Search

Werner syndrome (WS) is an autosomal recessive disease characterized by early onset of many features of aging, by an unusual spectrum of cancers, and by genomic instability. The WS protein (WRN) possesses 3'-->5' DNA helicase and associated ATPase activities, as well as 3'-->5' DNA exonuclease activity. Currently, WRN is the only member of the widely distributed RecQ DNA helicase family with documented exonuclease activity. It is not known whether deficiency of the exonuclease or helicase/ATPase activities of WRN, or all of them, is responsible for various elements of the WS phenotype. WRN exonuclease has limited homology to Escherichia coli RNaseD, a tRNA processing enzyme. We show here that WRN preferentially degrades synthetic DNA substrates containing alternate secondary structures, with an exonucleolytic mode of action suggestive of RNaseD. We present evidence that structure-dependent binding of WRN to DNA requires ATP binding, while DNA degradation requires ATP hydrolysis. Apparently, the exonuclease and ATPase act in concert to catalyze structure-dependent DNA degradation. We propose that WRN protein functions as a DNA processing enzyme in resolving aberrant DNA structures via both exonuclease and helicase activities.

The repair of O(6)-methylguanine (m(6)G) by human O(6)-alkylguanine-DNA alkyltransferase (hAGT) is approximately 5000-fold greater than that for O(4)-methylthymine (m(4)T). To evaluate each adduct's contribution to mutagenesis, we previously created a mutant hAGT with increased specificity for m(4)T in vitro. The mutant and wild-type (WT) hAGT have now been expressed in bacterial strains that allow for the specific detection of A:T-->G:C and G:C-->A:T mutations induced by m(4)T and m(6)G, respectively. After exposure to the mutagenic methylating agent, N-methyl-N'-nitro-N-nitrosoguanidine, A:T-->G:C substitutions were reduced >4-fold in cells expressing the mutant hAGT compared with 1. 1-fold for WT hAGT. G:C-->A:T substitutions were decreased >2.5-fold in cells expressing the mutant hAGT, whereas WT hAGT totally prevented G:C-->A:T mutations. These results demonstrate that the altered substrate specificity of hAGT observed in vitro also occurs in vivo, and that it is responsible for the observed differences in mutations.

There is increasing evidence that in eukaryotic cells, DNA undergoes continuous damage, repair and resynthesis. A homeostatic equilibrium exists in which extensive DNA damage is counterbalanced by multiple pathways for DNA repair. In normal cells, most DNA damage is repaired without error. However, in tumor cells this equilibrium may be skewed, resulting in the accumulation of multiple mutations. Among genes mutated are those that function in guaranteeing the stability of the genome. Loss of this stability results in a mutator phenotype. Evidence for a mutator phenotype in human cancers includes the frequent occurrence of gene amplification, microsatellite instability, chromosomal aberrations and aneuploidy. Current experiments have centered on two mechanisms for the generation of genomic instability, one focused on mutations in mismatch repair genes resulting in microsatellite instability, and one focused on mutations in genes that are required for chromosomal segregation resulting in chromosomal aberrations. This dichotomy may reflect only the ease by which these manifestations can be identified. Underlying both pathways may be a more general phenomenon involving the selection for mutator genes during tumor progression. During carcinogenesis there is selection for cells harboring mutations that can overcome adverse conditions that limit tumor growth. These mutations are produced by direct DNA damage as well as secondarily as a result of mutations in genes that cause a mutator phenotype. Thus, as tumor progression selects for cells with specific mutations, it also selects for cancer cells harboring mutations in genes that normally function in maintaining genetic instability.

Fluoropyrimidines, such as 5-fluorouracil (5-FU), are used extensively in cancer therapy. In the cell, 5-FU is metabolized to 5-fluorodeoxyuridylate (5-FdUMP), a tight binding covalent inhibitor of thymidylate synthase (TS). In order to create 5-FdUMP resistant enzymes to protect chemosensitive normal cells and further understand mechanisms of 5-FdUMP resistance, we have randomized four residues within the active site of TS. Our previous studies identified alterations in residues which produce active TS with enhanced resistance to 5-fluorouridine (5-FdUR). By remutagenizing a subset of the 13 previously targeted residues (A197, L198, C199 and V204), an unbiased random library can be created allowing for extensive testing of all possible amino acid substitutions at each of the sites. Using genetic complementation and selection in Escherichia coli, we identified the spectrum of substitutions that yield active TS as well as those that resulted in 5-FdUR resistant mutants of TS. The 5-FdUR resistant TS were found to share several structural features including hydrophobic substitutions at residue 197, retention of the wild-type leucine 198, the alteration C199L (present in 64% of the drug-resistant library), and polar alterations of valine 204. The catalytic activity of mutants with these features was approximately equal to that of the wild-type TS.

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.

O(6)-alkylguanine-DNA alkyltransferase (AGT) is a suicide protein that corrects DNA damage by alkylating agents and may also serve to activate environmental carcinogens. We expressed human wild-type and two active mutant AGTs in bacteria that lack endogenous AGT and are also defective in nucleotide excision repair, to examine the ability of the AGTs to protect Escherichia coli from DNA damage by different types of alkylating agents and, oppositely, to sensitize cells to the genotoxic effects of dibromoalkanes (DBAs). Control bacteria carrying the cloning vector alone were extremely sensitive to mutagenesis by low, noncytotoxic doses of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). Expression of human wild-type AGT prevented most of this enlarged susceptibility to MNNG mutagenesis. Oppositely, cell killing required much higher MNNG concentrations and prevention by wild-type AGT was much less effective. Mutants V139F and V139F/P140R/L142M protected bacteria against MNNG-induced cytotoxicity more effectively than the wild-type AGT, but protection against the less stringent mutagenesis assay was variable. Subtle differences between wild-type AGT and the two mutant variants were further revealed by assaying protection against mutagenesis by more complex alkylating agents, such as N-ethyl-N-nitrosourea and 1-(2-chloro- ethyl)-3-cyclohexyl-1-nitrosourea. Unlike wild-type and V139F, the triple mutant variant, V139F/P140R/L142M was unaffected by the AGT inhibitor, O(6)-benzylguanine. Wild-type AGT and V139F potentiated the genotoxic effects of DBAs; however, the triple mutant virtually failed to sensitize the bacteria to these agents. These experiments provide evidence that in addition to the active site cysteine at position 145, the proline at position 140 might be important in defining the capacity by which AGTs modulate genotoxicity by environmentally relevant DBAs. The ability of AGTs to activate dibromoalkanes suggests that this DNA repair enzyme could be altered, and if expressed in tumors might be lethal by enhancing the activation of specific chemotherapeutic prodrugs.

An understanding of the contribution of reactive oxygen species to mutagenesis has been hampered by the vast number of different chemical modifications they cause in DNA. Even though many of these DNA alterations have been catalogued, the identification of specific lesions that cause mutations has depended on testing one modification at a time. In this study we present another approach to identify key mutagenic lesions from a pool of oxidatively modified nucleotides. dCTP was treated with an oxygen radical-generating system containing FeSO4, H2O2, and ascorbic acid. The modification products were separated by reverse-phase and anion-exchange HPLC and then incorporated by human immunodeficiency virus reverse transcriptase into a DNA that contains a target gene for scoring for mutations. One of the mutagenic species isolated was identified as 5-hydroxy-2'-deoxycytidine. It is incorporated efficiently into DNA and causes C-->T transitions in Escherichia coli at a frequency of 2.5%, which is more mutagenic than any previously identified oxidative DNA lesion.

The DNA polymerase-primase from Drosophila melanogaster contains a cryptic 3'—-5' exonuclease that can be detected after separation of the 182-kDa polymerase subunit from the four-subunit enzyme. To determine the specificity of excision of mispaired nucleotides by the exonuclease, we have utilized primed phi X174am3 single-stranded DNA containing a noncomplementary nucleotide at the 3'-primer terminus, opposite deoxyadenosine at position 587 in the amber3 codon of the template strand. In the absence of polymerization, the preference for excision of the mispaired nucleotide from the primer is C greater than A much greater than G. Excision under these conditions is inhibited by the addition of deoxyguanosine monophosphate. Under conditions of concomitant DNA synthesis, the preference for excision at this site becomes A = G much greater than C, and excision is insensitive to deoxyguanosine monophosphate. The high fidelity of DNA synthesis exhibited by the isolated 182-kDa polymerase subunit is not reduced by concentrations of deoxyguanosine monophosphate or adenosine monophosphate that inhibit proofreading by prokaryotic DNA polymerases. Thus, the 3'—-5' exonuclease of the Drosophila DNA polymerase-primase participates in exonucleolytic proofreading by excising noncomplementary nucleotides prior to extension of the primer by polymerase action. The deoxynucleoside triphosphate analogs N2-(p-butylphenyl)deoxyguanosine triphosphate and N2-(p-butylphenyl)deoxyadenosine triphosphate are potent inhibitors of DNA polymerase alpha. Like calf thymus DNA polymerase delta, recently determined to have proofreading capability, DNA synthesis by the isolated Drosophila 182-kDa polymerase subunit was not inhibited by the two analogs. In contrast, DNA synthesis by the intact Drosophila polymerase-primase complex was inhibited greater than 95% by these analogs.

The generation of Chinese hamster ovary cell lines that express assembly defective forms of beta-tubulin were isolated using selections based on reversion of conditional lethal or drug resistance phenotypes. Two such cell lines, D2 and 6H3, were chosen for further characterization because they contain beta-tubulin polypeptides that exhibit decreases in apparent molecular weight on two-dimensional gel electrophoresis. Analysis of the nucleic acid from these cell lines using both Southern and Northern procedures suggests a deletion in one of the beta-tubulin genes in each cell line. Localization of the missing sequence in D2 was first determined by tryptic peptide mapping by high performance liquid chromatography. Subsequently, the assignment was confirmed by constructing appropriate subclones of a wild type Chinese hamster ovary beta-tubulin cDNA for Southern analysis to demonstrate a failure to recognize characteristic hybridization patterns of the mutant tubulin gene. In the other revertant, 6H3, the deletion was detected on a Northern blot by differential hybridization of a 3′ fragment of the cDNA to the beta-tubulin messages. The results indicate that D2 has an internal deletion whose approximate limits extend from amino acid residues 250 through 345. Cell line 6H3 has a deletion that begins near amino acid residue 330 and extends into the 3′-untranslated region of the gene.

Werner syndrome is an inherited disease characterized by premature aging, genetic instability and a high incidence of cancer. The wild type Werner syndrome protein (WRN) has been demonstrated to exhibit DNA helicase activity in vitro. Here we report further biochemical characterization of the WRN helicase. The enzyme unwinds double-stranded DNA, translocating 3'-->5' on the enzyme-bound strand. Hydrolysis of dATP or ATP, and to a lesser extent hydrolysis of dCTP or CTP, supports WRN-catalyzed strand-displacement. K m values for ATP and dATP are 51 and 119 microM, respectively, and 2.1 and 3.9 mM for CTP and dCTP, respectively. Strand-displacement activity of WRN is stimulated by single-stranded DNA-binding proteins (SSBs). Among the SSBs from Escherichia coli, bacteriophage T4 and human, stimulation by human SSB (human replication protein A, hRPA) is the most extensive and occurs with a stoichiometry which suggests direct interaction with WRN. A deficit in the interaction of WRN with hRPA may be associated with deletion mutations that occur at elevated frequency in Werner syndrome cells.

Human immunodeficiency virus (HIV) reverse transcriptase substitutes for temperature-sensitive DNA polymerase I (Pol Its) in Escherichia coli, providing a screen for anti-HIV reverse transcriptase nucleoside analogs in bacteria. Since phosphorylation of nucleosides in E. coli is limited to thymidine and its derivatives, we coexpressed herpes simplex virus thymidine kinase, an enzyme that phosphorylates a wide variety of nucleoside analogs, together with HIV reverse transcriptase. Coexpression of herpes simplex virus thymidine kinase and HIV reverse transcriptase rendered Pol Its cells sensitive to dideoxycytidine. Studies with different nucleoside analogs indicate that this bacterial screening system is able to select and identify nucleoside analogs that specifically target HIV reverse transcriptase.

The contribution of proofreading to the fidelity of catalysis by DNA polymerases has been determined with deoxyribonucleoside [1-thio]triphosphate substrates. These analogues, which contain a sulfur in place of an oxygen on the alpha phosphorus, are incorporated into DNA by DNA polymerases at rates similar to those of the corresponding unmodified deoxynucleoside triphosphates. The fidelity of DNA synthesis was measured with phi X174 am3 DNA; reversion to wild type occurs most frequently by a single base substitution, a C for a T at position 587. By using avian myeloblastosis virus DNA polymerase and DNA polymerase beta (enzymes without a proofreading 3' leads to 5' exonucleolytic activity), substitution of deoxycytidine thiotriphosphate in the reaction mixture did not alter fidelity. In contrast, with DNA polymerases from E. coli (DNA polymerase I) and bacteriophage T4 (enzymes containing a proofreading activity), fidelity was markedly reduced with deoxycytidine [1-thio]triphosphate. DNA containing phosphorothioate nucleotides is insensitive to hydrolysis by the exonuclease associated with these prokaryotic DNA polymerases. These combined results indicate that the deoxynucleoside [1-thio]triphosphates have normal base-pairing properties; however, once misinserted by a polymerase, they are not excised by proofreading. Proofreading of a C:A mismatch at position 587 is thereby found to contribute 20-fold to the fidelity of E. coli DNA polymerase I and a greater amount to the fidelity of bacteriophage T4 DNA polymerase.

Introduction of apurinic sites into phi X174 am3 DNA leads to loss of biological activity when measured in a transfection assay. For single-stranded DNA, approximately one apurinic site constitutes a lethal hit; for double-stranded (RFI) DNA, approximately 3.5 hits per strand are lethal. When the reversion frequency of am3 DNA is measured, no increase due to depurination is observed above the background level. However, a large increase in reversion frequency is observed when the same DNA is assayed by using spheroplasts derived from bacteria previously exposed to UV light. The results suggest that apurinic sites are impediments to a replicating DNA polymerase; however, nucleotides can be incorporated opposite these sites under SOS-induced conditions. We estimate the frequency of mutagenesis per apurinic site to be less than 1 in 1400 in normal spheroplasts and 1 in 100 in SOS-induced spheroplasts.

We screened 67 mutants in the O-helix of Thermus aquaticus (Taq) DNA polymerase I (pol I) for altered fidelity of DNA synthesis. These mutants were obtained (Suzuki, M., Baskin, D., Hood, L., and Loeb, L. A. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 9670-9675) by substituting an oligonucleotide containing random sequences for codons 659-671, and selecting for complementation of a growth defect in Escherichia coli caused by temperature-sensitive host pol I. Thirteen mutants decreased fidelity in a screen that employed primer extension reactions lacking one of four complementary deoxynucleoside triphosphates (dNTPs). Three mutants were purified and exhibited 29-68% of wild-type specific activity. Homogeneous polymerases A661E, A661P, and T664R extended primers further than the wild-type, synthesizing past template nucleotides for which the complementary dNTP was absent. The data indicate that both misinsertion of incorrect nucleotides and extension of mispaired primer termini were increased. In a lacZalpha forward mutation assay, A661E and T664R yielded mutation frequencies at least 7- and 25-fold greater, respectively, than that of the wild-type polymerase. These findings emphasize the importance of the O-helix in substrate recognition and are compatible with a role for pyrophosphate release in enhancing fidelity of DNA synthesis.

In this study we examined whether the arrest of DNA polymerase alpha (pol alpha)-catalyzed DNA synthesis at template pause sites entails terminal nucleotide misincorporation. An approach was developed to identify the 3'-terminal nucleotide in nascent DNA chains that accumulate at pause sites. A radioactive 5'-end-labeled primer was annealed to a bacteriophage M13mp2 single-stranded DNA template and elongated by pol alpha. Individual DNA chains that were accumulated at pause sites were resolved by sequencing gel electrophoresis, isolated, and purified. These DNA chains were elongated by pol alpha by using four annealed synthetic DNA templates, each of which contained a different nucleotide at the position opposite the 3' terminus of the arrested chain. Owing to the high preference of pol alpha for matched-over-mismatched primer termini, only those templates that contain a nucleotide that is complementary to the 3' terminus of the isolated pause-site chain are copied. Electrophoresis of product DNA showed the extent of copying of each template and thus identified the 3'-terminal nucleotide of the pause-site chains. We found that product DNA chains terminate with a noncomplementary 3'-terminal nucleotide opposite pause sites within the sequence 3'-d(AAAA)-5' at positions 6272-6269 of the M13mp2 genome. pol alpha catalyzed misincorporation of dG or dA into the 3' terminus of nascent chains opposite two of the M13mp2 template dA residues. A similar analysis of a different pause site did not reveal significant misincorporation opposite template dC. These results suggest that some but not all sites at which pol alpha pauses may constitute loci of mutagenesis.

Vinyl chloride is a known human and rodent carcinogen that forms several cyclic base derivatives in DNA. The mutagenic potential of these derivatives has been examined in vitro but not in vivo. One of these derivatives, N2,3-ethenoguanine (epsilon G), is known to base pair with both cytosine and thymine during in vitro DNA synthesis, which would result in G----A transitions. To determine the base pairing specificity of this labile guanine derivative in Escherichia coli, we have developed a genetic reversion assay for guanine derivatives. The assay utilizes DNA polymerase-mediated analogue insertion into a bacteriophage vector, M13G*1, which detects all single-base substitutions at position 141 of the lacZ alpha gene by change in plaque color. After the insertion of a single epsilon G opposite the template cytosine at position 141 by use of epsilon dGTP and DNA polymerase and further extension with all four normal dNTPs, the DNA was transfected into E. coli. Transfection of M13G*1 containing epsilon G at the target site yielded 135 mutants among 26,500 plaques, 134 of which represented G----A transitions. The uncorrected mutation frequency was 0.5%, as compared with the control value, approximately 0.02%; when corrected for epsilon G content and penetrance, the calculated mutagenic potential of epsilon G (mutations/analogue) was about 13%. We thus conclude that epsilon G specifically induces G----A transitions during DNA replication in E. coli. The M13G*1 assay may permit the testing of other labile guanine derivatives not otherwise amenable to mutagenesis studies.

Reactive oxygen species are generated by a variety of cellular processes. These endogenously generated, reactive intermediates produce a multiplicity of DNA alterations and mutations and have been implicated in the pathogenesis of several human diseases. We report here that treatment of single-stranded M13mp2 bacteriophage DNA with methylene blue and white light generates increased levels of 8-hydroxydeoxyguanosine and that mutagenesis is both highly specific and dependent on the SOS response. Lesions produced block the progression of DNA synthesis one base preceding template guanines. In SOS-induced Escherichia coli, 97% of all methylene blue-induced mutations in the lacZ alpha gene of M13mp2 DNA are single-base substitutions opposite template guanines. The most frequent mutations are G----C transversions. The G----T transversions expected from the presence of 8-hydroxydeoxyguanosine in the template strand occur, but at a lower frequency. Sequence data together with SOS dependency and the presence of replication blockage demonstrate that while 8-hydroxydeoxyguanosine may serve as an important marker to monitor oxygen-induced DNA damage in humans, it does not account for either the observed blockage to replication or the mutagenesis by methylene blue plus light in SOS-induced E. coli. Instead, an as yet unidentified lesion generated by active oxygen species is a more potent mutagenic event.

In addition to its DNA helicase activity, Werner syndrome protein (WRN) also possesses an exonuclease activity (Shen, J.-C., Gray, M. D., Kamath-Loeb, A. S., Fry, M., Oshima, J., and Loeb, L. A. (1998) J. Biol. Chem. 273, 34139-34144). Here we describe the properties of nearly homogeneous WRN exonuclease. WRN exonuclease hydrolyzes a recessed strand in a partial DNA duplex but does not significantly digest single-stranded DNA, blunt-ended duplex, or a protruding strand of a partial duplex. Although DNA is hydrolyzed in the absence of nucleoside triphosphates, nuclease activity is markedly stimulated by ATP, dATP, or CTP. WRN exonuclease digests DNA with a 3' --> 5' directionality to generate 5'-dNMP products, and DNA strands terminating with either a 3'-OH or 3'-PO4 group are hydrolyzed to similar extents. A recessed DNA strand with a single 3'-terminal mismatch is hydrolyzed more efficiently by WRN than one with a complementary nucleotide, but the enzyme fails to hydrolyze a DNA strand terminating with two mismatched bases. WRN exonuclease is distinguished from known mammalian DNA nucleases by its covalent association with a DNA helicase, preference for a recessed DNA strand, stimulation by ATP, ability to equally digest DNA with 3'-OH or 3'-PO4 termini, and its preferential digestion of DNA with a single 3'-terminal mismatch.

Werner Syndrome (WS) is a human progeroid disorder characterized by genomic instability. The gene defective in WS encodes a 3' --> 5' DNA helicase (Gray, M. D., Shen, J.-C., Kamath-Loeb, A. S., Blank, A. , Sopher, B. L., Martin, G. M., Oshima, J., and Loeb, L. A.(1997) Nat. Genet. 17, 100-103). Sequence alignment analysis identified an N-terminal motif in WRN that is homologous to several exonucleases. Using combined molecular genetic, biochemical, and immunochemical approaches, we demonstrate that WRN also exhibits an integral DNA exonuclease activity. First, whereas wild-type recombinant WRN possesses both helicase and exonuclease activities, mutant WRN lacking the nuclease domain does not display exonucleolytic activity. In contrast, WRN proteins with defective helicase activity are active in exonucleolytic digestion of DNA. Second, the exonuclease co-purifies with the 160-kDa WRN protein and its associated DNA helicase and ATPase activities through successive steps of ion exchange and affinity chromatography, suggesting that all three activities are physically associated. Lastly, anti-WRN antiserum specifically co-precipitates the WRN helicase and exonuclease activities indicating that both activities reside on the same antigenic WRN polypeptide. The association of an exonuclease with WRN distinguishes it from other RecQ homologs and raises the possibility that the distinct phenotypic characteristics of WS may be due in part to a defective exonuclease.

Thymidylate synthase (TS) catalyzes the methylation of dUMP to dTMP and is the target for the widely used chemotherapeutic agent 5-fluorouracil. We used random sequence mutagenesis to replace 13 codons within the active site of TS and obtain variants that are resistant to 5-fluorodeoxyuridine (5-FdUR). The resulting random library was selected for its ability to complement a TS-deficient Escherichia coli strain, and sequence analysis of survivors found multiple substitutions to be tolerable within the targeted region. An independent selection of the library was carried out in the presence of 5-FdUR, resulting in a more limited spectrum of mutations. One specific mutation, C199L, was observed in more than 46% of 5-FdUR-resistant clones. A 5-FdUR-resistant triple mutant, A197V/L198I/C199F, was purified to apparent homogeneity. Kinetic studies with the substrate dUMP indicate that this mutant is similar to the wild type in regards to kcat and Km values for dUMP and the cosubstrate CH2H4-folate. In contrast, equilibrium binding studies with the inhibitor, FdUMP, demonstrate that the dissociation constant (Kd) for FdUMP binding into the ternary complex was 20-fold higher than values obtained for the wild-type enzyme. This 5-FdUMP-resistant mutant, or others similarly selected, is a candidate for use in gene therapy to render susceptible normal cells resistant to the toxic effects of systemic 5-fluorouracil.

The unusually high error rate of human immunodeficiency virus type 1 reverse transcriptase (HIV-1 RT) suggests that polymerization errors by this enzyme contribute to the genetic variability of the AIDS virus. We have analyzed the mechanism for HIV-1 RT infidelity by studying two distinct steps that might lead to base substitution mutations: nucleotide misinsertions and elongation from 3'-terminal DNA mispairs. Our results indicate that the capacity of HIV-1 RT to polymerize nucleotides onto mispaired termini is a major factor in the production of mutations by this enzyme. When a noncomplementary dAMP was inserted opposite a template adenine by HIV-1 RT, the nascent 3'-terminal A.A mispair was readily extended by subsequent incorporation of the next complementary nucleotide. The frequencies of nucleotide addition onto 3'-terminal A-A, A-C, and A-G mispairs were determined by quantitating the amount of extended primers with a gel electrophoresis assay and by measuring mutagenesis after hybridization of mismatched primers opposite an amber mutation in bacteriophage phi X174 DNA. The mispair extension frequencies are approximately 50-fold higher by HIV-1 RT than by the mammalian replicative enzyme DNA polymerase alpha.

Addition of the 3'----5' proofreading exonuclease, epsilon subunit of Escherichia coli DNA polymerase III, to DNA polymerase alpha from calf thymus has been studied. Alone, calf thymus DNA polymerase alpha terminates in vitro DNA synthesis upon insertion of noncomplementary nucleotides. Upon addition of the epsilon subunit, DNA polymerase alpha elongates the newly synthesized DNA as a result of hydrolysis of the 3'-terminal mispair. The fidelity of DNA polymerase alpha in vitro is increased 7-fold by addition of the exonuclease. The functional interaction between DNA polymerase alpha and the epsilon subunit is independent of any detectable physical association. This suggests that a mechanism for proofreading could exist in mammalian cells involving sequential catalysis by DNA polymerase alpha excision of errors by a separate 3'----5' exonuclease, and further elongation onto correctly base-paired 3' termini by DNA polymerase alpha.

By a condensation of 1,10-phenanthroline-5,6-dione and 1,2-diamino antraquinone, the new acceptor polypiridine ligand, 10,11-[1,4 naphtalendione]dipyrido[3,2-a;2′,3′-c]phenazine, was obtained. A new synthetic route for the 1,10phenanthroline-5,6-dione precursor is also reported.

A number of metals have been demonstrated to be mutagens in procaryotic and eucaryotic organisms as well as carcinogens in experimental animals. Epidemiologic studies have indicated that Ni, Cr, and As are involved in human carcinogenesis. We have hypothesized that the active molecular species is the cation and that metal induced mutations result from incorrect base-substitutions during DNA replication. This is supported by the observations that metal ions diminish the fidelity of DNA synthesis in vitro using a variety of DNA polymerases. There is a significant correlation between the metals that decrease fidelity and those that have been reported to be mutagenic and carcinogenic. Thus, metal carcinogens are no exception to the general postulate that carcinogens can be identified by their effects on DNA.

Oxidative damage to DNA is mutagenic and thus may play a role in carcinogenesis. Because of the large number of different DNA lesions formed by oxidative species, no genetic alteration so far identified is exclusively associated with oxygen damage. Tandem double CC-->TT mutations are known to occur via UV damage to DNA and are thought to be a specific indicator of UV exposure. Using a sensitive reversion assay that can detect both single and double mutations within the same codon of the M13-encoded lacZ alpha gene, we show that treatments that produce reactive oxygen species can also produce tandem double CC-->TT mutations. The frequency at which these mutations occur is less than that for single base mutations by a factor of approximately 30. The induction of these mutations is inhibited by treatment that scavenges hydroxyl radicals. This unique mutation provides a marker of oxygen free radical-induced mutagenesis in cells that are not exposed to UV-irradiation and an indicator for assessing the involvement of oxidative damage to DNA in aging and tumor progression.

Knowledge of the catalytic properties and structural information regarding the amino acid residues that comprise the active site of an enzyme allows one, in principle, to use site-specific mutagenesis to construct genes that encode enzymes with altered functions. However, such information about most enzymes is not known and the effects of specific amino acid substitutions are not generally predictable. An alternative approach is to substitute random nucleotides for key codons in a gene and to use genetic selection to identify new and interesting enzyme variants. We describe here the construction, selection, and characterization of herpes simplex virus type 1 thymidine kinase mutants either with different catalytic properties or with enhanced thermostability. From a library containing 2 x 10(6) plasmid-encoded herpes thymidine kinase genes, each with a different nucleotide sequence at the putative nucleoside binding site, we obtained 1540 active mutants. Using this library and one previously constructed, we identified by secondary selection Escherichia coli harboring thymidine kinase mutant clones that were unable to grow in the presence of concentrations of 3'-azido-3'-deoxythymidine (AZT) that permits colony formation by E. coli harboring the wild-type plasmid. Two of the mutant enzymes exhibited a reduced Km for AZT, one of which displayed a higher catalytic efficiency for AZT over thymidine relative to that of the wild type. We also identified one mutant with enhanced thermostability. These mutants may have clinical potential as the promise of gene therapy is increasingly becoming a reality.

The DNA polymerase-primase from Drosophila lacks 3'----5' exonuclease activity. However, a potent exonuclease can be detected after separating the 182-kDa polymerase subunit from the other three subunits of the enzyme (73, 60, and 50 kDa) by glycerol gradient sedimentation in the presence of 50% ethylene glycol. The exonuclease activity cosediments with the polymerase subunit, suggesting that the two activities reside in the same polypeptide. The 3'----5' exonuclease excises mismatched bases at the 3' termini of primed synthetic and natural DNA templates. Excision of a mispaired base at the 3' terminus occurs at a 10-fold greater rate than excision of the correctly paired base. When replication fidelity is measured by the bacteriophage phi X174 am3 reversion assay, the isolated polymerase subunit is at least 100-fold more accurate than either the intact polymerase-primase or a complex of the 182- and 73-kDa subunits. These results suggest that the 3'----5' exonuclease functions as a proofreading enzyme during Drosophila DNA replication in vitro and very likely in vivo.

In order to better understand the role of the -35 sequence motif in transcription initiation by Escherichia coli sigma 70 RNA polymerase holoenzyme, -35 promoter elements of limited nucleotide composition have been selected from random DNA sequences. Functional promoter elements have been identified that are composed of just two nucleotide species (A,T; G,C; T,C; and T,G) and one nucleotide species (poly(dT)). From this study of 81 promoter mutations, two conclusions can be made. First, given a population of random DNA sequences, there exist sequences that form stronger -35 promoter elements than the consensus sequence. These sequences lack some features of the consensus sequence and reveal unexpected homology in the ordinarily nonconserved spacer sequence. Second, the sequence requirements at the -35 site may suggest a possible role for DNA secondary structure in the recognition of promoters by RNA polymerase.

We have designed and utilized a bacterial complementation system to identify and characterize mammalian DNA polymerase beta mutants. In this complementation system, wild-type rat DNA polymerase beta replaces both the replicative and repair functions of DNA polymerase I in the Escherichia coli recA718 polA12 double mutant; our 263 DNA polymerase beta mutants replace E. coli polymerase I less efficiently or not at all. Of the 10 mutants that have been shown to contain DNA sequence alterations, 2 exhibit a split phenotype with respect to complementation of the growth defect and methylmethanesulfonate sensitivity of the double mutant; one is a null mutant. The mutants possessing a split phenotype contain amino acid residue alterations within a putative nucleotide binding site of DNA polymerase beta. This approach for the isolation and evaluation of mutants of a mammalian DNA polymerase in E. coli may ultimately lead to a better understanding of the mechanism of action of this enzyme and to precisely defining its role in vertebrate cells.

DNA repair alkyltransferases protect organisms against the cytotoxic, mutagenic, and carcinogenic effects of alkylating agents by transferring alkyl adducts from DNA to an active cysteine on the protein, thereby restoring the native DNA structure. We used random sequence substitutions to gain structure-function information about the human O6-methylguanine-DNA methyltransferase (EC 2.1.1.63), as well as to create active mutants. Twelve codons surrounding but not including the active cysteine were replaced by a random nucleotide sequence, and the resulting random library was selected for the ability to provide alkyltransferase-deficient Escherichia coli with resistance to the methylating agent N-methyl-N'-nitro-N-nitrosoguanidine. Few amino acid changes were tolerated in this evolutionarily conserved region of the protein. One mutation, a valine to phenylalanine change at codon 139 (V139F), was found in 70% of the selected mutants; in fact, this mutant was selected much more frequently than the wild type. V139F provided alkyltransferase-deficient bacteria with greater protection than the wild-type protein against both the cytotoxic and mutagenic effects of N-methyl-N'-nitro-N-nitrosoguanidine, increasing the D37 over 4-fold and reducing the mutagenesis rate 2.7-5.5-fold. This mutant human alkyltransferase, or others similarly created and selected, could be used to protect bone marrow cells from the cytotoxic side effects of alkylation-based chemotherapeutic regimens.

The effect of several divalent cations on the accuracy of DNA replication in vitro has been examined. Only Be2+ altered the accuracy of DNA synthesis using purified DNA polymerase (DNA nucleotidyltransferase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase; EC 2.7.7.7) from avian myeloblastosis virus. The Be2+-induced base substitutions occurred with all templates and with all nucleotides tested. Analysis of the product by equilibrium density centrifugation and processive hydrolysis with snake venom phosphodiesterase suggested that the noncomplementary nucleotides were present in phosphodiester linkage. Nearest neighbor studies indicated that many of the Be2+-induced errors were present as single base substitutions. The enhancement of error frequency could be duplicated by the pretreatment of the enzyme, but not the template, with Be2+. Glycerol gradient centrifugation dissociated the Be2+-DNA polymerase complex and restored the initial error frequency of the polymerase. Thus, the weak binding of a metal cation to a DNA polymerase could alter the accuracy with which that polymerase copied DNA. Beryllium is a known carcinogen. The potential use of this system as a screening technique to detect chemical mutagens and carcinogens is considered.

The effect of Escherichia coli single-strand binding protein on the accuracy of in vitro DNA synthesis has been determined by using two independent methods. By using the synthetic polynucleotide poly[d(A-T)] and measuring dGTP misincorporation or by using phi X174 DNA and measuring nucleotide substitutions, we found that binding protein increases the fidelity of DNA synthesis by as much as 10-fold. This increase is observed with DNA polymerases of divergent sources and is progressive with increasing concentration of binding protein. The increased accuracy observed with DNA polymerases lacking a 3' leads to 5' exonuclease points to a mechanism other than augmented proofreading. In accord with the properties of single-strand binding proteins, it is suggested that increased fidelity is a result of enhanced base selection by the DNA polymerase, resulting from increased rigidity of the template due to its interaction with binding protein.

We present evidence that DNA polymerase delta of Saccharomyces cerevisiae, an enzyme that is essential for viability and chromosomal replication, is also required for base excision repair of exogenous DNA methylation damage. The large catalytic subunit of DNA polymerase delta is encoded by the CDC2(POL3) gene. We find that the mutant allele cdc2-2 confers sensitivity to killing by methyl methanesulfonate (MMS) but allows wild-type levels of UV survival. MMS survival of haploid cdc2-2 strains is lower than wild type at the permissive growth temperature of 20 degrees C. Survival is further decreased relative to wild type by treatment with MMS at 36 degrees C, a nonpermissive temperature for growth of mutant cells. A second DNA polymerase delta allele, cdc2-1, also confers a temperature-sensitive defect in MMS survival while allowing nearly wild-type levels of UV survival. These observations provide an in vivo genetic demonstration that a specific eukaryotic DNA polymerase is required for survival of exogenous methylation damage. MMS sensitivity of a cdc2-2 mutant at 20 degrees C is complemented by expression of mammalian DNA polymerase beta, an enzyme that fills single-strand gaps in duplex DNA in vitro and whose only known catalytic activity is polymerization of deoxyribonucleotides. We conclude, therefore, that the MMS survival deficit in cdc2-2 cells is caused by failure of mutant DNA polymerase delta to fill single-strand gaps arising in base excision repair of methylation damage. We discuss our results in light of current concepts of the physiologic roles of DNA polymerases delta and epsilon in DNA replication and repair.

The fidelity with which wild type T4 DNA polymerase copies phi X174 amber 3 plus strand DNA at position 587 in vitro has been measured. Synthesis is initiated by hybridizing to the template a HaeIII restriction fragment whose 3'-OH terminus is 83 nucleotides from the amber 3 site. Based on gel electrophoresis of product DNA molecules and genetic marker rescue data, T4 DNA polymerase copies significantly beyond the mutant site. Transfection analysis shows that the A X T leads to G X C mutation at position 587 occurs 10- to 100-fold less frequently with T4 DNA polymerase than with E. coli DNA polymerase I. The aberrant incorporation of cytosine opposite adenine at position 587 by the T4 polymerase alone is occurring at a frequency not greater than about 10(-7) which, for this particular locus, may be similar to the fidelity exhibited by the T4 accessory proteins plus the polymerase comprising the replication complex. A comparison of the accuracy of mutator L56 and antimutator L141 T4 DNA polymerases relative to wild type shows at most a 2- to 4-fold decrease and increase, respectively, in fidelity. When compared to 10- to 1000-fold effects on mutation frequencies that these same mutant alleles have in vivo, these results suggest that the wide range in expression of mutator and antimutator phenotypes in vivo may be dependent on an abnormal interaction of the aberrant DNA polymerases with other protein components of the replication complex.

The fidelity of DNA synthesis with purified DNA polymerase alpha and beta from human placenta has been studied. With poly[d(A-T)] as the template-primer and Mg2+ as the metal activator, DNA polymerase alpha incorporates 1 mol of dGMP for every 6,000 to 12,000 mol of complementary nucleotides polymerized. Under the same conditions, DNA polymerase beta is more accurate, the error rate being 1/20,000 to 1/60,000. This greater accuracy of DNA polymerase beta is observed with a variety of homopolymer templates. With both enzymes, substitution of Mg2+ with activating concentrations of Mn2+ or Co2+ enhances the frequency of misincorporation. At greater than activating concentrations of Mn2+ and Co2+, there is an inhibition of complementary nucleotide incorporation, further increasing the frequency of misincorporation. Nearest neighbor analysis of the products synthesized with both enzymes indicates that the noncomplementary nucleotides are incorporated predominantly as single base substitutions. The greater accuracy of DNA polymerase beta over DNA polymerase alpha should be considered in relationship to their possible roles in DNA replication and repair.

We have measured the efficiencies of utilization of 8-oxo-dGTP and 8-NH2-dGTP by human immunodeficiency virus type 1 and murine leukemia virus reverse transcriptases and compared them to those of DNA polymerases alpha and beta. Initially, we carried out primer extension reactions in the presence of dGTP or a dGTP analog and the remaining three dNTPs using synthetic DNA and RNA templates. These assays revealed that, in general, 8-NH2-dGTP is incorporated and extended more efficiently than 8-oxo-dGTP by all enzymes tested. Second, we determined rate constants for the incorporation of each analog opposite a template cytidine residue using steady state single nucleotide extension kinetics. Our results demonstrated the following. 1) Both reverse transcriptases incorporate the nucleotide analogs; discrimination against their incorporation is a function primarily of Km or Vmax depending on the analog and the enzyme. 2) Discrimination against the analogs is more stringent with the DNA template than with a homologous RNA template. 3) Polymerase alpha exhibits a mixed kinetic phenotype, with a large discrimination against 8-oxo-dGTP but a comparatively higher preference for 8-NH2-dGTP. 4) Polymerase beta incorporates both analogs efficiently; there is no discrimination with respect to Km and a significantly lower discrimination with respect to Vmax when compared with the other polymerases.

We describe catalytically active mutants of HIV RT (human immunodeficiency virus reverse transcriptase) generated by random sequence mutagenesis and selected in Escherichia coli for ability to complement the temperature-sensitive phenotype of a DNA polymerase I (Pol Its) mutant. We targeted amino acids Asp-67 through Arg-78 in HIV RT, which form part of the beta3-beta4 flexible loop and harbor many of the currently known mutations that confer resistance to nucleoside analogs. DNA sequencing of 109 selected mutants that complement the Pol Its phenotype revealed substitutions at all 12 residues targeted, indicating that none of the wild-type amino acids is essential. However, single mutations were not observed at Trp-71, Arg-72, and Arg-78, consistent with evolutionary conservation of these residues among viral RTs and lack of variation at these positions among isolates from patients. The mutations we recovered included most of those associated with drug resistance as well as previously unidentified mutations. Purification and assay of 14 mutant proteins revealed correlation between their DNA-dependent DNA polymerize activity in vitro and ability to complement the Pol Its phenotype. Activity of several mutants was resistant to 3'-azidothymidine triphosphate. We conclude that random sequence mutagenesis coupled with positive genetic selection in E. coli yields large numbers of functional HIV RT mutants. Among these are less active variants which are unlikely to be isolated from HIV-infected individuals and which will be informative of the roles of individual amino acids in the catalytic functions of the enzyme.

Oxygen free radicals are highly reactive species generated by many cellular oxidation-reduction processes. These radicals damage cellular constituents and have been causally implicated in the pathogenesis of many human diseases. We report here that oxygen free radicals generated by Fe2+ in aqueous solution are mutagenic. Aerobic incubation of luminal diameter X174 am3 (amber 3 mutation) DNA with Fe2+ results in decreased phage survival when the treated DNA is transfected into Escherichia coli spheroplasts. Transfection of the treated DNA into SOS-induced spheroplasts results in an increase in mutagenesis as great as 50-fold. Both killing and mutagenesis can be prevented by binding of Fe2+ with deferoxamine or by the addition of catalase or mannitol. These results suggest that DNA damage and mutagenesis brought about by Fe2+ are likely to occur by a Fenton-type mechanism that involves the generation of (i) hydrogen peroxide by the autoxidation of iron and (ii) hydroxyl radicals by the interaction of the hydrogen peroxide with Fe2+. DNA sequence analysis of the Fe2+-induced mutants indicates that reversion of the phage phenotype to wild type occurs largely by a transversion type of mutation involving substitution of deoxyadenosine for thymidine opposite a template deoxyadenosine. Mutagenesis is not abolished by incubation of Fe2+-treated luminal diameter X174 am3 DNA with an apurinic endonuclease and only partially abolished by incubation with alkali, suggesting that a large fraction of the mutagenesis by oxygen free radicals is not caused by formation of apurinic sites but instead involves an as-yet-to-be-defined alteration in deoxyadenosine. These findings raise the possibility that free iron localized in cellular DNA may cause mutations by the generation of oxygen free radicals.

A series of colon carcinomas, adenomas, and adjacent tissues were analyzed for ploidy alterations and mutations in KRAS2. To increase the sensitivity for identifying mutations, we used histological enrichment, cell sorting, and DNA amplification by the polymerase-catalyzed chain reaction followed by direct DNA sequence analysis. Of the 40 carcinomas analyzed, 27 contained aneuploid cells and 26 contained mutations at the first position of codon 12 of KRAS2. Of the 12 adenomas studied, 4 contained aneuploid cells and 9 contained the same mutation at codon 12. In both adenomas and carcinomas, mutations were identified in both diploid and aneuploid cells. In some cases, regions of histologically benign mucosa adjacent to the carcinoma contained mutations. These combined results suggest that mutations in KRAS2 occur early in the development of human colon carcinoma, before change in ploidy, and that these mutations exist in diploid cells from which an aneuploid subpopulation arises. Furthermore, mutations may exist in histologically normal mucosa in regions adjacent to carcinoma, suggesting that a field of genetically abnormal mucosa may surround these tumors.

Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms.

The Chinese hamster V79 cell mutant aphr-4-2, selected for its resistance to aphidicolin, a specific inhibitor of DNA polymerase alpha (DNA nucleotidyltransferase, EC 2.7.7.7), is characterized by slow growth, UV sensitivity, and hypersensitivity to UV-induced mutation. DNA polymerase alpha has been purified from mitochondria-free crude extracts of the mutant and its parental wild-type cells by sequential column chromatography on DEAE-cellulose and phosphocellulose. The major DNA polymerase activity from both cell lines was found to have characteristics of the alpha-type polymerase: sensitivity to 0.2 M KCl, resistance to heat denaturation (45 degrees C for 15 min), an apparent Km of 5 microM for dATP, and an ability to copy poly(dT)X(rA)10 but not poly(rA)X(dT)12. The crude extracts and purified DNA polymerase alpha from the mutant cells are not inhibited by aphidicolin (greater than 0.6 microM). The apparent Km for dCTP with DNA polymerase alpha is 1.0 +/- 0.4 microM (mean +/- SD) for the mutant enzyme. The polymerase from the parental cells, similarly purified, is sensitive to aphidicolin and has an apparent Km for dCTP of 10 +/- 4 microM. The spontaneous mutation rate (per cell per division), determined by fluctuation analysis at the Na+/K+-ATPase (EC 3.6.1.8) locus, is higher for mutant cells (42-73 x 10(-8)) than for parental cells (3-16 x 10(-8)). These data suggest a mechanism for aphidicolin resistance of the mutant--i.e., a decrease in the Km for dCTP. The results also indicate that an altered DNA polymerase alpha may be intrinsically mutagenic during normal semiconservative replicative as well as during UV-induced repair syntheses.

We have selected a group of Escherichia coli promoters from random DNA sequences by replacing 19 base pairs at the -35 promoter region of the tetracycline resistance gene tetr of the plasmid pBR322. Substitution of 19 base pairs with chemically synthesized random sequences results in a maximum of 4(19) (about 3 X 10(11)) possible replacement sequences. From a population of about 1000 bacteria harboring plasmids with these random substitutions, tetracycline selection has revealed several functional -35 promoter sequences. These promoters have retained only partial homology to the -35 promoter consensus sequence. In three of these promoters, the consensus alignment shifts 10 nucleotides downstream, allowing the RNA polymerase to recognize another Pribnow box from within the original pBR322 sequence. Two of the sequences promote transcription more strongly than the native promoter. This technique may have application for the selection of additional DNA sequences with varied biological activity.

Two families of platelet phospholipase A2 activity, were chromatographically resolved by anion exchange chromatography and were functionally distinguishable by their differential phospholipid subclass substrate specificity and calcium ion requirements. The major phospholipase A2 activity was present in the cytosolic compartment, eluted from DEAE-cellulose at 230 mM NaCl (hereafter referred to as phospholipase A2(beta)), and demonstrated a 100-fold selectivity in catalyzing the hydrolysis of 1-(O)-(Z)-hexadecenyl-2-oleoyl-sn-glycero-3-phosphocholine (plasmenylcholine) in comparisons with 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (phosphatidylcholine). Phospholipase A2(beta) was purified to homogeneity by sequential gel filtration and Mono Q column chromatographies. Phospholipase A2(beta) eluted with an apparent molecular mass of 58 kDa during gel filtration chromatography and migrated as a single band with an apparent molecular mass of 30 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, indicating that its native quaternary structure is dimeric. Fast protein liquid chromatography demonstrated that the polypeptides catalyzing this activity were comprised of multiple isoforms which possessed different specific activities. Each isoform required Ca2+ ion for activity and was completely activated over the range through which Ca2+ ion concentration is augmented in stimulated platelets (i.e. 300-800 nM).

The effect of pyrophosphate on the fidelity of in vitro DNA synthesis has been examined. Pyrophosphate enhances misincorporation by Escherichia coli DNA polymerase I in copying phi X174 DNA. The increased misincorporation is directly proportional to the extent of inhibition of the rate of polymerization. In contrast, pyrophosphate is not detectably mutagenic with avian myeloblastosis virus DNA polymerase or DNA polymerases alpha and beta from animal cells, which lack associated proofreading activities. This suggests that increased misincorporation by pyrophosphate is not due to an increase in misinsertions by DNA polymerase, but rather due to inhibition of proofreading by pyrophosphate. However, the pyrophosphate-induced infidelity has a different specificity from, and is not competitive with, two experimental markers of 3'----5' exonuclease proofreading; i.e. the effects of the next nucleotide or the addition of deoxynucleoside monophosphates. These distinctive features suggest a second mode of proofreading susceptible to inhibition by pyrophosphate. This concept is discussed in relation to models for proofreading described in the literature.

The mechanism of enhancement of DNA polymerase activity by the murine DNA-binding protein factor D was investigated. Extension by Escherichia coli DNA polymerase I and calf thymus DNA polymerase-alpha of 5′-32P-labeled oligodeoxynucleotide primers that are complementary to poly(dT) or to bacteriophage M13 DNA was measured in the absence or presence of factor D. With 5′-[32P](dA)9.poly(dT), factor D enables E. coli polymerase I to fill approximately 15-nucleotide gaps between adjacent primers; whereas in the absence of the stimulatory protein, poly(dT) is not copied significantly. In order to study the nucleotide specificity of synthesis enhancement, we used M13mp10 DNA containing 4 consecutive thymidine residues downstream from the 3-hydroxyl terminus of an oligonucleotide primer. Upon addition of factor D, both polymerase I and polymerase-alpha can traverse this sequence more efficiently and thus generate longer DNA products. Densitometric analysis of nonextended and elongated 5′-32P-labeled M13 primer indicates that, without changing the frequency of primer utilization, factor D enhances the activity of these DNA polymerases by increasing their apparent processivity. By positioning oligonucleotide primers 4, 8, and 12 bases upstream from the (dT)4 template sequence, we show that the enhancement of synthesis by factor D is independent of the position of the oligothymidine cluster. We hypothesize that factor D interacts with oligo(dT).oligo(dA) domains in DNA to alter their conformation, which may normally obstruct the progression of DNA polymerases.