Search

A ceftolozane-tazobactam- and ceftazime-avibactam-resistant Pseudomonas aeruginosa isolate was recovered after treatment (including azithromycin, meropenem, and ceftolozane-tazobactam) from a patient that had developed ventilator-associated pneumonia after COVID-19 infection. Whole-genome sequencing revealed that the strain, belonging to ST274, had acquired a nonsense mutation leading to truncated carbapenem porin OprD (W277X), a 7-bp deletion (nt213Δ7) in NfxB (negative regulator of the efflux pump MexCD-OprJ), and two missense mutations (Q178R and S133G) located within the first large periplasmic loop of MexD. Through the construction of mexD mutants and complementation assays with wild-type nfxB, it was evidenced that resistance to the novel cephalosporin-s-lactamase inhibitor combinations was caused by the modification of MexD substrate specificity.

Molecular surveillance by whole-genome sequencing was used to monitor the susceptibility of circulating influenza A viruses to three polymerase complex inhibitors. A total of 12 resistance substitutions were found among 285 genomes analyzed, but none were associated with high levels of resistance. Natural resistance to these influenza A antivirals is currently uncommon.

In this study, the plasmid content of clinical and commensal strains was analyzed and compared. The replicon profile was similar in both populations, except for L, M, A/C, and N (detected only in clinical strains) and HI1 (only in commensal strains). Although I1 and F were the most frequent replicons, only IncI1, sequence type 12 (ST12) was associated with bla CMY-2 in both populations. In contrast, the widespread resistant IncF plasmids were not linked to a single epidemic plasmid.

Colistin resistance in Acinetobacter baumannii is of great concern and is a threat to human health. In this study, we investigate the mechanisms of colistin resistance in four isogenic pairs of A. baumannii isolates displaying an increase in colistin MICs. A mutation in pmrB was detected in each colistin-resistant isolate, three of which were novel (A28V, I232T, and ΔL9-G12). Increased expression of pmrC was shown by semi-quantitative reverse transcription-PCR (qRT-PCR) for three colistin-resistant isolates, and the addition of phosphoethanolamine (PEtN) to lipid A by PmrC was revealed by mass spectrometry. Interestingly, PEtN addition was also observed in some colistin-susceptible isolates, indicating that this resistance mechanism might be strain specific and that other factors could contribute to colistin resistance. Furthermore, the introduction of pmrAB carrying the short amino acid deletion ΔL9-G12 into a pmrAB knockout strain resulted in increased pmrC expression and lipid A modification, but colistin MICs remained unchanged, further supporting the strain specificity of this colistin resistance mechanism. Of note, a mutation in the pmrC homologue eptA and a point mutation in ISAba1 upstream of eptA were associated with colistin resistance and increased eptA expression, which is a hitherto undescribed resistance mechanism. Moreover, no cost of fitness was observed for colistin-resistant isolates, while the virulence of these isolates was increased in a Galleria mellonella infection model. Although the mutations in pmrB were associated with colistin resistance, PEtN addition appears not to be the sole factor leading to colistin resistance, indicating that the mechanism of colistin resistance is far more complex than previously suspected and is potentially strain specific.

We investigated whether the addition of fosfomycin or cloxacillin to daptomycin provides better outcomes in the treatment of methicillin-resistant Staphylococcus aureus (MRSA) experimental aortic endocarditis in rabbits. Five MRSA strains were used to perform in vitro time-kill studies using standard (10 6 ) and high (10 8 ) inocula. Combined therapy was compared to daptomycin monotherapy treatment in the MRSA experimental endocarditis model. A human-like pharmacokinetics model was applied, and the equivalents of cloxacillin at 2 g/4 h, fosfomycin at 2 g/6 h, and daptomycin at 6 to 10 mg/kg/day were administered intravenously. A combination of daptomycin and either fosfomycin or cloxacillin was synergistic in the five strains tested at both inocula. A bactericidal effect was detected in four of five strains tested with both combinations. The MRSA-277 strain (vancomycin MIC, 2 μg/ml) was used for the experimental endocarditis model. Daptomycin plus fosfomycin significantly improved the efficacy of daptomycin monotherapy at 6 mg/kg/day in terms of both the proportion of sterile vegetations (100% versus 72%, P = 0.046) and the decrease in the density of bacteria within the vegetations ( P = 0.025). Daptomycin plus fosfomycin was as effective as daptomycin monotherapy at 10 mg/kg/day (100% versus 93%, P = 1.00) and had activity similar to that of daptomycin plus cloxacillin when daptomycin was administered at 6 mg/kg/day (100% versus 88%, P = 0.48). Daptomycin nonsusceptibility was not detected in any of the isolates recovered from vegetations. In conclusion, for the treatment of MRSA experimental endocarditis, the combination of daptomycin plus fosfomycin showed synergistic and bactericidal activity.

Ceftazidime-avibactam and comparator antibiotics were tested by the broth microdilution method against 200 Enterobacteriaceae and 25 Pseudomonas aeruginosa strains resistant to fluoroquinolones (including strains with the extended-spectrum β-lactamase [ESBL] phenotype and ceftazidime-resistant strains) collected from our institution. The MICs and mechanisms of resistance to fluoroquinolone were also studied. Ninety-nine percent of fluoroquinolone-resistant Enterobacteriaceae strains were inhibited at a ceftazidime-avibactam MIC of ≤4 mg/liter (using the susceptible CLSI breakpoint for ceftazidime alone as a reference). Ceftazidime-avibactam was very active against ESBL Escherichia coli (MIC 90 of 0.25 mg/liter), ESBL Klebsiella pneumoniae (MIC 90 of 0.5 mg/liter), ceftazidime-resistant AmpC-producing species (MIC 90 of 1 mg/liter), non-ESBL E. coli (MIC 90 of ≤0.125 mg/liter), non-ESBL K. pneumoniae (MIC 90 of 0.25 mg/liter), and ceftazidime-nonresistant AmpC-producing species (MIC 90 of ≤0.5 mg/liter). Ninety-six percent of fluoroquinolone-resistant P. aeruginosa strains were inhibited at a ceftazidime-avibactam MIC of ≤8 mg/liter (using the susceptible CLSI breakpoint for ceftazidime alone as a reference), with a MIC 90 of 8 mg/liter. Additionally, fluoroquinolone-resistant mutants from each species tested were obtained in vitro from two strains, one susceptible to ceftazidime and the other a β-lactamase producer with a high MIC against ceftazidime but susceptible to ceftazidime-avibactam. Thereby, the impact of fluoroquinolone resistance on the activity of ceftazidime-avibactam could be assessed. The MIC 90 values of ceftazidime-avibactam for the fluoroquinolone-resistant mutant strains of Enterobacteriaceae and P. aeruginosa were ≤4 mg/liter and ≤8 mg/liter, respectively. We conclude that the presence of fluoroquinolone resistance does not affect Enterobacteriaceae and P. aeruginosa susceptibility to ceftazidime-avibactam; that is, there is no cross-resistance.

A carbapenem-resistant Escherichia coli isolate (sequence type 448 [ST448]) was recovered from a urine culture of a female patient with no recent record of traveling. PCR screening identified the presence of bla NDM-5 , bla TEM-1 , bla OXA-1 , bla CMY-42 , and rmtB. bla NDM-5 was carried in a conjugative IncFII-type plasmid (90 kb) together with bla TEM-1 and rmtB . The genetic environment of bla NDM-5 showed a structure similar to those of pMC-NDM and pGUE-NDM, identified in Poland and France in E. coli of African and Indian origin, respectively.

In vitro activity of ozenoxacin, a novel nonfluorinated topical (L. D. Saravolatz and J. Leggett, Clin. Infect. Dis. 37: 1210–1215, 2003) quinolone, was compared with the activities of other quinolones against well-characterized quinolone-susceptible and quinolone-resistant Gram-positive bacteria. Ozenoxacin was 3-fold to 321-fold more active than other quinolones. Ozenoxacin could represent a first-in-class nonfluorinated quinolone for the topical treatment of a broad range of dermatological infections.

The development of high-level daptomycin resistance (HLDR; MIC of ≥256 mg/liter) after exposure to daptomycin has recently been reported in viridans group streptococcus (VGS) isolates. Our study objectives were as follows: to know whether in vitro development of HLDR after exposure to daptomycin was common among clinical isolates of VGS and Streptococcus bovis ; to determine whether HLDR also developed during the administration of daptomycin to treat experimental endocarditis caused by the daptomycin-susceptible, penicillin-resistant Streptococcus mitis strain S. mitis 351; and to establish whether combination with gentamicin prevented the development of HLDR in vitro and in vivo. In vitro studies were performed with 114 VGS strains (mitis group, 92; anginosus group, 10; mutans group, 8; and salivarius group, 4) and 54 Streptococcus bovis strains isolated from 168 consecutive patients with infective endocarditis diagnosed between 1995 and 2010. HLDR was only observed after 24 h of exposure to daptomycin in 27% of the mitis group, including 27% of S. mitis isolates, 47% of S. oralis isolates, and 13% of S. sanguis isolates. In our experimental model, HLDR was detected in 7/11 (63%) and 8/12 (67%) isolates recovered from vegetations after 48 h of daptomycin administered at 6 mg/kg of body weight/24 h and 10 mg/kg/24 h, respectively. In vitro , time-kill experiments showed that daptomycin plus gentamicin was bactericidal against S. mitis 351 at tested concentrations of 0.5 and 1 times the MIC and prevented the development of HLDR. In vivo , the addition of gentamicin at 1 mg/kg/8 h to both daptomycin arms prevented HLDR in 21 out of 23 (91%) rabbits. Daptomycin plus gentamicin was at least as effective as vancomycin plus gentamicin. In conclusion, HLDR develops rapidly and frequently in vitro and in vivo among mitis group streptococci. Combining daptomycin with gentamicin enhanced its activity and prevented the development of HLDR in most cases.

et al., There is limited information on the role of penicillin-binding proteins (PBPs) in the resistance of Acinetobacter baumannii to β-lactams. This study presents an analysis of the allelic variations of PBP genes in A. baumannii isolates. Twenty-six A. baumannii clinical isolates (susceptible or resistant to carbapenems) from three teaching hospitals in Spain were included. The antimicrobial susceptibility profile, clonal pattern, and genomic species identification were also evaluated. Based on the six complete genomes of A. baumannii, the PBP genes were identified, and primers were designed for each gene. The nucleotide sequences of the genes identified that encode PBPs and the corresponding amino acid sequences were compared with those of ATCC 17978. Seven PBP genes and one monofunctional transglycosylase (MGT) gene were identified in the six genomes, encoding (i) four high-molecular-mass proteins (two of class A, PBP1a [ponA] and PBP1b [mrcB], and two of class B, PBP2 [pbpA or mrdA] and PBP3 [ftsI]), (ii) three low-molecular-mass proteins (two of type 5, PBP5/6 [dacC] and PBP6b [dacD], and one of type 7 (PBP7/8 [pbpG]), and (iii) a monofunctional enzyme (MtgA [mtgA]). Hot spot mutation regions were observed, although most of the allelic changes found translated into silent mutations. The amino acid consensus sequences corresponding to the PBP genes in the genomes and the clinical isolates were highly conserved. The changes found in amino acid sequences were associated with concrete clonal patterns but were not directly related to susceptibility or resistance to β-lactams. An insertion sequence disrupting the gene encoding PBP6b was identified in an endemic carbapenem-resistant clone in one of the participant hospitals., This work was partially supported by the Instituto de Salud Carlos III, Spanish Network for Research in Infectious Diseases (REIPI, RD06/0008), and FIS (PI080209). We are grateful to the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), which gave a PDEE grant to R.C. (protocol 4149/08-4). We acknowledge the funding of MICINN (BFU2009-09200) to J.A.A.

Carbapenem-resistant Acinetobacter baumannii is a major source of nosocomial infections worldwide and is mainly associated with the acquisition of OXA-type carbapenemases and, to a lesser extent, metallo-β-lactamases (MBLs). In this study, 82 nonepidemiologically related Acinetobacter strains carrying different types of OXA or MBL enzymes were tested using the Eazyplex system, a loop-mediated isothermal amplification (LAMP)-based method to rapidly detect carbapenemase carriage. The presence/absence of carbapenem-hydrolyzing enzymes was correctly determined for all isolates in

Elevated levels of fluoroquinolone resistance are frequently found among Escherichia coli clinical isolates. This study investigated the antibiotic resistance mechanisms of strain NorE5, derived in vitro by exposing an E. coli clinical isolate, PS5, to two selection steps with increasing concentrations of norfloxacin. In addition to the amino acid substitution in GyrA (S83L) present in PS5, NorE5 has an amino acid change in ParC (S80R). Furthermore, we now find by Western blotting that NorE5 has a multidrug resistance phenotype resulting from the overexpression of the antibiotic resistance efflux pump AcrAB-TolC. Microarray and gene fusion analyses revealed significantly increased expression in NorE5 of soxS , a transcriptional activator of acrAB and tolC . The high soxS activity is attributable to a frameshift mutation that truncates SoxR, rendering it a constitutive transcriptional activator of soxS . Furthermore, microarray and reverse transcription-PCR analyses showed that mdtG ( yceE ), encoding a putative efflux pump, is overexpressed in the resistant strain. SoxS, MarA, and Rob activated an mdtG :: lacZ fusion, and SoxS was shown to bind to the mdtG promoter, showing that mdtG is a member of the marA-soxS-rob regulon. The mdtG marbox sequence is in the backward or class I orientation within the promoter, and its disruption resulted in a loss of inducibility by MarA, SoxS, and Rob. Thus, chromosomal mutations in parC and soxR are responsible for the increased antibiotic resistance of NorE5.

Based on imipenem resistance in an Acinetobacter genospecies 3 clinical isolate, we were able to identify, for the first time in this genomic species, a plasmid-encoded bla OXA-58 gene that was 100% homologous to the same gene in Acinetobacter baumannii .

We describe here the occurrence of bla VIM-2 in 10 carbapenem-resistant Pseudomonas monteilii strains isolated from different clinical samples from patients at the University Hospital Marqués de Valdecilla in northern Spain. All the bla VIM-2 -harboring P. monteilii isolates possessed a class 1 integron, with the cassette array [ intI1 _ bla VIM-2 _ aac(6′)-Ib_qacEΔ1 _ sul1 ]. Our results show the emergence of VIM-2-producing multidrug-resistant species other than Pseudomonas aeruginosa or Pseudomonas putida in a Spanish hospital. P. monteilii , although sporadically isolated, should also be considered an important metallo-β-lactamase (MBL) reservoir.

Resistance of Acinetobacter baumannii clinical isolates to carbapenems is on the rise worldwide mainly in association with the production of OXA-23. Until recently, however, OXA-23 was absent in Spain. In this work, we report the molecular characterization of a hospital outbreak of OXA-23-producing A. baumannii in Barcelona caused by a multidrug-resistant (MDR) clone belonging to international clone IC-II/sequence type ST85 between October 2010 and May 2011. bla OXA-23 was carried in a plasmid of 90 kb and located within the composite transposon Tn 2006 .

A carbapenem-resistant Acinetobacter baumannii clinical isolate belonging to European clone II and sequence type 2 was recovered from a patient in the Son Espases hospital in Mallorca, Spain. Genetic analysis showed the presence of the bla OXA-23 gene in association with the widely disseminated transposon Tn 2006 . This is the first reported identification of A. baumannii carrying bla OXA-23 in Spain.

The evolution of antimicrobial resistance in Salmonella isolates causing traveler's diarrhea (TD) and their mechanisms of resistance to several antimicrobial agents were analyzed. From 1995 to 2002, a total of 62 Salmonella strains were isolated from stools of patients with TD. The antimicrobial susceptibility to 12 antibiotics was determined, and the molecular mechanisms of resistance to several of them were detected as well. The highest levels of resistance were found against tetracycline and ampicillin (21 and 19%, respectively), followed by resistance to nalidixic acid (16%), which was mainly detected from 2000 onward. Molecular mechanisms of resistance were analyzed in 16 isolates. In these isolates, which were resistant to ampicillin, two genes encoding β-lactamases were detected: oxa-1 (one isolate) and tem -like (seven isolates [in one strain concomitantly with a carb-2 ]). Resistance to tetracycline was mainly related to tetA (five cases) and to tetB and tetG (one case each). Resistance to chloramphenicol was related to the presence of the floR and cmlA genes and to chloramphenicol acetyltransferase activity in one case each. Different genes encoding dihydrofolate-reductases ( dfrA1 , dfrA12 , dfrA14 , and dfrA17 ) were detected in trimethoprim-resistant isolates. Resistance to nalidixic acid was related to the presence of mutations in the amino acid codons 83 or 87 of the gyrA gene. Further surveillance of the Salmonella spp. causing TD is needed to detect trends in their resistance to antimicrobial agents, as we have shown in our study with nalidixic acid. Moreover, such studies will lead to better treatment and strategies to prevent and limit their spread.

Producción Científica, A presumptive chromosomal cephalosporinase (pI, 9.0) from a clinical strain of Acinetobacter genomic species 3 (AG3) is reported. The nucleotide sequence of this -lactamase shows for the first time the gene encoding an AmpC enzyme in AG3. In addition, the biochemical properties of the novel AG3 AmpC -lactamase are reported

New Delhi metallo-β-lactamase (NDM-1) was initially identified in various Enterobacteriaceae and recently in Acinetobacter baumannii . This study described the clonal dissemination of an NDM-2-producing A. baumannii isolate in an Israeli rehabilitation ward and the genetic surroundings of the gene. The bla NDM-2 gene was surrounded by the ble and trpF genes downstream and two copies of the IS Aba125 on both sides. These are the first NDM-producing A. baumannii strains in Israel from patients with no previous travel or hospitalization on the Indian subcontinent.

We investigated the mechanisms of resistance to carbapenems, aminoglycosides, glycylcyclines, tetracyclines, and quinolones in 90 multiresistant clinical strains of Acinetobacter baumannii isolated from two genetically unrelated A. baumannii clones: clone PFGE-ROC-1 (53 strains producing the OXA-58 β-lactamase enzyme and 18 strains with the OXA-24 β-lactamase) and clone PFGE-HUI-1 (19 strains susceptible to carbapenems). We used real-time reverse transcriptase PCR to correlate antimicrobial resistance (MICs) with expression of genes encoding chromosomal β-lactamases (AmpC and OXA-51), porins (OmpA, CarO, Omp33, Dcap-like, OprB, Omp25, OprC, OprD, and OmpW), and proteins integral to six efflux systems (AdeABC, AdeIJK, AdeFGH, CraA, AbeM, and AmvA). Overexpression of the AdeABC system (level of expression relative to that by A. baumannii ATCC 17978, 30- to 45-fold) was significantly associated with resistance to tigecycline, minocycline, and gentamicin and other biological functions. However, hyperexpression of the AdeIJK efflux pump (level of expression relative to that by A. baumannii ATCC 17978, 8- to 10-fold) was significantly associated only with resistance to tigecycline and minocycline (to which the TetB efflux system also contributed). TetB and TetA(39) efflux pumps were detected in clinical strains and were associated with resistance to tetracyclines and doxycycline. The absence of the AdeABC system and the lack of expression of other mechanisms suggest that tigecycline-resistant strains of the PFGE-HUI-1 clone may be associated with a novel resistance-nodulation-cell efflux pump (decreased MICs in the presence of the inhibitor Phe-Arg β-naphthylamide dihydrochloride) and the TetA(39) system.

The tet (M) gene encodes a protein which is related to tetracycline ribosomal protection, one of the mechanisms of tetracycline resistance. A tet (M) gene that is 100% homologous to the tet (M) gene of Staphylococcus aureus has been found in a clinical isolate of Acinetobacter baumannii , which also carries the tet (A) gene encoding a tetracycline efflux pump.

Non- Acinetobacter baumannii spp. are emerging among clinical Acinetobacter isolates causing nosocomial infections, and some (such as genomospecies 13TU) appear to be multidrug resistant. The prevalence of non- Acinetobacter baumannii spp. in the hospital setting is likely understated due to poor identification techniques. We report the first identification of an AdeABC-type efflux pump in an Acinetobacter genomospecies 13TU clinical isolate, its contribution to multidrug resistance, and the coexistence of three Ade-type efflux pumps in this strain.

Enterotoxigenic Escherichia coli isolates were identified as a cause of traveler’s diarrhea in 82 of 520 (16%) patients and tested for resistance to seven antimicrobial agents. Thirty patients (36%) needed antimicrobial therapy: 17 (56%) for persistence of symptoms and 13 (44%) for severity of symptoms. Ampicillin, tetracycline, and trimethoprim-sulfamethoxazole resistance was high. Chloramphenicol showed moderate activity, and amoxicillin plus clavulanic acid, nalidixic acid, and ciprofloxacin showed very good activity. Five nalidixic acid-resistant strains were isolated, four from patients visiting India. Enterotoxigenic Escherichia coli (ETEC) is the major cause of traveler’s diarrhea in people from industrialized countries visiting less-developed countries (6, 7) and is an important cause of dehydrating diarrhea in infants and children in lessdeveloped countries (13). Traveler’s diarrhea caused by ETEC strains is usually a mild, self-limited disease, but for severe traveler’s diarrhea, early treatment with loperamide and an antibiotic such as trimethoprim-sulfamethoxazole, doxycycline, or a fluoroquinolone has been recommended (4). Many previous studies of antimicrobial susceptibility of ETEC involved a small number of isolates from a single geographic location. We, therefore, performed antimicrobial susceptibility testing of ETEC isolates causing traveler’s diarrhea originating from diverse geographical locations. Investigation of the mechanisms of acquisition of quinolone resistance in the nalidixic acid-resistant ETEC strains was also performed. During the period from 1994 to 1997, stool specimens from 520 adult patients with traveler’s diarrhea were analyzed. The patients were recruited from the traveler’s clinic of the Tropical Medicine Department of the Hospital Clinic. All patients had diarrhea on arrival in Spain or within 2 days after their return. The stool specimens were cultured for E. coli and other bacterial enteropathogens by conventional methods (11). Single-colony subcultures of all different lactose-fermenting colonial morphotypes growing on MacConkey agar were identified by conventional criteria. The E. coli isolates were tested by PCR to detect the heat-stable (ST) and heat-labile (LT) toxin genes (15). ETEC strains were isolated from 82 patients (16%) with traveler’s diarrhea. The distribution of these strains according to the type of enterotoxin synthesized was as follows: 58 strains (71%) produced the ST, 11 strains (13%) produced LT, and 13 strains (16%) produced both toxins (LT/ST). ETEC strains were isolated from stool samples of patients traveling to different tropical and subtropical areas, except for Central and South Africa. The range of prevalence was from 7.5% to 31%, with West Africa and the Indian Subcontinent being the two geographic areas where ETEC strains were more prevalent, at 31 and 22%, respectively. Thirty patients (36%) needed antimicrobial therapy: 17 patients (56%) because of persistence of symptoms and 13 (44%) because of severity of symptoms. In 14 treated patients, the cause of diarrhea was ST-producing ETEC (ETEC-ST), representing 24% of the total number of strains of ETEC-ST, whereas in 7 (63%) and 9 (69%) patients, the cause was LT- and LT/ST-producing ETEC, respectively (P , 0.02). All patients were empirically treated with ciprofloxacin, and in all, the duration of diarrhea was shortened and the accompanying symptoms such as abdominal discomfort, flatulence, nausea, and vomiting were relieved. It is noteworthy that patients with ETEC-LT and ETEC-LT/ST strains required antimicrobial therapy more frequently than patients with ETEC-ST strains. However, this finding needs to be confirmed in future studies. The MICs for the clinical isolates studied were determined by E-test according to standard practice. E. coli ATCC 25922 was used as a reference strain for quality control. The breakpoints considered to define a resistant strain were those recommended in reference 12. The MICs of antimicrobial agents for ETEC-ST, ETEC-LT, and ETEC-ST/LT strains are shown in Table 1. Randomized, controlled studies have demonstrated that a 3- to 5-day course of an antibiotic can reduce the duration of an acute diarrheal episode in travelers. Most studies

The main objective of this study was to determine the prevalence of the Qnr determinants in clinical and environmental Aeromonas spp. A total of 52 Aeromonas sp. isolates identified by biochemical methods (5), 25 isolated from natural waters (1) and 27 isolated from clinical samples from hospitals in Valencia, Spain, were tested for quinolone resistance by the disk diffusion method (4) (nalidixic acid, 30 μg; oxolinic acid, 2 μg; flumequine, 30 μg; ciprofloxacin, 5 μg; and levofloxacin, 5 μg). Among the studied isolates, 27 showed resistance to nalidixic acid and susceptibility to ciprofloxacin, 24 isolates were susceptible to both nalidixic acid and ciprofloxacin, and only 1, the A. veronii A272 clinical isolate, was resistant to both nalidixic acid and ciprofloxacin. The isolates resistant to nalidixic acid were also resistant to oxolinic acid and flumequine. Moreover, A. veronii A272 was the only one resistant to levofloxacin. Screening of the qnrA, qnrB, and qnrS genes was performed by multiplex PCR using a set of specific primers for all isolates. Bacterial strains positive for each qnr gene were used as positive controls (Klebsiella pneumoniae UAB1 for qnrA, Escherichia coli J53 pMG252 for qnrB, and E. coli J53 pMG298 for qnrS) and were run in each batch of tested samples. Only an A. veronii clinical isolate (A. veronii A272) presented a qnr gene, which showed 100% homology with the qnrS2 gene previously reported in an isolate from the bacterial community of a wastewater treatment plant in Germany (2) and in a non-Typhi Salmonella clinical isolate in the United States (6).

Escherichia coli is the most common microorganism causing urinary tract infections. Quinolone-resistant E. coli strains have fewer virulence factors than quinolone-susceptible strains. Several urovirulence genes are located in pathogenicity islands (PAIs). We investigated the capacity of quinolones to induce loss of virulence factors such as hemolysin, cytotoxic necrotizing factor 1, P fimbriae, and autotransporter Sat included in PAIs in three uropathogenic E. coli strains. In a multistep selection, all strains lost hemolytic capacity at between 1 and 4 passages when they were incubated with subinhibitory concentrations of ciprofloxacin, showing a partial or total loss of the PAI containing the hly (hemolysin) and cnf-1 (cytotoxic necrotizing factor 1) genes. RecA − mutants were obtained from the two E. coli strains with partial or total loss of the PAI. The inactivation of the RecA protein affected only the partial loss of the PAI induced by quinolones. No spontaneous loss of PAIs was observed on incubation in the absence of quinolones in either the wild-type or mutant E. coli strains. Quinolones induce partial or total loss of PAIs in vitro in uropathogenic E. coli by SOS-dependent or -independent pathways, respectively.

Quinolone susceptibility was analyzed in 17 clinical isolates of Corynebacterium striatum and 9 strains of Corynebacterium amycolatum by the E-test method in Mueller-Hinton agar plates. The C. striatum ATCC 6940 strain was used as a control strain. The amplified quinolone resistance determining regions of the gyrA genes of C. amycolatum and C. striatum were characterized. Four in vitro quinolone-resistant mutants of C. amycolatum were selected and analyzed. Both in vivo and in vitro quinolone-resistant strains of C. amycolatum showed high levels of fluoroquinolone resistance in strains with a double mutation leading to an amino acid change in positions 87 and 91 or positions 87 and 88 (unusual mutation) of GyrA, whereas the same concomitant mutations at amino acid positions 87 and 91 in GyrA of C. striatum produced high levels of resistance to ciprofloxacin and levofloxacin but only showed a moderate increase in the MIC of moxifloxacin, suggesting that other mechanism(s) of quinolone resistance could be involved in moxifloxacin resistance in C. amycolatum . Moreover, a PCR-RFLP-NcoI of the gyrA gene was developed to distinguish between C. amycolatum and C. striatum species.

Seventeen multiple-antibiotic-resistant nonpathogenic Escherichia coli strains of human, animal, and food origins showed a wide variety of antibiotic resistance genes, many of them carried by class 1 and class 2 integrons. Amino acid changes in MarR and mutations in marO were identified for 15 and 14 E. coli strains, respectively.

Antimicrobial susceptibility was determined in 15 epidemiologically unrelated clinical isolates of Acinetobacter genospecies 3. Moreover, the mechanisms of resistance to some β-lactam antibiotics may be associated with the presence of a chromosomal cephalosporinase, AmpC, and the resistance to quinolones related to mutations in the gyrA and parC genes.

The mutations in the quinolone resistance-determining region of the gyrA and gyrB genes from 27 clinical isolates of Escherichia coli with a range of MICs of ciprofloxacin from 0.007 to 128 micrograms/ml and of nalidixic acid from 2 to > 2,000 micrograms/ml were determined by DNA sequencing. All 15 isolates with ciprofloxacin MICs of > or = 1 micrograms/ml showed a change in Ser-83 to Leu of GyrA protein, whereas in clinical isolates with a MIC of > or = 8 micrograms/ml (11 strains), a double change in Ser-83 and Asp-87 was found. All isolates with a MIC of nalidixic acid of > or = 128 micrograms/ml showed a mutation at amino acid codon Ser-83. Only 1 of the 27 clinical isolates of E. coli analyzed showed a change in Lys-447 of the B subunit of DNA gyrase. A change in Ser-83 is sufficient to generate a high level of resistance to nalidixic acid, whereas a second mutation at Asp-87 in the A subunit of DNA gyrase may play a complementary role in developing the strain's high levels of ciprofloxacin resistance.

Acinetobacter baumannii has been increasingly associated with hospital-acquired infections, and the presence of multidrug resistance strains is of great concern to clinicians. A. baumannii is thought to possess a great deal of intrinsic resistance to several antimicrobial agents, including chloramphenicol, although the mechanisms involved in such resistance are not well understood. In this work, we have identified a major facilitator superfamily efflux pump present in most A. baumannii strains, displaying strong substrate specificity toward chloramphenicol.

The use of radiopharmaceuticals for the diagnosis of infection is increasing due to their ability to distinguish between septic and aseptic inflammation. The aim of this study was to analyze the intracellular accumulation of technetium-99m-ciprofloxacin in strains of Staphylococcus aureus and Pseudomonas aeruginosa harboring an overexpression of NorA and MexAB-OprM, respectively.

A clinical strain of Acinetobacter baumannii (strain Ab41) that was resistant to all beta-lactam antibiotics tested except ceftazidime, ceftriaxone, ceftizoxime, and imipenem produced three beta-lactamases: a presumptive chromosomal cephalosporinase, a TEM-1-like beta-lactamase (pI 5.4), and a novel OXA-derived beta-lactamase named OXA-21 (pI 7.0). The gene encoding OXA-21 was located in an integron. The nucleotide sequence showed three mutations compared with the sequence of OXA-3, with two being silent; the nonsilent mutation generated a substitution of Ile-217 to Met.

Traveler's diarrhea (TD) is a frequent health problem among travelers abroad. Diarrheagenic Escherichia coli, Shigella spp., Salmonella spp., and Campylobacter spp. are among the most common causes of TD (3, 5). The antimicrobial resistance in Salmonella strains is an increasing problem (15). Genetic elements, such as plasmids, transposons, and integrons, carrying resistant genes have previously been reported for this microorganism (13, 14, 15). We previously studied the evolution of antimicrobial resistance and the mechanisms of resistance to several antimicrobial agents in Salmonella isolates causing TD and found different genes encoding resistant determinants (3). The aim of the present study was to determine the presence of class 1 integrons and identify the resistance genes located therein in different serotypes of TD-causing, resistant Salmonella strains obtained in the previous study. Sixteen Salmonella strains that were isolated from the stool samples of patients with TD were analyzed (1) using the Kirby-Bauer method and chosen for their resistance to at least one of the following tested antimicrobial agents: ampicillin, amoxicillin-clavulanic acid, nalidixic acid, tetracycline, trimethoprim-sulfamethoxazole, chloramphenicol, gentamicin, ciprofloxacin, amikacin, imipenem, norfloxacin, and ceftazidime. The results were interpreted according to the Clinical and Laboratory Standards Institute (formerly NCCLS) guidelines (9). The strains belonged to the following Salmonella enterica serotypes: Enteritidis (seven strains), Typhimurium (two strains), Virchow (one strain), Haifa (one strain), Goldcoast (one strain), Risseu (one strain), Paratyphi A (one strain), Kiambu (one strain), and Hadar (one strain). The presence of class 1 integrons was determined by PCR amplification (7, 16). The sequences obtained were compared to those in GenBank to identify the genes. Class 1 integrons were present in 4/16 (25%) of the resistant strains analyzed (Table ​(Table1;1; Fig. ​Fig.1).1). Three of the four strains presented one integron, whereas the fourth showed two integrons, with the integron sizes ranging from 1,050 to 1,700 bp. All integrons were sequenced to detect the gene cassettes located inside. The resistance genes located in the integrons encoded enzymes that were associated with resistance to aminoglycosides, β-lactams, trimethoprim, and chloramphenicol (Table ​(Table1).1). The prevalence of integrons among the Salmonella strains causing TD described herein is similar to that described in other reports analyzing Salmonella strains not causing TD. Class 1 integrons were found in 20, 20, and 17% of the Salmonella strains that were isolated in Spain, the United Kingdom, and China (6, 12, 17), respectively. In these studies, serotype Virchow carried an integron containing the aadA1a and dfrA1 genes and serotype Haifa carried an integron with the tetA gene (6, 12), which were different from those found in our study. We have not found any report in the scientific literature concerning the presence of integrons in Salmonella serotype Goldcoast. Moreover, the type of resistance genes that were found in the class 1 integrons agrees with previous studies that were undertaken with resistant Shigella strains causing TD (11). Serotype Kiambu had two integrons containing the aadA2 and carb-2 genes, respectively, which have also been described in different serotypes of Salmonella, such as Typhimurium, Agona, Paratyphi B, and Albany. These two integrons have been located in a genomic resistance island (SGI1) (2, 4, 8), suggesting that our strain also carries this genomic island. The range in the geographic origins of our strains containing integrons demonstrates the wide dissemination of these genetic elements. Nowadays, widespread international travel has facilitated the dissemination of multiresistant pathogenic strains throughout the world, and this has become a great public health problem (10). In addition, if resistance is associated with genes that are located in genetic elements such as plasmids, transposons, or integrons, they can be transferred and disseminated to the local bacterial population. FIG. 1. Class 1 integrons of Salmonella-resistant strains. The designation numbers of the strains are reported above each lane. Lane M, the molecular weight marker. TABLE 1. Characteristics of Salmonella strains with class 1 integrons

The gyrA gene mutations associated with quinolone resistance were determined in 21 epidemiologically unrelated clinical isolates of Acinetobacter baumannii. Our studies highlight the conserved sequences in the quinolone resistance-determining region of the gyrA gene from A. baumannii and other bacteria. All 15 isolates for which the MIC of ciprofloxacin is > or = 4 micrograms/ml showed a change at Ser-83 to Leu. Six strains for which the MIC of ciprofloxacin is 1 microgram/ml did not show any change at Ser-83, although a strain for which the MIC of ciprofloxacin is 1 microgram/ml exhibited a change at Gly-81 to Val. Although it is possible that mutations in other locations of the gyrA gene, the gyrB gene, or in other genes may also contribute to the modulation of the MIC level, our results suggest that a gyrA mutation at Ser-83 is associated with quinolone resistance in A. baumannii.

Antimicrobial susceptibility testing was performed on 54 epidemiologically unrelated clinical isolates of Acinetobacter baumannii by using a standard agar dilution technique. On the basis of the in vitro activities, imipenem and doxycycline were the most active agents, whereas amikacin, isepamicin, and the new fluorquinolones ciprofloxacin and ofloxacin presented moderate activity. Cephalosporinase activity was found in 98% of the strains, whereas lactamases of TEM type 1 and one with a pI of 7 to 7.5 were present in 16 and 11% of the strains, respectively. Resistance to aminoglycosides was explained by the production of the three classes of aminoglycoside-modifying enzymes, with predominance of aminoglycoside-3'-phosphotransferase VI in 28% of the strains.

Haemophilus influenzae is a frequent cause of upper and lower respiratory tract infections (9). The new fluoroquinolones have been widely used as therapy for respiratory tract infections and have shown good activity against H. influenzae (3). Resistance to quinolones in H. influenzae is mainly due to chromosomal mutations in the gyrA and parC genes, which encode the A subunits of the DNA gyrase and topoisomerase IV, respectively (2, 7), similar to those found in other bacterial species (11, 12). Although ciprofloxacin-resistant H. influenzae strains have been isolated (2, 4), the development of quinolone resistance in H. influenzae from patients with chronic lung disease has been infrequently reported, and the mechanism of quinolone resistance acquisition has not been investigated (1). We studied the increase in the level of quinolone resistance of an H. influenzae clinical isolate during ofloxacin therapy in a patient with recurrent respiratory infections. The patient was a 59-year-old female with severe bronchiectasis and recurrent respiratory infections repeatedly submitted to multiple courses of antibiotics (frequently including amoxicillin plus clavulanic acid or ciprofloxacin). In May 1997, she was admitted to the hospital for an episode of bronchial infection, respiratory failure, and severe hypoxemia. She was on ventilatory support and intravenous therapy. Sputum culture for noncapsulated H. influenzae (isolate 1) with susceptibility to ciprofloxacin (MIC, 2 μg/ml), ofloxacin (MIC, 4 μg/ml), and nalidixic acid (MIC, ≥256 μg/ml) was positive. The patient was treated with ofloxacin (200 mg/12 h orally) for 4 days and subsequently with amoxicillin plus clavulanic acid and was discharged after compensation. Four months later, she attended the outpatient clinic and a control sputum culture was positive, with two colonial morphotypes of H. influenzae being detected. One (isolate 2) had the same resistance pattern as the one isolated in May (isolate 1), while the only difference with the other (isolate 3) was that the MIC of ciprofloxacin was 32 μg/ml (isolate 3). Finally, three months later, the patient was again admitted for respiratory deterioration, and two H. influenzae isolates with resistance patterns identical to those previously recovered were found in sputum. The epidemiological relationship of these isolates was investigated by pulsed-field gel electrophoresis (PFGE), showing that the three isolates belonged to the same clone (Fig. ​(Fig.1).1). FIG. 1 Molecular typing of H. influenzae strains by PFGE. Lanes 1, 2, and 10 are molecular weight markers. Lanes 3, 4, and 5 are isolates 1, 2, and 3 of this study, respectively. Lanes 6, 7, 8, and 9 are different strains of H. influenzae chosen randomly. MICs were determined by a commercial microdilution test (Emiza 2E; Sensititre Ltd., Imberhorne, United Kingdom) and for nalidixic acid, by the E-test method (AB Biodisk, Dalvagen, Sweden) performed according to the manufacturers’ instructions. In addition, for the strain with a MIC of ciprofloxacin higher than 2 μg/ml, the MIC was determined by the macrodilution broth method according to the National Committee for Clinical Laboratory Standards recommendations (10). PCR amplification was used to amplify the quinolone resistance-determining region (QRDR) of the gyrA and parC genes, and the nucleotide sequences of these amplicons were determined. The oligonucleotide primers used to amplify the QRDR of the gyrA gene from nucleotides 17 to 816 (800 bp) (from codon 6 to 272) were 5′ AATCATCTATCACCCCTGTC 3′ and 5′ TTTTGCTTTATTTACTTGGT 3′, whereas for the amplification of the QRDR of the parC gene from nucleotides 95 to 471 (377 bp) (from codon 32 to 157) the oligonucleotide primers used were 5′ ATCGTGCGTTGCCTTTTATC 3′ and 5′ TTCAGCCAAGGTTCCATCAA 3′. The PCR program and the DNA sequencing methodology used were as described in reference 11. Nucleotide sequencing of the 800- and 377-bp amplicons obtained from the QRDR of the gyrA and parC genes, respectively, revealed several mutations leading to the amino acid substitutions shown in Table ​Table1.1. TABLE 1 Mutations in the gyrA and parC genes of different isolates of H. influenzae The substitution at amino acid 84 (Ser-Leu) of the GyrA protein or its equivalent in other microorganisms is the most prevalent and has been found in H. influenzae (2, 7) and in other bacteria (11, 12). Georgiou et al. (7) found that strains with MICs of 2 μg/ml showed double mutations, one in the amino acid codon Asp-88 of the gyrA gene and another in the amino acid codon Ser-84 of the parC gene. Similarly, isolates 1 and 2 (MICs of ciprofloxacin of 2 μg/ml) of our study also present a double mutation, whereas the strain for which the MIC of ciprofloxacin was 32 μg/ml showed three main substitutions, two in the GyrA protein (Ser-84 to Leu and Asp-88 to Ala) and one in the ParC protein (Ser-84 to Arg). These results are also in agreement with those found by Georgiou et al. (7). The mutation in the amino acid codon Asp-83, which generated a substitution to Asn, is apparently neutral despite the change in the charge. Studying H. influenzae in sputum samples, Groeneveld et al. (8) found patients persistently infected with the same H. influenzae strain for up to 23 months. Similarly, the strain described herein persisted for at least 7 months despite the treatment with amoxicillin plus clavulanic acid. These results emphasize the potential risk of development of quinolone-resistant H. influenzae during fluoroquinolone therapy in patients with recurrent respiratory infections and confirm the role of substitutions in positions Ser-84 and Asp-88 of the GyrA protein and Ser-84 of the ParC protein in the acquisition of quinolone resistance in this microorganism.