediated PVY resistance, improving the design of pathogen-derived hpRNA expression cassettes for transgenic plant against viruses. [ABSTRACT FROM AUTHOR]

This review summarizes main difficulties involved in barley ( Hordeum vulgare L.) transformation. The most commonly used procedures for genetic transformation in barley are Agrobacterium tumefaciens and particle bombardment mediated methods. While different barley cultivars are used for genetic engineering with varying sensitivity, recent improvements in regeneration and transformation techniques are described and summarized. Furthermore, some of the transformation complicating factors, in particular somaclonal variation and transgene insertion sites, are discussed in more detail. [ABSTRACT FROM AUTHOR]

Methylglyoxal (MG) is a highly reactive α-oxoaldehyde, demonstrating anticancer effect on plant neoplastic tumours. In in vivo studies it was observed that MG destroyed crown gall tumours in Nicotiana tabacum produced by Agrobacterium tumefaciens, without any adverse effect on the host. The efficacy of MG in comparison to other anticancer drugs viz. cisplatin and ellagic acid in the treatment of crown gall was investigated. A slight degeneration of galls was noted in plants treated with cisplatin and ellagic acid but the plants died subsequently. With MG however, crown galls were completely cured and the plants completed their usual life cycle by flowering and producing seeds. MG inhibited the respiration of crown gall calluses suggesting that energy depletion resulted in tumour destruction. [ABSTRACT FROM AUTHOR]

Embryogenic cell suspension cultures of Santalum album were transformed with Agrobacterium tumefaciens harboring pD35SHER plant expression vector having hepatitis B small surface antigen (HBsAg) with a C-terminal ER retention signal. The transformed colonies were selected on culture medium supplemented with kanamycin and subsequently the transgenic nature of these colonies was confirmed by PCR analysis. The expression of HBsAg was confirmed by RT-PCR analysis and Western blot analysis and the expression was quantified using monoclonal antibody-based ELISA. Cell suspension cultures were initiated from the colony with expression of 11.09 μg(HBsAg) g(f.m.). To further increase the expression of HBsAg, transgenic S. album suspensions were cultured on media with various medium additives and cells growing in medium with 30 mM trehalose showed the expression of 19.95 μg(HBsAg) g(f.m.). [ABSTRACT FROM AUTHOR]

synthetic chimeric gene SbtCryIII(A) encoding the insecticidal protein btCryIII(A), was transformed into Pinus armandii embryos and embryogenic calli using Agrobacterium tumefaciens. Polymerase chain reaction and genomic DNA Southern blot analysis showed that the SbtCryIII(A) gene was integrated into the genome of transgenic Pinus armandii plants, and Northern blot analysis indicated that the SbtCryIII(A) gene was transcribed. [ABSTRACT FROM AUTHOR]

Cotyledonary leaves of 9-d-old tomato ( Lycopersicon esculentum Mill.) were co-cultivated with Agrobacterium tumefaciens GV 3101 harboring binary vector pBI101 containing kanamycin resistance gene ( npt II) as selection marker. Murashige and Skoog (MS) inorganic salts with Gamborg’s B5 vitamins supplemented with optimized concentrations of zeatin riboside and indole-acetic acid resulted in enhanced regeneration efficiency. Under optimized conditions of plant regeneration, transformation frequency in cvs. Pusa Ruby, Pusa Uphar and DT-39 was greater than 37 %. Transformed shoots were selected on kanamycin medium and the presence of the transgene in the primary transformants was confirmed by PCR. Integration of the npt II gene in the tomato genome was further confirmed by Southern blot analysis. RT-PCR analysis using neomycin phospho-transferase ( npt II) gene-specific primers confirmed the expression of the transgene in transgenic plants. Transformed plants were successfully transferred to phytotron, where these plants grew to maturity and produced flowers and fruits. [ABSTRACT FROM AUTHOR]

MAT (multi-auto-transformation) vector system has been one of the strategies to excise the selection marker gene from transgenic plants. Agrobacterium tumefaciens strain EHA105 harboring an ipt-type MAT vector, pNPI132, was used to produce morphologically normal transgenic Petunia hybrida ‘Dainty Lady’ employing isopentenyl transferase ( ipt) gene as the selection marker gene. β-glucuronidase ( GUS) gene was used as model gene of interest. Infected explants were cultured on Murashige and Skoog (MS) medium without plant growth regulators (PGR) and antibiotics. Shoots showing extreme shooty phenotype (ESP) were produced from the adventitious shoots separated from the explants. Visual selection was carried out until production of morphologically normal shoots (approximately 4 months after infection). Histochemical GUS assay detected GUS gene in both ESP and normal shoots. PCR analysis confirmed the presence of model gene ( GUS gene) and excision of the selection marker ( ipt) gene in the normal transgenic plants. The insertion sites (1–3 for ipt gene and 1–2 for GUS gene) were detected by Southern blot analysis using DIG-labeled probes of both genes. These results show that ipt-type MAT vector can be used successfully to produce marker-free transgenic Petunia hybrida plants on PGR- and antibiotic-free MS medium. [ABSTRACT FROM AUTHOR]

The purpose of this research was Eucalyptus saligna in vitro regeneration and transformation with P5CSF129A gene, which encodes Δ-pyrroline-5-carboxylate synthetase ( P5CS), the key enzyme in proline biosynthesis. After selection of the most responsive genotype, shoot organogenesis was induced on leaf explants cultured on a callus induction medium (CI) followed by subculture on a shoot induction medium (SI). Shoots were subsequently cultured on an elongation medium (BE), then transferred to a rooting medium and finally transplanted to pots and acclimatized in a greenhouse. For genetic transformation, a binary vector carrying P5CSF129A and uidA genes, both under control of the 35SCaMV promoter, was used. Leaves were co-cultured with Agrobacterium tumefaciens in the dark on CI medium for 5 d. The explants were transferred to the selective callogenesis inducing medium (SCI) containing kanamycin and cefotaxime. Calli developed shoots that were cultured on an elongation medium for 14 d and finally multiplied. The presence of the transgene in the plant genome was demonstrated by PCR and confirmed by Southern blot analysis. Proline content in the leaves was four times higher in transformed than in untransformed plants while the proline content in the roots was similar in both types of plants. [ABSTRACT FROM AUTHOR]

Transformation and high efficient regeneration of transgenic plants from the trimmed etiolated shoot/root region (TESRR) of Anliucheng sweet orange [Citrus sinensis (L.) Osb.] seedling was reported. A visual green fluorescent protein (GFP) marker gene was introduced to evaluate transformation efficiency by using the explants from TESRR and epicotyls. The transformation protocol was: infection 20 min, co-culture 3 d, selection culture 30 d, and rooting 15 d. Out of a total of 288 sprouted shoots obtained from TESRR, 34 shoots (11.8 %) yielded GFP expression. In contrast, only 2 (3.0 %) of the 67 sprouted shoots from epicotyl transformation yielded GFP expression. In all plants showing the green fluorescence an expected 500 bp GFP fragment was proved by PCR analysis. Southern blot analysis further confirmed the integration of GFP gene into citrus genome. Transgenic plantlets were obtained within 80 d using the TESRR, compared within 150 d by using epicotyls. [ABSTRACT FROM AUTHOR]

Agrobacterium tumefaciens mediated vacuum infiltration transformation in planta has been established in pakchoi, a kind of Chinese cabbage, but the transformation frequency in harvested seeds has varied in the range of 0.5 to 3.0 × 10-4 over several years and is much lower than the transformation frequency in Arabidopsis thaliana. To understand that, the distribution and vitality changes of A. tumefaciens in plant tissues were examined. Results revealed that there was a majority of A. tumefaciens in the flower compared with that in the stem and in the leaf at all times after infiltration. As fact of transformants in the upper part of the treated plant (T0) stalk and fact of the survival of A. tumefaciens in the plant were proved, possibilities of optimizing the transformation conditions to increase the transformation frequency in pakchoi was discussed. [ABSTRACT FROM AUTHOR]

Abstract  Two selection systems for Agrobacterium tumefaciens mediated transformation of tomato and potato were compared. In the tomato (Lycopersicon esculentum cv. Moneymaker), the highest transformation rate, 4.2 %, of cotyledon explants on mannose-selection medium was obtained when mannose/sucrose concentration in the regeneration medium was 5/15 g dm−3. The best transformation efficacy with the commonly used concentration of 100 mg dm−3 kanamycin as a selection agent was 9 %. In the potato (Solanum tuberosum cv. Bintje), the highest transformation frequency was 53.3 % when mannose concentration in the regeneration medium was 5 g dm−3 during the first 3 weeks after transformation and 10 g dm−3 afterwards. The optimum concentration of sucrose was 20 g dm−3. The transformation efficiency using kanamycin as a selection agent at a concentration 100 mg dm−3 was 33.3 % with potato. Our results demonstrate that the transformation efficiency using mannose selection is 1.6-fold higher for potato and about 2 times lower for tomato comparing with the ordinary protocol using kanamycin. [ABSTRACT FROM AUTHOR]

Abstract   Agrobacterium tumefaciens-mediated transformation was used to produce transgenic watermelon. Cotyledonary explants of Citrullus lanatus Thumb (cv. Daesan) were co-cultivated with Agrobacterium strains (LBA4404, GV3101, EHA101) containing pPTN289 carrying with bar gene and pPTN290 carrying with nptII gene, respectively. There was a significant difference in the transformation frequency between bacteria strains and selective markers. The EHA101/pPTN289 showed higher transformation frequency (1.16 %) than GV3101/pPTN289 (0.33 %) and LBA4404/pPTN289 or /pPTN290 (0 %). The shoots obtained (633 and 57 lines) showed some resistance to glufosinate and paromomycin, respectively. Of them, the β-glucuronidase positive response and PCR products amplified by bar and nptII specific primers showed at least 21 plants resistant to glufosinate and at least 6 plants to paromomycin. Southern blot analysis revealed that the bar gene integrated into genome of transgenic watermelon. Acclimated transgenic watermelons were successfully transplanted in the greenhouse and showed no phenotypic variation. [ABSTRACT FROM AUTHOR]

Abstract  Epicotyl segments of kumquat (Fortunella crassifolia Swingle cv. Jindan) were transformed with Agrobacterium tumefaciens GV3101 harboring neomycin phosphotransferase gene (npt II) containing plant expression vectors. Firstly, the explants were cultured in darkness at 25 C on kanamycin free shoot regeneration medium (SRM) for 3 d, and then on SRM supplemented with 25 mg dm−3 kanamycin and 300 mg dm−3 cefotaxime for 20 d. Finally, they were subcultured to fresh SRM containing 50 mg dm−3 kanamycin monthly and grown under 16-h photoperiod. Sixty five kanamycin resistant shoots were regenerated from 500 epicotyl explants after four-month selection. Shoot tips of 20 strong shoots were grafted to 50-day-old kumquat seedlings and survival rate was 55 %. Among the 11 whole plants, 3 were transgenic as confirmed by Southern blotting. This is the first report on transgenic kumquat plants, and a transformation efficiency of 3.6 % was achieved. [ABSTRACT FROM AUTHOR]

Abstract??Agrobacterium tumefaciensstrain EHA105 carrying a binary vector pCAMBIA2301, which contains a neomycin phosphotransferase gene (nptII) and a ?-glucuronidase (GUS) gene (uidA) interrupted with an intron, was used for transformation ofVigna mungocotyledonary node explants. Various factors such as preculture and wounding of explants, manipulations in inoculation and co-cultivation conditions were found to play a significant role in influencing tissue competence,Agrobacteriumvirulence and compatibility of both, for achieving the maximum transformation frequencies. The stable transformation with 4.31 % efficiency was achieved using the optimized conditions. The transformed green shoots that were selected and rooted on medium containing kanamycin and tested positive fornptIIgene by polymerase chain reaction were established in soil to collect seeds. GUS activity was detected in leaves, roots, pollen grains and T1seedlings. Southern analysis of T0plants showed the integration ofnptIIinto the plant genome. [ABSTRACT FROM AUTHOR]

Transgenic tobacco ( Nicotiana tobacum) plants carrying the gene coding for potato virus A (PVA) non-structural P3 protein were prepared by inoculation with Agrobacterium tumefaciens. Seeds from self-pollinated flowers (T1 generation) were collected. To estimate the effectiveness of vertical transfer of the introduced gene and usefulness of respective plant lines for further experiments, the T1 generation was characterized by testing its ability to grow in the presence of kanamycin (Km) and by PCR of both neomycin phosphotransferase (nptII) and PVA P3 genes. Eight and ten of 29 lines showed Mendelian segregation of Km-resistant phenotype 3:1 and ≥15:1, respectively, the T1 of eleven lines showed low Km resistance. Selected PCR-positive lines were tested for the presence of P3 mRNA. In most cases the transgene transcription was dependent on the presence or absence of Km in the plant growth medium. Prepared transgenic plants were furthermore tested for sensitivity to PVA and potato virus Y (PVY) infection. All of them showed identical symptom development as the non-transgenic control plants. [ABSTRACT FROM AUTHOR]

For expression of MRJP1 - the most abundant protein of honeybee royal jelly - in plants, plasmid carrying the expression cassette composed of CaMV 35S RNA promoter, cDNA encoding MRJP1 with its native signal peptide, and nos3′ as transcription terminator in binary vector pBin19 was prepared. The plasmid was introduced into tobacco ( Nicotiana tabacum L. cv. Wi38) plants by Agrobacterium tumefaciens-mediated transformation. Transgenic F1 and F2 generation was grown from the seeds of the primary obtained transgenic tobacco plants. Immunoblot analyses of protein leaf extracts from transgenic plants showed expression of MRJP1. [ABSTRACT FROM AUTHOR]

The in vitro regeneration of three flax (Linum usitatissimum L.) breeding lines (cv. Jitka, cv. Areco and NLN 245) and selection of transgenic plants were studied. A. tumefaciens derived binary vector GV3101 (pPM90RK)(pPCVRN4) bearing tetramer of 35S promoter enhancer was used in transformation experiments. Following 3 weeks of cultivation on shoot inducing Murashige and Skoog agar medium containing BAP (0.1 µM) and NAA (0.005 µM) from 82.6 % to 98 % of hypocotyl segments formed shoots. While ticarcillin (500 mg dm−3) used to eliminate Agrobacterium following the transformation decreased the organogenic response by about 10 % only, the addition of 20 mg dm−3 hygromycin to ticarcillin efficiently suppressed the regeneration of untransformed control plants. To look up for genomic mutations caused by T-DNA insertion from Agrobacterium transformation or originated from somaclonal variation over 500 regenerated plants have been cloned, transferred into soil and evaluated especially for their morphological characteristics. Up to now among plants of cv. Areco-background at least 8 genotypes showed changes either in flower or filament and stigma colour and one clone of plants with pollen sterility was identified. Among fifty four plant clones evaluated in 7 clones the presence of transgene specific sequence hpt was detected and simultaneously Agrobacterium contamination of tissues was firmly excluded. [ABSTRACT FROM AUTHOR]

The expression of genes for synthesis of auxin (iaaM and iaaH) and cytokinins (ipt) was studied in tobacco plants transformed by two Agrobacterium tumefaciens strains C 58 and LBA 4404. The strain LBA 4404 carried binary vector plasmid pCB 1334 (ipt gene) and plasmid pCB 1349 (iaaM, iaaH and ila genes). Both plasmids carried reportered gene for npt II. Obtained plants expressed incorporated genes. New proteins with molecular masses of about 74, 40, 26, 25, 21 and 17 kDa for wild plasmid pTi C58; 60, 36, 31.5, 27, 26 and 17 kDa for binary vector plasmid pCB 1334 and 74, 49, 36, 31.5, 26 and 25 kDa for binary vector plasmid pCB 1349 were found in the patterns of soluble proteins. Significant changes in the content of chlorophylls, especially chlorophyll a, were detected in the plants carrying ipt gene and in plants transformed by the wild strain C58 of A. tumefaciens. Tobacco plants expressing ipt gene and genes from T-DNA of pTi C58 plasmid were dwarf, and in comparison to the controls, they had thicker stems, and the surface of the leaf blades was reduced to 20 - 50 %. Adventitious roots, growing from the stem, were typical for transformants overproducing auxins. Regenerants and transformants expressing genes from T-DNA of plasmid pTi C58 differed in the shape of the flowers and their fertility. [ABSTRACT FROM AUTHOR]

The localization of peroxidase in cells of horse-radish (Armoracia lapathifolia Gilib.) tumour and teratoma tissues was studied. Both tissue lines were derived from the same primary crown-gall tumour induced on the leaf fragments by a wild type of Agrobacterium tumefaciens B6S3. Enzymatic activity was measured in cell walls, high-density heterogeneous membrane fraction, microsomal and soluble (no particulate) fractions. The subcellular localization of enzymatic activity was distinct for each transformed tissue. Both tumour and teratoma showed similar isoenzyme patterns, but one soluble acidic isoperoxidase could be considered as a marker of cell differentiation. [ABSTRACT FROM AUTHOR]

Vigna Δ1-pyrroline-5-carboxylate synthetase (P5CS) cDNA was transferred to chickpea (Cicer arietinum L.) cultivar Annigeri via Agrobacterium tumefaciens mediated transformation. Following selection on hygromycin and regeneration, 60 hygromycin-resistant plants were recovered. Southern blot analysis of five fertile independent lines of T0 and T1 generation revealed single and multiple insertions of the transgene. RT-PCR and Western blot analysis of T0 and T1 progeny demonstrated that the P5CS gene is expressed and produced functional protein in chickpea. T1 transgenic lines accumulated higher amount of proline under 250 mM NaCl compared to untransformed controls. Higher accumulation of Na+ was noticed in the older leaves but negligible accumulation in seeds of T1 transgenic lines as compared to the controls. Chlorophyll stability and electrolyte leakage indicated that proline overproduction helps in alleviating salt stress in transgenic chickpea plants. The T1 transgenics lines were grown to maturity and set normal viable seeds under continuous salinity stress (250 mM) without any reduction in plant yield in terms of seed mass.