208 results on '"TEST systems"'
Search Results
2. Usability evaluation of an intelligent aquaculture system.
- Author
-
Santi, Adinda Mutiara, Hsu, Yu-Ling, Dharmastiti, Rini, and Cho, Wei-Yu
- Subjects
- *
USER experience , *WATER quality , *AQUACULTURE , *TEST systems , *QUESTIONNAIRES - Abstract
The rapid development of technology has made it possible to improve aquaculture production through intelligent aquaculture. Intelligent aquaculture utilizes modern technologies to control aquaculture production remotely. The usability of intelligent aquaculture system is important as it helps users to fulfil their goals by using the system. This study aims to evaluate the usability of an intelligent aquaculture system by performance testing and post-test questionnaires which include System Usability Scale (SUS) and User Experience Questionnaire (UEQ). The result of this study shows the SUS score of the system is 52.25 which indicates improvements are needed to increase the usability of the system. The UEQ score shows that dependability, motivation, and novelty aspects of the system were perceived well by the users. On the other side, attractiveness, efficiency, and perspicuity aspect of the system must be improved to provide better user experience. To improve the usability of the system, it is recommended to 1) provide clearer button with an appropriate color, shape, and button name, and 2) display the name and icon of each water quality parameter on the parameter setting page. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
3. New approach to analysis machine learning base power quality in a test grid system.
- Author
-
Salam, S. M., Rashid, M. M., Ali, M. Y., and Yvette, S.
- Subjects
- *
RENEWABLE energy sources , *GRIDS (Cartography) , *ELECTRIC power distribution grids , *TEST systems , *DATA quality - Abstract
The integration of renewable energy sources with advanced power grid technologies has raised concerns over electricity quality. The use of machine learning techniques enables the assessment of power quality data analysis for the purposes of identifying and mitigating disturbances. This study presents a novel approach to power quality analysis in various power systems, using machine learning algorithms. The proposed methodology involves the processing and analysis of real-time power quality data obtained from various appliances. This data is extracted using a power data collection system equipped with sensors. Subsequently, machine learning techniques and algorithms are employed to identify and classify voltage and current harmonics, as well as transients. The system uses machine learning techniques to identify, classify, and predict power quality issues by using historical data. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
4. Generator coherency identification using support vector machine.
- Author
-
Isnaadh, Ahmed and Lukose, Jacqueline
- Subjects
- *
GENERATORS of groups , *SUPPORT vector machines , *MACHINE learning , *TEST systems , *ANGLES - Abstract
Generator coherency identification is an important step that needs to be taken in the case of a fault to enable durable islanding that could prevent a cascading blackout. Coherent generators are generally identified using the behaviour of rotor angles of the generators. Machine learning techniques have been implemented to tackle this problem. However, these techniques can be configured in different variations This research aims to implement a fine-tuned machine learning technique into the problem of generator coherency identification, to determine coherent generator groups with extreme accuracy. For this purpose, SVM was chosen as the machine learning technique to be implemented in this research, and was fine-tuned to yield the most accurate results for this problem. Data was collected in the form of rotor angles using a simulation of the IEEE 39-bus test power system in DIgSILENT PowerFactory. Based on the results obtained, SVM proved to be accurate in the primary performance metric RMSE, with a value of 0.077. Furthermore, in the secondary performance metric, R2, the value was extremely high at 0.98. Moreover, in various tests such as with reduced input data of 1000, 500, 250 and 50 out of the original 2000, and reduced computational power of 50% and 90%, SVM was accurate, in both RMSE and R2. A third performance metric, accuracy as a percentage, was also analysed, where SVM had an accuracy of 65.7%, which was compared to an RBFNN model in the literature that had a 95.03% accuracy. However, as other performance metrics show that SVM is accurate, it can be concluded that the fine-tuned SVM is applicable for the clustering of coherent generators. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
5. Generator coherency identification using artificial neural network.
- Author
-
Isnaadh, Ahmed and Lukose, Jacqueline
- Subjects
- *
ARTIFICIAL neural networks , *GENERATORS of groups , *MACHINE learning , *TEST systems , *ANGLES - Abstract
Generator coherency identification is an important step that needs to be taken in the case of a fault to enable durable islanding that could prevent a cascading blackout. Coherent generators are generally identified using the behaviour of rotor angles of the generators. Machine learning techniques have been implemented to tackle this problem. However, these techniques can be configured in different variations This research aims to implement a fine-tuned machine learning technique into the problem of generator coherency identification, to determine coherent generator groups with extreme accuracy. For this purpose, ANN was chosen as the machine learning technique to be implemented in this research and was fine-tuned to yield the most accurate results for this problem. Data was collected in the form of rotor angles using a simulation of the IEEE 39-bus test power system in DIgSILENT PowerFactory. Based on the results obtained, ANN proved to be moderately accurate in the primary performance metric RMSE, with a value of 0.345. However, in the secondary performance metric, R2, the value was high at 0.95. Moreover, in various tests such as with reduced input data of 1000, 500, 250 and 50 out of the original 2000, and reduced computational power of 50% and 90%, ANN was accurate, in both RMSE and R2. A third performance metric, accuracy as a percentage, was also analysed, where ANN had an accuracy of 89.9%, which was compared to an RBFNN model in the literature that had a 95.03% accuracy. This concludes that the fine-tuned ANN is applicable for the clustering of coherent generators. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
6. Generator coherency identification using a deep learning technique.
- Author
-
Isnaadh, A. and Lukose, J.
- Subjects
- *
GENERATORS of groups , *MACHINE learning , *TEST systems , *PROBLEM solving , *AUTHORSHIP , *DEEP learning - Abstract
Generator coherency identification is an important step that needs to be taken in the case of a fault to enable durable islanding that could prevent a cascading blackout. Coherent generators are generally identified using the behaviour of rotor angles of the generators. Deep learning has been an up-and-coming technique to solve complex problems with supreme accuracy. This research aims to implement deep learning into the problem of generator coherency identification, to determine coherent generator groups with extreme accuracy. For this purpose, LSTM was chosen as the deep learning technique to be implemented in this research and was fine-tuned to yield the most accurate results for this problem. Data was collected in the form of rotor angles using a simulation of the IEEE 39-bus test power system in DIgSILENT PowerFactory. Based on the results obtained, LSTM proved to be extremely accurate in the primary performance metric RMSE, with the lowest value of 0.03. However, in the secondary performance metric, R2, the value was lower at only around 0.81. However, in various tests such as with reduced input data of 1000, 500, 250 and 50 out of the original 2000, and reduced computational power of 50% and 90%, LSTM reigned accurate, in both RMSE and R2. A third performance metric, accuracy as a percentage, was also analysed, where LSTM had an accuracy of 95.7%, which was compared to an ANN model in the literature that had a 95.03% accuracy. This concludes that LSTM is applicable for the clustering of coherent generators. All in all, deep learning was able to yield more accurate results compared to traditionally used machine learning techniques such as ANN in literature. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
7. Realtime road damage detection using transfer learning with Nvidia Jetson Nano.
- Author
-
Setyawan, Sulfan Bagus, Arrosida, Hanum, Elhakim, Aulia, Shahab, Dahris, and Nugroho, Eryandhi Putro
- Subjects
- *
OBJECT recognition (Computer vision) , *TRAFFIC accidents , *SOLID state drives , *RESEARCH personnel , *TEST systems - Abstract
Based on cases of traffic accidents due to damaged roads that continue to occur every year. Efforts are needed to overcome these problems. Many researchers have made innovations related to road damage detection. Several methods are used to detect road damage, hovewer it need to implement in real time because road damage location needs to detect. In this paper, real time road damage detection is proposed. This system consist of camera, Nvidia Jetson Nano, GPS sensor. The camera as a road image capture which is then processed by the Nvidia Jetson Nano. The data is processed using the Tensorflow Object Detection framework with lite SSD as trained model of transfer learning. The results of this system are detection and classification of road damage. The detection results are classified into pothole and crack. This system was equipped by GPS sensor to detect road damage location. Based on the experimental results, the detection process should ideally be carried out at a speed of 20 km/h to 30 km/h which has an average accuracy of 80%. Based on testing the entire system at, Jl. Sumpil Basuki and Jl. serayu. The detection and mapping system can run well when with F1 score 88% [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
8. Augmented reality as a medium for the introduction of athletic equipments.
- Author
-
Juniawan, Fransiskus Panca, Zaliman, Iski, Vizta, Umar Faruq, Tou, Nurhaeka, Endraswari, Putri Mentari, and Adawiyah, Rodiatul
- Subjects
- *
ATHLETIC equipment , *AUGMENTED reality , *RELAY racing , *ACADEMIC motivation , *SPORTING goods , *TEST systems , *ATHLETICS - Abstract
Athletics is a combination of several types of sports which can be broadly grouped into running, throwing, jumping, and walking. There are many people that already know about this sport, however, not many students that understand about tools are used in this sport. One of the solution that we can used to introduce the equipments of athletics to beginner students is through Augmented Reality. This technology combines real objects and virtual objects based on a media marker, which runs interactively in real time. There is also integration between objects in three-dimensional form, namely virtual objects that are integrated in the real world. This research uses Game Engine Unity and Vuforia which can display 3-dimensional objects, and using Android as the basis of the system. In this paper, we present four equipments of athletic sports, likely Discuss Throw, Pole Vault, High Jump, and Relay Race. The aim of this research is to enhance students knowledge to recognize those athletic sports equipment, so that students motivation can be increased. The result of the research is an Augmented Reality-based athletics introduction application that has been tested well for the system performance using blackbox testing, and the marker performance using various conditions of its marker. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
9. Utilization of automatic test case generation methods for various system specifications.
- Author
-
Fujita, Yuto and Ueda, Kiyoshi
- Subjects
- *
REQUIREMENTS engineering , *COMMUNICATIONS software , *TEST systems , *INFRASTRUCTURE (Economics) , *NATURAL languages - Abstract
High-quality software tends to be expensive to develop and maintain because it is used in social infrastructures. In previous studies, a description format for requirement specifications was defined in a form that can be handled by machines, and customers were asked to describe their requirement specifications using this description format. However, a method for generating test cases from natural language documents has not been developed. We proposed a method to automatically generate test cases for system tests from requirement specifications. We applied this method to various system specifications and confirmed its usefulness. As a result, sufficient accuracy was obtained, confirming the usefulness of the proposed method. We also applied the proposed method to large-scale communication node software and clarified the specification-dependent characteristics of the proposed method. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
10. Access right to module and data attachment for company profile administrator module.
- Author
-
Tungadi, Eddy, Yusri, Iin Karmila, Serpian, Serpian, Irmawati, Irmawati, Olivya, Meylanie, and Utomo, Muhammad Nur Yasir
- Subjects
- *
CORPORATE websites , *SUPPLY & demand , *TEST systems - Abstract
Widan Technology (Widantech), which operates in the software house sector, has several clients with small to medium scale projects. A high demand project is the company profile website application. In Widantech company profile projects, role and module management are not included, so any changes to module and data access must be carried out by the Widantech programming team. The increasing number of clients requires an adaptive development model according to module additions and changes. However, lack of skills are the main obstacle in analyzing adaptive system models. Even though an adaptive system is needed to facilitate user managers to manage access rights to modules and data. This setting is very important because it relates to the security of client company information. Implementing a module and data access rights model is needed to ensure the adaptability of the company profile product being created. Setting access rights is one important component to accommodate these requirements. Module and data access rights management are implemented through the stages of collecting entities related to company profiles, observing several Widantech client company profile systems, implementing modules and data access rights, and system testing. The module and data access rights model can support the development of an adaptive company profile system for Widantech clients. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
11. A simple and accurate PV performance tester microcontroller based with data logger.
- Author
-
Usman, U., Syarifuddin, Syarifuddin, Ardiyansyah, Muhammad Riyan, Gunawan, Gunawan, Junaidi, Apri, and Sofyan, S.
- Subjects
- *
DATA loggers , *MICROCONTROLLERS , *MEASURING instruments , *SMART cards , *TEST systems - Abstract
This paper presents the design and implementation of a tool that allows the simultaneous measurement of Isc, Voc, irradiance, ambient temperature and PV panel temperature. The data collected can be exhibited on a screen or saved to a memory card through a data logger system. The implementation steps are as follows: designing, assembling, individually testing each sensor, and testing the overall system. The performance of this tool is tested by comparing its measurement results to those of conventional measuring instruments. This tool has been proven to measure Isc, Voc, irradiance, ambient temperature and photovoltaic temperature simultaneously. Its measurement results show an average deviation of less than 2% compared to conventional measuring instruments. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
12. Impact of volumetric air flow rate of hot side on the coefficient of peltier (COP) for thermoelectric air-conditioning system.
- Author
-
Abdulsattar, Mohammed Wajeeh, Mahdi, Mahmmoud Mustafa, and Ahmed, Majida Khalee L.
- Subjects
- *
AIR conditioning , *JOB performance , *EXERGY , *TEST systems , *SOLAR cycle - Abstract
Thermoelectric air conditioners with Solar photovoltaic are better and suitable for remote locations, particularly those with direct power source from the sun. In this study, a low-cost solar-thermoelectric air-conditioning duct has been developed and built for cooling and heating purposes in remote places where energy is still unavailable or insufficient. The thermoelectric peltier has low coefficient of performance. The goal of this research is to evaluate the performance of the thermoelectric air-conditioning to obtain optimum operation technique for the system and better COP values. The volume flow rate affects the dissipation of heat from the hot side of the thermoelectric cooler, which in turn influences the performance of the thermoelectric air conditioning system. In this work the performance of thermoelectric air-conditioning system tested for three volumetric flow rate value of (0.003, 0.005 and 0.007) m3/s. It was shown that the COP is higher in the case of 0.007 m3/s velocity with average value 0.39, which is 1.18 time greater than the 0.005 m3/s case and 1.33 time than the 0.003 m3/s. Using sufficient convection air on hot side reduce the temperature difference along the day and which leads to higher COP can be obtain which give better Performance. The exergy efficiency enhances in the case 0.007 m3/s by 41.97% from 0.005 m3/s case and 24.6% from the 0.003 m3/s case. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
13. Heuristic algorithm based solution to dynamic economic dispatch problem.
- Author
-
Pulluri, Harish, Preeti, Kumar, T. Anil, Vedik, B., and Mahender, K.
- Subjects
- *
KRILL , *TEST systems , *HEURISTIC algorithms , *PARTICLE swarm optimization - Abstract
The krill herd (KH) approach is proposed in this article for tackling the dynamic economic dispatch (DED) issue with valve point loadings (VPL). The purpose of resolving the DED problem is to find the optimum feasible combinations of output powers of all committed generators within a given time period while simultaneously meeting dynamic operational constraints and satisfy the total load. With the addition of valve-points in the generator cost characteristics, the DED issue becomes an inherently non-linear and non-convex issue and the DED is going to be more complicated when losses are taken into account. KH is a swarm-inspired algorithm based on krill individual herding behaviour. KH employs two global and local tactics and these works in parallel, making KH an efficient evolutionary technique. The suggested technique was tested on DED systems with 6 and 15 units, and the findings showed that the KH is effective at solving DED issues. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
14. Impact of congestion on market power of GENCOs in deregulated electricity market.
- Author
-
Mittal, Anupam and Singh, Kanwardeep
- Subjects
- *
ELECTRICITY markets , *MARKET power , *ENERGY industries , *ELECTRICAL load , *TEST systems - Abstract
This paper presents the quantitative analysis of market power of the Generation Companies (GENCOs) and the impact of congestion on it in the deregulated electricity market. The intensity of market power of the GENCOs has been obtained by making use of a novel Market Revenue Share (MRS) index. The MRS of a GENCO is defined as a revenue earned by it as a fraction of total market revenue of all the participating GENCOs in the deregulated electricity market during any specific time span. The MRS of GENCOs has been obtained by solving an optimal power flow problem for maximizing social welfare function subject to the non-linear operational and congestion constraints. From the present electricity market real studies, it is noticed that under congested system conditions, some costly generators can get chance to exercise market power in the deregulated environment. The effectiveness of the proposed methodology has been demonstrated on IEEE-30 bus test system. It has been observed that due to congestion, there is an increase in the value of MRS Index of some costly generators which implies that GENCOS's ability to exercise market power increases with congestion in the deregulated electricity market. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
15. Implementation of HEBMO in solving convex economic dispatch problems.
- Author
-
Ismail, Nor Laili, Musirin, Ismail, Dahlan, Nofri Yenita, Mansor, Mohd Helmi, and Senthilkumar, A. V.
- Subjects
- *
ROBUST optimization , *MATHEMATICAL optimization , *POWER transmission , *TEST systems , *TEST reliability - Abstract
Minimization of the cost of generation for any utilities is crucial to ensure the utilities will be able to maintain continuous supply and their survivability. Non-optimal amount of power generated by all generating stations in a country will possibly lead to monetary loss and ineffective operation of the power system. Thus, a robust and reliable optimization technique is the prerequisite to ensuring the lowest cost of generation can be achieved. This paper proposes a hybridized optimization technique that integrates the element of evolutionary programming (EP) into the barnacle mating optimizer (BMO), termed Hybrid Evolutionary Programming-Barnacles Mating Optimization (HEBMO). HEBMO is utilized to address the convex economic dispatch in a power transmission system. Its implementation on the IEEE 30-Bus Reliability Test System (RTS) in addressing the convex ED is remarkable, through the comparison with the traditional EP and BMO. The cost of generations in chosen cases such as base case conditions, stress conditions due to real power, and reactive power increments revealed the superiority of the proposed HEBMO over EP and BMO. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
16. Analysis diagnostic of inguinal hernia disease using method certainty factor.
- Author
-
Tambunan, F. R., Harumy, T. H. F., and Hardi, S. M.
- Subjects
- *
INGUINAL hernia , *INDUSTRIAL workers , *CERTAINTY , *HERNIA , *TEST systems , *GROIN , *EXPERT systems - Abstract
Health is something that is very valuable and expensive for all humans. Currently, many people are not aware of the symptoms of an inguinal hernia which is a disease that most people do not understand. Hernia is a disease caused by the descent of the intestine under the lining of the abdomen into the testicles. This disease often occurs in heavy workers such as coolies, factory workers, and other heavy work. For that we need a mobile-based application that can diagnose hernia disease early and avoid worsening of the disease. One of the methods in the expert system is the method of certainty factor. After performing 15 times of expert testing using this system, the mean score of diagnostic evidence was 84% with an accuracy rate of 86.6%. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
17. Computational-experimental method for designing brake system for a racing car, taking into account the controls.
- Author
-
Eremin, Valentin, Bolshikh, Alexander, and Shkurin, Maxim
- Subjects
- *
BRAKE systems , *INTERNAL auditing , *STRUCTURAL optimization , *TEST systems - Abstract
The performance of the brake system significantly affects the safety, handling, and dynamics of the car. This paper aims to formulate an approach and develop a detailed methodology for designing a brake system for a racing Formula Student class race car, considering the requirements of the competition regulations. To accomplish this task, design calculations were performed to determine the pressure required to stop the car and calculations confirming the operability of the developed parts. The analysis is carried out in three stages. The first step is to determine the pressure necessary to ensure the wheels are locked. The second stage selects the system parameters and structural elements that can provide the necessary pressure. The third stage is the topological optimization of structural elements, considering the conditions of the regulation and the preservation of strength characteristics. To verify the calculations of the brake system with a balancing rod as a pressure distribution mechanism, field tests were performed. During field tests of the brake system, the design of the pedal assembly was not destroyed. As a result of the work done, a methodology for designing a workable brake system and its control body was developed. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
18. Estimation of IR sensors information losses caused by distortion.
- Author
-
Larkin, Eugene, Akimenko, Tatiana, Bogomolov, Alexey, and Privalov, Aleksandr
- Subjects
- *
DETECTORS , *THERMOGRAPHY , *METHODS engineering , *PINCUSHIONS , *TEST systems - Abstract
The distortion of scene image by the pair «infrared lens/thermo-electronic converter» is investigated. Under the assumption that on the cold scene point heat source is placed randomly in such a way, that probabilities of its appearance at any direction are independent and unformed, the expression for information capacity is obtained. It is shown, that distortion decreases amount of information, when scene signal is transformed into its thermal image. Information losses are linked with changing of cells inverse projection on the observed scene space. Formulae for area of inverse cell projections and for information losses calculation in the IR system with pincushion and barrel type distortions are obtained. The structure of the testing system has been developed, the main element of which are eight IR LEDs, placed along the edges of the scene. The uncomplicated engineering method of IR sensor quality evaluation is proposed. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
19. Risk management and monitoring in accredited analytical testing laboratories.
- Author
-
Erkaboyev, Abrorjon and Masharipov, Shodlik
- Subjects
- *
TESTING laboratories , *TEST systems - Abstract
In the edition of ISO/IEC 17025:2017, the topic of risk management in the management system of testing laboratories is becoming increasingly relevant. This edition of the standard obliges each testing laboratory to include in its management system a documented procedure that describes the actions to manage risks and opportunities. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
20. Construction and testing of a hydraulic flow meter in a hydraulic system.
- Author
-
Pushkarov, Martin, Simova, Iskra, and Velichkova, Rositsa
- Subjects
- *
TEST design , *HYDRAULIC machinery , *FLOW meters , *HYDRAULIC turbines , *FLOW measurement , *TEST systems , *MANOMETERS - Abstract
The testing of different types of hydraulic elements and systems is directly related to the ability to measure several basic parameters in hydraulics, such as pressure and flow rate. Pressure can be measured relatively easily by attaching control points to measure pressure in the system by means of manometers. Measuring pressure in hydraulic systems is much easier and much cheaper than measuring flow rate in a given system. Apart from the expensive turbine hydraulic flow meters which are most commonly used in practice, the present work offers an alternative concept for flow rate measurements within the range of 0 to 25 l/min. The elements used for the system build up are given and explained. The method and the system test results are presented and analyzed. It is also made a comparison between three experiments that was made. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
21. Performance testing of virtualization systems on the assembly of different guest prefabricated systems.
- Author
-
Sergeev, Anatoliy, Rezedinova, Evgenia, and Khakhina, Anna
- Subjects
- *
UBUNTU (Operating system) , *TEST systems , *HYPERVISOR (Computer software) - Abstract
The methodology for testing the performance of virtualization systems when using different guest operating systems is discussed in this article. A cross-platform program with 14 tests was developed for performance testing. Three virtualization systems were tested: Oracle Virtual Box, VMware Workstation, and Microsoft Hyper-V. The program was tested on two different guest operating systems: Windows and Ubuntu. Testing has revealed that when the Ubuntu guest operating system is used, the performance of the virtualization systems under consideration is roughly the same. In terms of test execution speed, the VMware Workstation hypervisor outperforms other virtualization systems when running on Windows. In general, the runtime of tests on Ubuntu was significantly shorter than on Windows across all virtualization systems. The test execution time on the host operating system Windows and the guest operating system Windows were compared. Test execution time on the host is roughly twice that of the guest operating system. If the test program performs a large number of arithmetic operations, the performance hit is reduced. When the test program works intensively with memory, performance suffers significantly. This is true for all virtualization systems under consideration. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
22. Esophageal cancer segmentation based on FCM algorithm.
- Author
-
Al-Mayahi, Noor N. and Mohammed, Faisel G.
- Subjects
- *
ESOPHAGEAL cancer , *ALGORITHMS , *TEST systems , *EXPERIMENTAL design - Abstract
The research aims to design a system that cuts the cancerous area in the esophageal tissue that is often detected in late stages, using the FCM algorithm. This algorithm has achieved impressive results in determining the tumour area, which is; (sensitivity of 0.98, Accuracy of 0.95, and specificity of 0.92). The proposed system was tested on 200 images, which were downloaded from the Kaggle website. This research showed that is not possible to improve the images before using them in segmentation, due to the type of noise experienced by the data set is not uniform, because the images uploaded to the mentioned site are in JPG format (compressed images), which are losing many their features. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
23. State transition diagrams for business process flows testing.
- Author
-
Kurniawan, Luthfi Anggy and Putro, Hanson Prihantoro
- Subjects
- *
COMPUTER software testing , *INFORMATION storage & retrieval systems , *UNIFIED modeling language , *TEST systems - Abstract
Software testing consists of reviewing software to determine whether it is functioning as expected or not. There are many testing techniques available. A tester should be able to choose the appropriate technique for each case at hand. Sometimes, testers find it difficult to test software, especially dynamic ones that describe the flow of an organization's business processes. This study focuses on testing the process flow in an information system and applying state transition diagram to test the transition between states. This research aims to determine how to properly test the business process flow of an information system using the state transition diagram and ensure the suitability of the business process flow. This stage of research begins with creating a state transition diagram based on the business process flow. Following the creation of the state transition diagram, the system will be tested. The final stage is to make changes based on the test results. The study concludes that the system, which was initially unable to handle business processes properly, has now succeeded in running precisely by the existing business processes. Tests and improvements have resulted in a system that is correct in terms of business process flow. Since state transition diagrams have proved successful in testing information systems, new guidelines for testing the transitions between states have been developed. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
24. A flight control system in VTOL plane for waypoint tracking using LQR method.
- Author
-
Jayadi, Akhmad, Sembiring, Jaka Persada, Utami, Novia, and Adhinata, Faisal Dharma
- Subjects
- *
FLIGHT control systems , *VERTICALLY rising aircraft , *TEST systems - Abstract
The fixed-wing UAV vehicle can fly glide and has long-range roaming capability. On the other hand, rotary-wing UAVs can fly (hover) but cannot fly during fixed-wing. Fixed-wing rides can experience deviations when turning at large turning angles when doing waypoint missions. Deviations that occur due to maneuver limitations can be overcome by combining fixed-wing UAV and rotary-wing UAV types. The LQR control stabilizes both vehicle modes by processing multiple inputs for use on multiple outputs. System testing is carried out on the path tracking to find out the system's functioning, while the results of tests that have been carried out for three waypoint points were obtained, for the WP1 point to the WP2 point, and the deviation occurred by 3 meters. Then for the movement from the WP2 point to the WP3 point, the deviation is 2.5 meters. The ride time from the start point to the finish point is 30 seconds. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
25. Structural and algorithmic synthesis of intelligent commercial inspection of wagons.
- Author
-
Nutovich, V. E.
- Subjects
- *
RADIO control , *TEMPERATURE control , *RADIO frequency , *TEST systems , *DIGITAL technology , *WAGONS - Abstract
The article is devoted to the description of methods and algorithms for ensuring the reliability of the transportation process for goods and own empty wagons by rail in terms of intelligent commercial inspection of trains and wagons using digital technologies, and primarily neural networks. It contains description of a formal recurrent model, a task decomposition tree built according to an object-oriented and method-oriented principle, a description of autodiagnostic methods: weighing, zone control, laser scanning, neural network photodiagnostics, temperature control and radio frequency control. The architecture of built system and test results are also given. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
26. Audio reading system for blind persons, testing and evaluation.
- Author
-
Mohammed, Mohammed Ali, Hussein, Karim Q., and Al-Hassani, Mustafa Dhiaa
- Subjects
- *
SOUND systems , *CLOUD computing , *COMPUTER systems , *TEST systems - Abstract
According to the World Health Organization, there are approximately 285 million blind people around the world. Those people faced challenges in their life, especially when reading a book. This paper is aims to test and evaluation the audio reading system (which is use to help the blind person to read the book) with new dataset which consist of 161 image, 8 font size, mono and color image, and different views. The system is test and discussion from the aspects: accurate, Font size and type, and more reliable. According to the results (on our dataset (image type, 161 images)), the characteristics of the system is efficient and accurate real time system with cloud computing and the accuracy increase while the font size increase, whereas the accuracy of font size 30 is 100% and of 12 is 80%. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
27. A study of a clamped circular thin plate deformation under internal air pressure by a designed testing mechanism system.
- Author
-
Abdulrida, Yasameen H., Hassoun, Enaam O., and Reja, Ahmed H.
- Subjects
- *
TEST systems , *HYDROSTATIC pressure , *NUMERICAL calculations , *DEFORMATIONS (Mechanics) , *AIR pressure , *SOIL testing - Abstract
Circular thin plates are using in a wide range of engineering applications like roof and floor of building, deck slab of bridge, water tanks, turbine disks etc. Despite that, few experimental studies have been conducted to examine the behavior of a thin circular plate under uniformly distributed loads. The present study investigates the failure behavior of uniformly loaded clamped circular thin plates experimentally. The tests are conducting with a pressure system specially built for this work. It was developed to measure the maximum deflection of the circular plate under uniform internal hydrostatic pressure. Numerical and experimental results were compared and showed a good correlation for all plates investigated. The failure mechanism is discussed based on the results of numerical calculations and the results of a scanning electronic microscope (SEM). The results observed in this study show a good understanding of the problems related to different internal pressure values. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
28. Implementation of Hajj and Umrah Q&A system using case-based reasoning (CBR).
- Author
-
Bachtiar, Farid Sanitas, Basuki, Setio, and Wicaksono, Galih Wasis
- Subjects
- *
CASE-based reasoning , *PILGRIMAGE to Mecca , *QUESTION answering systems , *LIFE cycles (Biology) , *TEST systems - Abstract
Hajj and umrah guidance is needed to help pilgrims increase their knowledge about the rituals. But sometimes after following the hajj and umrah guidance, many of them still had many questions that need an expert to answer, but an expert sometimes not always be to help them. A question and answering system for Hajj and Umrah was developed to help pilgrims in answering their questions using the Case-Based Reasoning (CBR) method. This research only implements the Retrieve and Reuse process from the all CBR life cycle to answer the question. We tested the system in 2 scenarios. Firstly, using K-Fold Cross Validation with the value of K is four and used 104 data divided into 26 test data and 78 case base data. Second, using questions from outside the case base with a total of 26 data. Mean Reciprocal Rank was used to measure all of the scenarios. The first scenario shows the Mean Reciprocal Rank value is 0.97, and the second test, shows the value is 0.16. It offers that the system can give a relevant answer if the question is provided from the case base, and if not so, the system provides the un-relevant solution. The system needs to be improved by adding the Revise and Retain process and question rules [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
29. Comparative analysis of reliability assessment indices for smart distribution systems integrated with solar PV distributed energy resource.
- Author
-
Karamta, Meera and Joshua, Matsiko
- Subjects
- *
POWER resources , *SOLAR system , *TEST systems , *DISTRIBUTED power generation , *SOLAR technology , *ELECTRIC power distribution grids - Abstract
Over a period, the traditional power grid has met several challenges such as widespread blackouts and growing demand, among others, which have affected reliability especially in the distribution network. Reliability is today pertinent to both the consumer and the utility because of the attached economic losses. Various protection systems and devices have been deployed to improve reliability in the grid but many researchers are studying reliability improvement in the context of Smart Grid (SG) implementation. Further reliability improvement has been envisaged with integration of distributed energy resources (DER). This study assesses the reliability gains with integration of a distributed generation source typically a solar photovoltaic (PV) to an IEEE 34 node standard distribution test system. ETAP software is used for the reliability evaluation of the test system and the results are compared with a base case where DER is not connected in the test system. Reliability indices are calculated. The simulation results indicate significant improvements in most reliability indices with integration of DERs. A load flow study is conducted to understand the reasons for improved reliability. The voltage profile of the system is found to improve with DER integration. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
30. Hindi title generation using rule-based approach.
- Author
-
Sethi, Nandini, Dev, Amita, and Bansal, Poonam
- Subjects
- *
NATURAL language processing , *DOMINANT language , *UNIVERSAL language , *ORAL communication , *TEST systems - Abstract
Hindi is the third largest spoken language in the world and first in India. Addressing research and applications in natural language processing, Hindi, the dominant language in India, is still in its infancy. Hindi title generation is a crucial process that should be taken into consideration for any given story or document. This paper describes the automatic generation of title for a given text in Hindi. We have designed a system which generates the title relevant to the text or story and preserves the central theme. In the proposed system four algorithm are designed after performing the analysis of various text and stories of Hindi. The title will be created by the first algorithm using the utmost priority nouns. Second algorithm will generate the title as the combination of adjective and noun. Third algorithm is based on the proverbs present in the text and the last algorithm is based on the set of keywords present in the text or story. This system first tokenizes the text and then apply the tagging for identifying the nouns, pronouns, adverbs, adjectives etc., and then by applying different designed algorithms suggests the title of the text or story given by the user. Using 10 stories through a well-known Hindi text collection, the proposed approach is tested. Eight of the ten titles it produces are accurate. Second, a group of users, including Hindi teachers and academics, test the system. Their reviews and opinions indicate that the proposed strategy produces findings that are pertinent and is effective. The size of the story affects how well the system works. The most pertinent titles can then be chosen. This approach can be used by Hindi students who are still learning the language, as well as by novelists, newspapers, and magazines to produce titles at random for them. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
31. Optimal scheduling of hybrid power system having thermal generators with cubic fuel cost function using bio-inspired social spider algorithm.
- Author
-
Adhvaryyu, Shreya, Biswas, Buddhadev, and Adhvaryyu, P. K.
- Subjects
- *
COST functions , *HYBRID power systems , *FUEL costs , *TEST systems , *INDUSTRIAL costs , *SOLAR energy - Abstract
Scheduling of generators of hybrid power system for dispatching a specific demand economically is the objective of this paper. Cubic fuel cost function of the conventional generators has been considered in this work. The technique used to optimize the scheduling of generators in cost effective way is bio-inspired social spider algorithm. Conventional generators with cubic fuel cost function have been utilized in first two test systems to show the effectiveness of the used method. Results have been compared with already published work to show that the method could improve the outcome effectively. Test systems 3 and 4 constituted with conventional generators with cubic fuel cost function integrated with PV modules have been used to cater to the demand allocating the generators effectively so as to make the cost of production economic. Test systems 5 and 6 constituted with combined heat and power, solar power, wind mills and conventional generators with cubic fuel cost function have been used to establish the efficacy of the algorithm. Test systems 7 and 8 have been used where cogeneration units have been integrated with a large number of conventional generators with cubic fuel cost function. Moreover, Test systems 3 to 8 designed by the authors are also simulated using quadratic fuel cost function. Experimentally it is found that production cost obtained using quadratic cost function is optimistic than that obtained using more realistic cubic fuel cost function. These observations show that the algorithm is capable to solve such optimization task of different combinations of hybrid power system. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
32. Design and implementation of 8 - bit multiplier using carry adder by comparing with carry look ahead.
- Author
-
Tirumala Saiteja, Peeramsetty and Femila Roseline, J.
- Subjects
- *
OPEN source software , *TEST systems - Abstract
The main objective of this research is to design a novel wallace multiplier using CSA (Carry Select Adder) to obtain the less propagation delay time (in ns) when compared to wallace multiplier using CLA (Carry Look Ahead Adder). With a sample size of ten, the proposed system uses CSA as group 1 to test a novel wallace multiplier, while the existing system uses CLA as group 2 to test a system with pre-test power of 80%. The wallace multiplier was designed in the open source software Model Sim. A waveform is displayed at output with propagation delay time and some binary values after designing the multiplier in the Model Sim software. The novel wallace multiplier using CSA takes very less propagation delay of 700 ns whereas the wallace multiplier using CLA takes the 800 ns of propagation delay which is very high. The significance value obtained was 0.0121 (p<0.05). From the simulated results novel wallace multiplier using CSA shows less propagation delay, less power consumption and less size when compared to wallace multiplier using CLA. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
33. Intelligent module design for smart refrigerator.
- Author
-
Jain, Pulkit and Chawla, Paras
- Subjects
- *
LITERATURE reviews , *REFRIGERATORS , *INTERNET of things , *MACHINE learning , *TEST systems - Abstract
The main idea of this research paper is to avoid food wastage by making an ordinary refrigerator smart cost-effectively instead of designing a brand new refrigerator which is a very costly affair. This paper deals with the complete design of an intelligent module based on Machine Learning (ML) and Internet of Things (IoT) which can be fitted to any refrigerator with enough features thereby making it smart and modular. The module comprises an adjustable frame containing the processing unit at the top side, a display screen in front, and a weight measurement tray with camera sensing attached on one side of the refrigerator respectively. This design helps to remove the mess of wires inside the fridge which is a common issue with other smart refrigerators as evident from the literature review. At the end, results of system testing using ImageNet dataset are shown where an accuracy of 85% is achieved in item classification. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
34. Improving usability of Telkom university open library website using user-centered design method.
- Author
-
Safira, Diva Jihan, Syahrina, Alvi, and Musnansyah, Ahmad
- Subjects
- *
ACADEMIC libraries , *WEBSITE usability , *TEST systems , *TEST design - Abstract
Telkom University Open Library's official website is an Open Library service belonging to one of the universities in Indonesia, Telkom University. Usability of a website can be a benchmark for assessing how well and accessible it is for users. As users of the Telkom University Open Library website, students want convenience and a good experience while using the website. A variety of survey methods are available to test and assess the usability of websites. This study conducted tests using the System Usability Scale (SUS). The initial SUS result showed that Telkom University Open Library website has a poor score, therefore improvements are needed to increase this value. User-Centered Design is a design method that can be used to overcome the website's usability since it is based on the needs and interests of users. The result of this research is a prototype of Telkom University Open Library website for student's module. The prototype with the proposed design was tested using the System Usability Scale (SUS). The test resulted in a SUS score of 84.75. The score obtained is in the "acceptable" category and indicates that the application design tested to all test participants already has an improved usability score. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
35. Design of the control system for the wheelchair's test stand.
- Author
-
Rybarczyk, Dominik
- Subjects
- *
ELECTRIC wheelchairs , *WHEELCHAIRS , *TORQUEMETERS , *REAL-time control , *TEST systems , *DATA recorders & recording - Abstract
In the article, the construction of the control system of the test stand intended for testing wheelchairs is described. The device allows for controlling drive systems (asynchronous motors) through inverters, as well as reading data from torque meters and force sensors in order to determine the centre of gravity of the standing wheelchair. It was built based on a PLC controller with input-output modules. The whole works under the control of the real-time operating system, which enables synchronous recording of individual data with a constant time determinism. Selected measurement results are included in the experimental part. The data was also displayed on a specially prepared visualization. An Ethernet interface was used for communication. In the experimental part, selected measurement results are presented in the form of graphs. These results can be used to verify simulation models, as well as to obtain information about the biomechanics of the movement of people with reduced mobility, who use wheelchairs on a daily basis. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
36. Rolling resistance measurements with the minimisation of inertia influence.
- Author
-
Kukla, Mateusz and Daniel, Mikołajczyk
- Subjects
- *
ROLLING friction , *MOTION analysis , *MUSCLE strength , *TEST systems , *WHEELCHAIRS , *RESEARCH methodology - Abstract
Rolling resistance is the most basic component of force counteracting movement of a vehicle equipped with a wheel and axle. This value is particularly important in the case of systems that are powered by muscle effort, such as for example a wheelchair. Modelling and analysis of the motion of such a vehicle requires knowledge of rolling resistance. There are a number of ways to measure the values essential for calculation of rolling friction, although individual methods have specific advantages and disadvantages. Therefore, a research method was developed that allows to determine the value of resistance to motion in real conditions - without the need to disassemble the wheels from the vehicle. The aim of the work was to determine the resistance to movement of wheels used in, inter alia, wheelchairs and to evaluate the research method developed for this end. The article contains a description of the research methodology and the results of the determined rolling resistance coefficient values. In relation to the previously developed research methods, an improvement was introduced, which allowed to reduce the impact of the inertia of the moving system on the test results. This is an important issue, especially for wheels with low load capacity, which are unable to withstand a considerable value of vertical force. The results presented in the study are a continuation of the research related to the analysis of wheelchair's rolling resistance. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
37. Android-based mobile academic information using push notification for supporting the student's academic activities: A case study.
- Author
-
Sukamto, Rosa Ariani, Piantari, Erna, and Van Kevin, Lundy
- Subjects
- *
ARCHITECTURAL design , *LIKERT scale , *TEST systems , *INFORMATION storage & retrieval systems , *COLLEGE students - Abstract
This research aimed to build a prototype model for android-based mobile academic information using push notification for supporting the student's academic activities. The prototype model purpose is to build mechanism of information spread from university to its students rapidly. Therefore, the students can receive the information as soon as possible as long as they access their smartphone. The prototype model is using prototyping method for developing the mock-up and several processes namely application architecture design, push service configuration, prototype implementation, and testing. This prototype model was tested using the system usability scale (SUS) Brooke version and a questionnaire with Likert scale. The testing results reveal that this prototype model is feasible and 87.88% of the respondents definitely agree that this mechanism can potentially help their academic activities. This result was influenced with the limitation of respondents and the difficulty of installed the client side application manually. The prototype model can be the model for university information academic system for delivering the information to their students effectively. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
38. Analysis of permeability changes of the Astrakhanskoye field rocks while implementing the method of directional unloading of the reservoir based on X-ray computed tomography.
- Author
-
Khimulia, V. and Barkov, S.
- Subjects
- *
COMPUTED tomography , *LOADING & unloading , *ROCK properties , *ROCK permeability , *X-rays , *TEST systems - Abstract
This article describes the results of physical modeling of deformation and filtration processes in the rocks of the Astrakhanskoye gas-condensate field when implementing the method of increasing the permeability of low-permeability rocks - the directional unloading method. The experiments were carried out on the unique Triaxial Independent Load Test System (TILTS) of the Institute for Problems in Mechanics of the Russian Academy of Sciences (IPMech RAS). A digital model of the internal structure of the rock by X-ray computed tomography methods was obtained. A digital analysis of changes in the filtration properties of rocks based on the experimental data of the micro CT study is carried out. It is shown that the directional unloading method can be successfully applied to low-permeability rocks of the Astrakhanskoye field. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
39. Smart trash bin for children using Raspberry Pi.
- Author
-
Hidayat, H. and Hamdani, D.
- Subjects
- *
RASPBERRY Pi , *INFORMATION technology , *WASTE management , *BINS , *TEST systems , *ORGANIC wastes - Abstract
Increasing the habit of disposing of garbage properly in order to create a clean and healthy environment is an important thing that we need to be conducted. This study aims at producing a prototype smart trash bin that can increase children's awareness of a healthy and clean environment, especially in their school. The method used in this research is an experimental method, starting with gathering information and materials, designing the system implementation, and testing the system. The components used in this design are the Raspberry Pi which the main control, an ultrasonic ping sensor to detect garbage into the bin, and an infrared sensor to detect the capacity of the waste in the bin. The results showed that a smart trash bin that controls the condition of its box could give warnings when the trash is full and provide interesting education for children about the importance of maintaining a clean and healthy environment. It is hoped that the results of this research will become the application of information technology in encouraging children's awareness to create a clean and healthy environment. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
40. Experimental receiver setup of a high performance molten salt test receiver system.
- Author
-
Frantz, Cathy, Ebert, Miriam, Schlögl-Knothe, Bärbel, Binder, Matthias, and Schuhbauer, Christian
- Subjects
- *
FUSED salts , *TEST systems , *THERMAL efficiency - Abstract
In the High Performance Molten Salt II Project a closed loop salt cycle which uses conventional Solar Salt (60% NaNO3, 40% KNO3) at top salt temperatures reaching up to 600°C will be demonstrated. This salt cycle features all functionalities a commercial cycle would expose. One of the goals is to measure the thermal efficiency of the receiver and to validate the simulation models, which were used during the design phase of the salt cycle and receiver. This paper details the selection process and design of the 1 MWth receiver and its measurement equipment, which will be integrated into the test infrastructure at the Multi Focus Tower in Jülich, Germany. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
41. Modeling of raw data pattern classification of wind tunnel test data in ILST.
- Author
-
Purwadi, Pane, Ivransa Zuhdi, Syafaruddin, and Ahmad, Andani
- Subjects
- *
WIND tunnel testing , *DATA structures , *K-nearest neighbor classification , *ATTITUDE testing , *TEST systems - Abstract
Wind tunnel testing plays an important role in determining the design of infrastructure and transportation media whose performance is influenced by aerodynamic effects. In a typical wind tunnel test, a set of raw data is generally produced that represents the results sensed by the measuring instrumentation. This data set can be patterned for various purposes, such as classifying wind tunnel test types and checking the readiness level of wind tunnel test systems. This research activity seeks to model the pattern of raw data from the Indonesian Low Speed Tunnel wind tunnel test, by compiling a data structure consisting of four raw data clusters, namely pressure, temperature, force/moment, and attitude of the test model, conditioning the data structure so that it forms a 16 different raw data patterns, and perform numerical tests to verify and validate the classification of raw data patterns using the K-Nearest Neighbor method. The results show that the developed model is capable of classifying according to the expected 16 patterns and can be projected to support decision making in examining the level of readiness of the wind tunnel test system. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
42. Development of polymerase chain reaction for identification of phytopathogenic fungi Fusarium oxysporum.
- Author
-
Feoktistova, Natalya, Suldina, Ekaterina, Lomakin, Artem, Mastilenko, Andrey, and Bogdanov, Ilgizar
- Subjects
- *
IDENTIFICATION of fungi , *FUSARIUM oxysporum , *POLYMERASE chain reaction , *AGRICULTURE , *PHYTOPATHOGENIC fungi , *TEST systems , *CUCUMBERS - Abstract
The article presents the results of research on the development of test system by the method of polymerase chain reaction with real-time detection for the identification of phytopathogenic fungi Fusarium oxysporum. These fungi are cosmopolitan for many types of agricultural (wheat, soybeans, peas, alfalfa) and fruit and vegetable crops (tomatoes, cucumbers) in various geographical areas. The authors selected for the work a section of genome that encodes endopolygalacturonase-Fusarium oxysporum isolate TD586 (pg1) gene. Specific primers were selected (f) 5'-3' GGGATCTGGGAGTACGGTTGC and (r) 3'-5' CCTACAGGCAGCGTTGAAGC and a protocol for setting up the reaction has been developed, including preliminary denaturation – 95 0C-5 minutes (1 cycle); denaturation-95 0C-5 sec, annealing-60 0C-15 sec (50 cycles). Studying the sensitivity of the test system, the authors selected a probe (GCTATTGCGGCTTTGCTGC), fluorescent dye-ROX, quencher-BHQ-2. The scientific development was tested on 28 field strains and 1 reference strains (Fusarium oxysporum VKM No. F-140) which was tested on 28 field strains and 1 reference strains with a 15 positive result. The study was carried out according to the thematic plan-task of the Ministry of agriculture of the Russian Federation, the registration number of the INIS RTD 122030200367-8. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
43. Methodology of development and approbation of a test system for identification of Penicillium expansum based on polymerase chain reaction (real-time).
- Author
-
Feoktistova, Natalya, Suldina, Ekaterina, Lomakin, Artem, Mastilenko, Andrey, and Bogdanov, Ilgizar
- Subjects
- *
APPLE blue mold , *POLYMERASE chain reaction , *TEST systems , *SYSTEM identification , *PHYTOPATHOGENIC fungi , *IDENTIFICATION of fungi , *EGGPLANT , *PEACH - Abstract
The article shows the results of research on the development of a test system by polymerase chain reaction with «real-time» detection for the identification of phytopathogenic fungi Penicillium expansum, which cause apple disease – blue mold. It can infect a wide range of hosts, including pears, strawberries, tomatoes, corn and rice. P. expansum produces the carcinogenic metabolite patulin, which levels in food are regulated by the governments of many countries. The authors selected a section of genome, the gene patF Penicillium expansum strain NRRL 35695. It is a cluster of genes that mediates the biosynthesis of patulin, a derivative of tetraquetide mycotoxin acetate. The test system for Penicillium expansum includes specific primers: upstream primer (f) 5'-3' GTGGGTCCGCAGGCCTTTAT, downstream primer (r) 3'-5' GCCCATTCTCCATCGACCAC. Reaction setting protocol: pre-denaturation – 95 0C-5 minutes (1 cycle); denaturation-95 0C-5 sec, annealing-60 0C-15 sec (50 cycles). Probe: GCCCATTCTCCATCGACCAC, fluorescent dye – ROX, quencher-BHQ2. The optimal concentration of primers equal to 7 pM of each primer per reaction has been established. The optimal concentration of the probe is 0.4 pM. The approbation of the scientific development was carried out on 29 strains of Penicillium spp. isolated from samples of apples, eggplants, onions, strawberries, grapes, peaches with signs of spoilage, and soil samples from various natural geographical zones of the Russian Federation, and presumably typed as Penicillium expansum by dichotomous keys. It was established that only 15 belong to this species on the basis of conducted studies. The study was carried out according to the thematic plan-task of the Ministry of agriculture of the Russian Federation, the registration number of the INIS RTD 122030200367-8. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
44. An efficient SMS classification system for disaster response.
- Author
-
Reddy, K. Srinivasa, Reddy, M. Indrasena, Rakesh, B., and Ram, K. Bhargav
- Subjects
- *
FIRE departments , *POLICE , *SPAM email , *CLASSIFICATION , *TEXT messages , *NATURAL languages , *TEST systems - Abstract
Rescue agencies like fire departments, police departments, and health departments need to identify the important and emergency messages to provide better services to the people. In generally those departments will receive a lot of messages which consist of several categories like spam, invalid etc. These departments need a system that can categorize the received messages into categories like important, invalid and spam. This paper proposes a methodology using a naïve Bayes algorithm integrated with a natural language toolkit. The proposed methodology classifies the received messages into alter1, alert2, alert3, invalid and spam messages. Depending upon the category of messages the rescue agencies will take necessary action. The proposed methodology helps the rescue agencies in saving time by taking action against important messages and ignoring unimportant messages. The system is trained through the preprocessed data. This will help the system in categorizing the test data more accurately. The accuracy of the classification is compared with the existing methodologies. The proposed methodology showed 97% accuracy in the classification of the messages into the different categories. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
45. Home automation, monitoring and control system using Arduino IoT cloud server.
- Author
-
Kumar, Rahul and Verma, Pushpendra R.
- Subjects
- *
HOME automation , *INTERNET of things , *ACCESS control , *TEST systems , *HOUSEHOLD appliances - Abstract
Home automation has now become an integral and prominent part of society whether that may be for a societal status or the extensive ease of use that it brings forth by providing the ability to monitor, control and access common home appliances remotely whilst also being able to make informed decisions through the intelligent devices. The majority of the home automation products use IoT as their base technology which is a very recent cutting edge technology stack that enables connecting local daily life appliances to the internet and set a communication medium between the user and the appliance. In this study, a system architecture is proposed for the implementation of home automation with the Arduino IoT cloud server. The circuit diagram of the home automation system with the ESP 32 module is developed and presented in this study. To test and validate the system, a POC was developed with a TRL 5 consisting of a single central control hub, and 3 end device appliances were used for automated control. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
46. Queue model analysis of airline check-in offices with simulation approach.
- Author
-
Hasugian, Ivo Andika, Lubis, Fransiska, Yosephanie, Priscilla, and Sitohang, Yuni
- Subjects
- *
OFFICES , *BATIK , *INTERNATIONAL airports , *TEST systems , *CONSUMERS - Abstract
Currently, business processes in the community often get complaints about long queues, which also happened at the Batik Air check-in office at Kualanamu International Airport. This study was conducted to evaluate the queuing model at the Batik Air check-in office and to determine whether the model is the optimal model or needs some updating to optimize the queue. The airline's current queuing system is two queue lines with two counters. The average service time is 166.5 seconds, and the average arrival time is 119 seconds. Previous observation data shows that the average service time for counter 1 is 159 seconds, and counter 2 is 174 seconds. This data indicates that there is a long queue at the check-in counter. From the simulation system test, the result of changing two queuing lines to 3 queuing lines with three counters is the most optimal queuing system model. There had been an increase of customers number served by ten people from 34 customers or 29.4%, with the percentage of customers at each counter being 20% for counter 1, 50% for counter 2, 30% for counter 3. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
47. Network topology optimisation for improved wind penetration and reliability.
- Author
-
Lawal, Olatunji Ahmed
- Subjects
- *
TOPOLOGY , *WIND power , *TEST systems , *MATHEMATICAL optimization , *BUS conductors (Electricity) - Abstract
The traditional fixed topology of transmission networks is prone to power congestions, which can cause load curtailment and reduce the integrations of wind power, leading to more dispatching of conventional generators and higher overall dispatch cost. This can be overcome by improving the operation flexibility of transmission networks to enhance wind integration level. This is achieved in this paper by employing the network topology optimization technique to optimize network topology by flexibly altering the connections of lines and busbars. The proposed evaluation framework is generic and applicable on any network. Case studies performed on the IEEE 24-bus test system show that the proposed technique is effective in reducing the three costs considered here, namely the load curtailment cost, generator dispatch cost and wind curtailment cost. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
48. The need to use pressure sampling chambers for hydraulic testing of heating system fittings.
- Author
-
Usikov, Sergey and Kashurkin, Alexey
- Subjects
- *
HEATING , *TEST systems , *FLUID flow , *HYDRAULIC control systems , *RELIABILITY in engineering - Abstract
The issue of determining the hydraulic characteristics of the shut-off and control valves of the heating system is relevant. The hydraulic characteristics of control valves are used in the design of heating systems, as well as when setting them up. The quality of the entire system depends on the reliability of these characteristics. However, in the Russian Federation there is a rather small number of laboratories involved in the determination of the hydraulic characteristics of valves. The existing methods for determining the hydraulic characteristics of fittings are not perfect and are not suitable for the peculiarities of the operation of water heating systems. The measurement accuracy depends not only on the accuracy of the measuring devices, but also on the method of pressure sampling. The article discusses several options for taking pressure on a test bench when testing one of the types of balancing valves. The study was carried out using mathematical modeling using k-ε turbulence, with a stationary fluid flow, and the boundary conditions were selected from the conditions of operating modes of water heating systems. Conclusions are drawn about the non-uniformity of the pressure diagram when the fluid flow passes through the samples under study. The error of various methods of pressure sampling is estimated. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
49. Lateral flow immune sensor for phycotoxin domoic acid: New reactants for sensitive detection.
- Author
-
Hendrickson, O. D., Solopova, O. N., Zvereva, E. A., Zherdev, A. V., Sveshnikov, P. G., and Dzantiev, B. B.
- Subjects
- *
FLOW sensors , *BIOCHEMICAL substrates , *DOMOIC acid , *GOLD nanoparticles , *MONOCLONAL antibodies , *TEST systems - Abstract
A lateral flow immune sensor was proposed for the determination of extremely toxic phycotoxin domoic acid (DA). The assay is based on immunochromatographic principles and involves anti-DA monoclonal antibodies and gold nanoparticles for their labeling. The test system allows the detection of DA within 15 min in concentrations from 100 ng/mL visually and 1.3 ng/mL instrumentally. The applicability of the developed analysis for the detection of DA in spiked seawater samples was confirmed. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
50. Creation of Yersinia immunoassay test system based on antibodies to dimethyl sulfoxide antigen Yersinia pseudotuberculosis.
- Author
-
Manieson, V. E., Ivaschenko, S. V., and Larionova, O. S.
- Subjects
- *
YERSINIA pseudotuberculosis , *TEST systems , *YERSINIA , *YERSINIA enterocolitica , *IMMUNOASSAY , *IMMUNOGLOBULINS , *DIMETHYL sulfoxide - Abstract
An ELISA test system was created based on antibodies obtained as a result of immunization of rabbits and guinea pigs with the dimethyl sulfoxide antigen of Yersinia pseudotuberculosis. It showed high sensitivity and generic specificity with all strains of enteropathogenic Yersinia and did not interact with bacteria from other genera, which allows it to be used for diagnostic purposes. In accumulation media with pig faeces contaminated with Yersinia, the experimental test system detected Y. pseudotuberculosis and Yersinia enterocolitica already on the 3rd day of "cold enrichment", provided that 50 or more Yersinia cells per 1 ml were inoculated into the accumulation medium together with feces. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
Catalog
Discovery Service for Jio Institute Digital Library
For full access to our library's resources, please sign in.